Identification of five anti-lipopolysaccharide factors in oriental river prawn, Macrobrachium nipponense

Fish & Shellfish Immunology 46 (2015) 252e260

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification of five anti-lipopolysaccharide factors in oriental river prawn, Macrobrachium nipponense Yili Wang a, 1, Ting Tang a, b, 1, Jihai Gu a, Xiang Li a, Xue Yang a, Xiaobin Gao c, Fengsong Liu a, b, *, Jianhui Wang c, ** a b c

College of Life Sciences, Hebei University, Baoding, Hebei, China The Key Laboratory of Zoological Systematics and Application, College of Life Sciences, Hebei University, Baoding, Hebei, 071002, China Department of Pathology, Yale University, New Haven, CT, USA

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 May 2015 Received in revised form 25 June 2015 Accepted 1 July 2015 Available online 6 July 2015

Anti-lipopolysaccharide factors (ALFs) are a group of antimicrobial peptides (AMPs) with broad-spectrum antimicrobial activities and antiviral activities mainly found in crustaceans and horseshoe crabs. In the present study, we identified 5 ALF expression sequence tags (ESTs) through analysis of the established M. nipponense transcriptome, and cloned their full-length cDNA sequences using rapid amplification of cDNA ends (RACE) method. The 5 ALFs were designated as MnALF1-5, and all of them showed high similarity with their Macrobrachium rosenbergii homologs in the phylogenetic analyses, especially in LPS binding domains. In healthy adult prawns, we found the highest expression of MnALF2 and MnALF4 in haemocytes, and the highest expression of MnALF4 and MnALF3 in intestine. Some isoforms of MnALF were down-regulated but the majority was up-regulated in different prawn tissues upon Aeromonas hydrophila challenge. To conform the expected antimicrobial activities harbored in MnALFs' LPS binding domains, we used a synthesized peptide cMnALF24 that corresponds to the LPS binding domain of MnALF2 as a representative molecule for the antibacterial activity test, and found that cMnALF24 possessed strong and broad-spectrum antibacterial activity against Gram positive and Gram negative bacteria, but no inhibition activity against fungi; Meanwhile, in the hemolytic test, cMnALF24 showed weak hemolysis activities (around 10%) to the rabbit red blood cells at concentrations of 0.67e33.50 mM. This study provides insights into understanding the antibacterial function of ALFs in the innate immunity of freshwater prawn, and reports a peptide that can be a potential drug candidate with good efficacy against bacterial infection and low toxicity to host cells. © 2015 Published by Elsevier Ltd.

Keywords: Anti-lipopolysaccharide factors Innate immunity Antimicrobial activity Macrobrachium nipponense

1. Introduction Like other invertebrates, crustaceans rely on innate immunity as their primary mechanism of defense against pathogens due to the absence of lymphocytes and functional antibody. Antimicrobial peptides (AMPs), as essential components of the front line host defense against microbe infection in invertebrate immune system, carry a broad spectrum of microbicidal activity to bacteria, fungi, parasites, and viruses [1e3]. Several categories of AMPs in

* Corresponding author. College of Life Sciences, Hebei University, Baoding 071002, Hebei, China. ** Corresponding author. 310 Cedar St FMB402, New Haven, CT 06510, USA. E-mail addresses: [email protected] (F. Liu), [email protected] (J. Wang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2015.07.003 1050-4648/© 2015 Published by Elsevier Ltd.

crustaceans, such as penaeidins, lysozymes, crustins, stylicins and anti-lipopolysaccharide factors (ALFs), have been described with common structural features or conserved sequence motifs [4]. As one type of AMPs with binding and neutralizing activities to lipopolysaccharide (LPS), ALFs were initially isolated and characterized from the horseshoe crabs Limulus polyphemus [5]. Over the past decades, ALFs have been isolated and characterized in various crustaceans, including Litopenaeus setiferus [6,7], Fenneropenaeus chinensis [7e9], Penaeus monodon [10], Marsupenaeus japonicus [11], Litopenaeus vannamei [12], Macrobrachium olfersii [13], Macrobrachium rosenbergii [14,15], Procambarus clarkii [16], Scylla paramamosain [17e19], Scylla serrata [20,21], Pacifastacus leniusculus [22], Eriocheir sinensis [23] and Portunus trituberculatus [24e28]. Many isoforms of ALFs usually coexist in one species with diverse functions and different expression profiles. For instance, six (ALFPm1-6), seven (PtALF1-7), and seven (ALFFc, FcALF1-6) ALF

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

isoforms respectively from P. monodon [29,30], P. trituberculatus [24,26e28] and F. chinensis [8,31] were identified. Most crustacean ALFs were reported to be involved in immune defense against bacteria, fungi, or virus infection [10,14,19,32e34], and the transcriptional expression levels of most identified ALFs in crustaceans were usually up-regulated in response to bacterial or viral infection. ALFs from freshwater prawns have not yet been fully elucidated [28]. The oriental river prawn Macrobrachium nipponense, a member of the Palaemonidae family of decapod crustaceans, widely distributing in freshwater and low-salinity estuarine regions in China and other Asian countries [35], is an important commercial prawn species and supports a large part of freshwater prawn fishery and aquaculture in China. However, with the development of intensive culture, various bacterial diseases such as “soft-shell syndrome” resulted from the pathogenic Aeromonas veronii and “red gill disease” from Aeromonas hydrophila caused mass mortality and greatly damaged the fishery [36]. Studies on the innate immune defense mechanisms of M. nipponense will provide new insights into prawn diseases prevention or treatment. In the present study, five ALF isoforms (MnALF1-5) were identified and characterized from M. nipponense, and a peptide corresponding to the LPS binding domain of MnALF2 was synthesized and its antimicrobial activities were analyzed. The distribution and expression profiles of MnALFs upon bacterial challenge were also established in this study. 2. Materials and methods 2.1. Prawns, immune challenge and tissue sampling Healthy prawns M. nipponense with average body weight of 3.25 g were obtained from Baiyang Lake in Hebei province, China. All the samples were maintained in 50-L tanks with aerated freshwater at 22 ± 1
C for one week prior to experimentation in the laboratory. Stocking densities were generally maintained at four to five prawns per square meter, and artificial feed was provided twice per day. Hemolymph was drawn from the first abdominal segment of six prawns in an equal volume of anticoagulant (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH 7). Haemocytes were isolated by centrifugation at 800 g for 10 min and immediately preserved in liquid nitrogen. At the same time, other tissues of these prawns including intestine, muscle, gill, and hepatopancreas were taken and preserved in liquid nitrogen to determine the tissue distribution of the target genes. The temporal expression profiles were analyzed after injecting a 20-ml suspension of A. hydrophila (2  107 CFU) in physiologic saline solution into the abdominal segment of M. nipponense. Gill, intestine, haemocytes, and hepatopancreas from five prawns were collected at different time points postinjection and preserved for quantitative real-time PCR (qPCR) analysis. 2.2. RNA isolation and cDNA synthesis Total RNA was extracted from various tissues with Trizol reagent (Invitrogen) following the manufacturer's protocol and treated with RQ1 RNase-Free DNase (Promega) to remove contaminated DNA. cDNA was synthesized from 3 mg total RNA by M-MLV reverse transcriptase (Promega) following the manufacturer's protocol with an universal primer AOLP (Table 1). 2.3. Cloning and sequencing of ALF cDNA Protein sequences of ALFs from M. rosenbergii [7,15] were used to query the M. nipponense transcriptomes [37,38] using CLC Main

253

Table 1 Primers used in this study. Primer name

Sequences(50

30 )

MnALF1-F MnALF2-F MnALF3-F MnALF4-F MnALF5-F AOLP AP MnALF1-RT-F MnALF1-RT-R MnALF2-RT-F MnALF2-RT-R MnALF3-RT-F MnALF3-RT-R MnALF4-RT-F MnALF4-RT-R MnALF5-RT-F MnALF5-RT-R

AATTCAATCCAGCCGTTTTATTCCG ATCATTAGCGTCCTGTTGGG ATGTGCAGTCTGTGGCTATAGTTTG ATAGATACCTTTGACCTTGGAATAC GCTTTGTTGACATTCAGCATTCTTC GGCCACGCGTCGACTAGTAC(T)16(A/C/G) GGCCACGCGTCGACTAGTAC CGGACTGTGGGAGACAGGTGA CTGCGACGGCTTCGTTCACTA GGGCTATGGCGAAGTGGAGAC GCTTTGTTGACCACGCTTGAGT CAGAAGATCCCAGCGTTGATT CAGGAGTTCCATGTCTCCCTC ACCTGGCATACGCTGTGAACT GCCCTGAGCTTCACAAGTGG TGTCTCCCTCATCATACACTCCA CGATACAACAGTGACCCAAAGAT

Workbench 5.5 with the tBLASTn program with a cutoff E-value of 105. Tentative matches were checked by searching the NCBI nr database using BLASTn for gene prediction errors. Five putative ALF sequences were obtained, and accordingly, gene-specific forward primers were designed within 50 untranslated region (UTR) to clone the 30 fragments of ALF genes with anchor primer AP (the primer sequences in Table 1). The PCR reactions were conducted and the products were cloned into the pMD18-T vector (TaKaRa) and sequenced in both directions. The sequencing results were verified and then subjected to cluster analysis. 2.4. Nucleotide sequences and bioinformatics analyses The cDNA clones were sequenced and deduced amino acid sequences were obtained using an ORF finder program (http://ncbi. nlm.nih.gov/gorf/gorf.html). Sequences were analyzed based on the protein databases using the BLASTp program at NCBI (http:// www.ncbi.nlm.nih.gov/BLAST/). SignalP 4.1 program was utilized to predict the presence and location of signal peptides in these amino acid sequences (http://www.cbs.dtu.dk/services/SignalP/). Multiple sequence alignments of ALFs were carried out using the Clustal W program. The predicted mature peptides of a total of 56 ALFs from crustaceans, including shrimp, freshwater prawn, crab, crayfish, and lobster were used to construct a Neighbor-Joining tree using MEGA 5.0 with the horseshoe crab ALF sequence as outgroup (GenBank no. AAK00651.1) [39]. The structural models of the mature MnALFs were created using Swiss-Model server (http:// swissmodel.expasy.org/) base on the structure of ALFPm3 [40]. 2.5. Quantitative analysis of MnALF1-5 transcript expression The mRNA expression of ALFs in various tissues were determined by qPCR, including intestine, muscle, gill, hepatopancreas and haemocytes of untreated prawns, and intestine, gill, hepatopancreas, and haemocytes of prawns after A. hydrophila challenge. First, total RNA from different tissues and haemocytes were extracted using Trizol reagent and the first-strand cDNA was synthesized using M-MLV reverse transcriptase. For the next step the cDNA was diluted 20e80 times by DEPC-treated water. The SYBR Green PCR assay was carried out in a LightCycler 96 System (Roche). The gene-specific primers of quantitative PCR were designed and presented in Table 1. The PCR was carried out in a total volume of 20 ml, containing 10 ml 2  SYBR Premix Ex Taq (TaKaRa), 4 ml diluted cDNA, 0.8 ml each primer (10 mM), and 4.4 ml sterile distilled H2O. The PCR program was 95
C for 3 min, followed by 40 cycles of

254

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

95
C for 10 s and 60
C for 10 s, melting cure was performed at the end of qPCR reaction at 65e95
C (in 0.5
C increments) for 10 s. Each sample was run in triplicate along with the internal control gene. b-actin was used as the reference gene for normalization of target genes expression. The relative quantification (comparative method) was calculated using the DDCt method [41]. All samples were normalized to the DCt value of a reference gene to obtain a DDCt value (DCt target  DCt reference). The final relative expression was calculated using the following formula: F ¼ 2DDCt. The data obtained from qPCR were analyzed for statistical significance using Graph-Pad Prism [42]. The significance at P < 0.05 was analyzed using one-way ANOVA. Quantitative data were expressed as means ± SD. 2.6. Peptide synthesis The putative LPS binding region of MnALF2 corresponding to amino acids 38e61 of the mature protein was commercially synthesized in a cyclic (cMnALF24) form by Shanghai Mocell biotech Co., Ltd. (Shanghai, China). Synthesized peptide was purified by using a high performance liquid chromatograph (HPLC) with a preparative C18 reverse-phase column, and the purity (>98%) and molecular mass were analyzed by mass spectrometry followed by amino acid composition analysis. Primary linear form of peptide lMnALF24 was cyclized to synthesize cyclic form of cMnALF24 by oxidation of the cystine residues. The synthesized peptide was diluted with sterile deionized water to different concentrations, and applied directly to antimicrobial assays.

agitation. After a 5-min centrifugation at 3500 rpm, the supernatants were collected and their absorbance was measured at 405 nm. Zero hemolysis (negative control) and 100% hemolysis (positive control) were determined in phosphate buffered saline and Triton X-100, respectively. Hemolytic assay was performed with three replicates. 3. Results 3.1. Molecular cloning of five MnALFs Upon searching the transcriptomic libraries of M. nipponense, five expression sequence tags (ESTs) of ALFs were identified. The 30 RACE primers were designed according to the corresponding EST sequences. The cDNA sequences of the five ALFs were determined by PCR, and the amino acid sequences were obtained using an ORF finder program. All MnALFs held high identity with the known ALFs in crustaceans. The cDNA of MnALFs encoded proteins that contained 121 to 135 amino acid residues. The nucleotide and deduced amino acid sequences of MnALFs are shown in Fig. 1. The N-terminus of all the MnALFs had the consistent feature of a signal peptide as defined by SignalP program. The physicochemical properties of each MnALF cDNA are summarized in Table 2. 3.2. Homologous and phylogenetic analysis of MnALFs

The bacterial and fungal strains used in the tests were gifts from Prof. Shunyi Zhu, Institute of Zoology, Chinese Academy of Sciences and Prof. Hongquan Li, School of Basic Medicine, Hebei University. Minimum inhibitory concentrations (MICs) were determined in duplicate by the liquid growth inhibition assay as previously described [43]. Briefly, 10 ml of each dilution (sterile deionized water as a control) were incubated in sterile microtiter plates (96 wells) with 100 ml of a suspension of mid-logarithmic-phase culture of bacteria at a starting optical density of OD600 ¼ 0.001, or with 80 ml of fungal spores (final concentration 104 spores/ml) and 10 ml of water. Poor-broth nutrient medium (1% bactotryptone, 0.5% NaCl w/v, pH 7.5) was used for standard bacterial cultures. Antifungal assays were performed in potatoes dextrose broth (Difco) at half-strength supplemented with 10 mg/ml tetracycline. Bacteria were grown during 24 h under vigorous shaking at 30
C. Fungi were grown at 25
C in the dark without shaking for 48 h in a moist chamber. Microbial growth was controlled by measurement of the optical density at OD600 after a-24 h incubation. Inhibition of filamentous fungi growth was observed at microscopic level after 24 h and measured at 600 nm after 48 h. The MIC values are expressed as the range between the highest concentration of the peptide where bacterial growth was observed and the lowest concentration that caused 100% inhibition of bacterial growth [44].

BLAST analysis of the amino acid sequences revealed the relation of MnALFs to their homologs present in other decapod crustaceans. All five MnALFs shared the highest similarity to the ALF isoforms of M. rosenbergii (Table 3). MnALF1-4 showed 81%e90% identity to the M. rosenbergii ALF isoforms. However, MnALF5 shared only 43% identity to ALF3 of M. rosenbergii followed by 42% identity to ALF5 of F. chinensis. Multiple sequence alignment revealed that two cysteine residues were highly conserved in MnALFs, and five to seven positively charged residues (K, R and H) existed within the disulfide loop which qualifies as a functional domain. In order to verify the classification status of MnALFs, and to identify the evolutionary relationships among crustacean ALFs, a phylogenetic tree was constructed using neighbor-joining (NJ) method with the deduced mature peptides of the available crustacean ALF sequences in the GenBank (Fig. 2). The phylogenetic tree clearly showed that the crustacean ALFs could be divided into three major groups. Group I consisted of ALFs from penaeid shrimps, freshwater prawns, and lobsters (Homarus americanus). Group II mainly consisted of ALFs from penaeid shrimps, freshwater prawns, and crabs. Another ALF from Palaemon carinicauda was clustered into this group. Palaemon and Macrobrachium both belong to Palaemoninae. Group III was found to consist of ALFs mainly from crabs, and a few from penaeid shrimps and one from crayfish (P. leniusculus). All of the Macrobrachium ALF homologs, including those from M. nipponense, M. rosenbergii, and M. olfersii, were clustered in three small distinct branches, which belonged to group I and II. This tree indicated that MnALFs have a closer evolutionary relationship with their M. rosenbergii homologs.

2.8. Hemolytic activity assay

3.3. Structure analysis of MnALFs

The hemolytic assay of the derived peptide cMnALF24 was performed as described by Dathe et al. [45]. Briefly, the rabbit red blood cells (RBCs) were prepared from freshly collected heparinized rabbit blood (5 ml) by centrifugation at 1500 rpm for 10 min at 4
C. The cells were washed three times with phosphate buffer saline (pH 7.2) and diluted to 10% hematocrite. The RBCs (1%) were mixed with different concentrations of peptide (0.67, 3.35, 6.70, 33.50, and 67.00 mM), and incubated for 1 h at 37
C with gentle

Pairwise sequence alignments showed that the mature peptide of MnALFs shared 37%e59% identity with that of ALFPm3, an ALF isoform from P. monodon. Multiple alignment performed for MnALFs with ALFPm3 revealed the presence of conserved regions within the sequence (Fig. 3). Peptide models of MnALFs created using Swiss-Model server showed a very similar 3D structure, which consisted of three a-helices packed against a four-strand bsheet. Two of the b-strands are in turn linked by a disulfide bond to

2.7. Antimicrobial activity assay

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

255

Fig. 1. Complete nucleotide and deduced amino acid sequences of MnALFs from Macrobrachium nipponense. The underline and box indicate the signal peptides and LPS binding domains respectively.

Table 2 The predicted properties of MnALFs cDNA and their deduced peptides. Gene name

MnALF1

MnALF2

MnALF3

MnALF4

MnALF5

cDNA length (bp) ORF (bp) Amino acid residues Signal peptide length Mature peptide length/Mass (kDa) pI of mature peptide pI of LPS binding domain APD defined total hydrophobic ratio of mature peptide

875 408 135 22 113/12.7 8.0 9.7 37%

1068 402 133 26 107/11.7 8.68 9.59 42%

1004 366 121 20 101/11.7 5.91 9.14 40%

975 375 124 25 99/11.3 9.30 9.79 40%

986 369 122 20 102/11.6 6.33 9.59 39%

256

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

Table 3 Result of BLASTp analysis of MnALFs in Nr database. Query peptide

Top-hit peptide (Accession number)

Query cover

E-value

Identity

MnALF1 MnALF2 MnALF3 MnALF4 MnALF5

anti-lipopolysaccharide anti-lipopolysaccharide anti-lipopolysaccharide anti-lipopolysaccharide anti-lipopolysaccharide

97% 100% 100% 100% 90%

9e-67 1e-65 1e-69 5e-79 1e-26

86% 83% 81% 90% 43%

factor factor factor factor factor

1 [Macrobrachium rosenbergii] (AFW04304.1) 2 [Macrobrachium rosenbergii] (ADI80707.1) 3 [Macrobrachium rosenbergii] (ADI80708.1) [Macrobrachium rosenbergii] (ACG60660.2) 3 [Macrobrachium rosenbergii] (ADI80708.1)

form an amphipathic loop rich in cationic amino acid side chains (figures not shown).

3.4. Tissue distribution qPCR was employed to analyze the tissue distribution of MnALFs. Fig. 4 shows that MnALFs existed in all examined tissues. MnALF1 was mainly expressed in intestine and haemocytes. MnALF2 was predominantly expressed in haemocytes, gill and intestine. Interestingly, MnALF3 had the highest expression level in intestine, followed by gill, hepatopancreas and muscle, and the lowest level in haemocytes. In general, MnALF4 showed robust expression in all detected tissues, in particular in haemocytes and intestine. However, the expression level of MnALF5 in these tissues was the lowest.

3.5. Expression profile after bacterial challenge The effects of bacterial challenge on the gene expressions of the MnALFs in gill, intestine, hepatopancreas, and haemocytes are shown in Fig. 5. In gill, the expression of MnALF4 was enhanced from 3 h post challenge and reached its highest level (approximately 5.2-fold upregulation) at 72 h. MnALF1, 2 and 5 in gill showed similar moderately enhanced expression profiles upon bacterial infection. In contrast, the expression of MnALF3 was decreased during 3e24 h post-injection, and increased at 48 and 72 h. In intestine, almost all the five MnALFs were down-regulated on bacterial challenge, except MnALF1 and 2, which were slightly elevated (approximately 1.3 and 1.5-fold) at 12 h. MnALF5 and MnALF3 had the best performances in hepatopancreas, another important tissue in the immune defense of crustaceans, in the early and late post bacterial injection respectively. In haemocytes, all five MnALFs was all upregulated at 6 and 72 h post injection to various degrees.

3.6. Antimicrobial assay In order to verify the antimicrobial activity of MnALF, we designed and synthesized a cyclic peptide (cMnALF24) based on the putative LPS binding domain of MnALF2. The antimicrobial activity spectrum of the synthetic peptide was investigated against a panel of Gram positive, Gram negative bacteria and fungi strains by the MIC assay (Table 4). The results showed that cMnALF24 could inhibit the growth of all the tested bacteria to different degrees. Potent antimicrobial activities of cMnALF24 were observed on the growth of Bacillus megaterium (3e6 mM), Bacillus cereus (3e7.5 mM), Staphylococcus aureus (15e22.5 mM), and a few important pathogenic strain for aquatic animals, such as Pseudomonas fluorescens (24e27 mM), A. hydrophila (27e30 mM), and Pseudomonas aeruginosa (42e45 mM). cMnALF24 exhibited the weakest inhibitory activity on the growth of Serratia marcescens with MIC value concentration span of 90e120 mM. However, cMnALF24 did not inhibit the growth of all the fungi tested at up to 120 mM.

3.7. Hemolytic activity Different concentrations of cMnALF24 (0.67e67 mM) were tested for hemolytic activity towards rabbit erythrocytes. After 1 h of incubation, weak hemolysis activities (around 10%) had been observed with the cMnALF24 at concentrations of 0.67e33.50 mM. We showed that the synthetic peptide displayed a considerable hemolysis (around 22%) at the high concentration of 67 mM (Fig. 6). 4. Discussion We cloned 5 ALF genes of M. nipponense, and analyzed their structural characteristics. The deduced amino acid sequences of the 5 MnALFs showed a common 22-amino acid domain that was considered to be necessary for LPS binding and neutralization [18]. The MnALFs also showed the conservation of two cysteine residues, which may cause one disulfide bond (loop) formation in the peptide and form b-sheet structures in solution [46]. In previous studies, the cationic and hydrophobic properties of AMPs facilitates their interaction and insertion into the anionic cell walls and phospholipid membranes of microorganisms [47], and thus were believed to be essential to the antimicrobial action. Most of the known AMPs are cationic peptides, which have a positive net charge at physiological pH due to the presence of a higher content in positively charged residues (Arg and Lys) than in negatively charged residues (Asp and Glu) [46]. In our study, the total hydrophobic ratios of the 5 MnALFs were from 37% to 42%, which is in high hydrophobic range. The mature peptides of MnALF2, 3 and 4 are cationic, but those of MnALF1 and 5 are anionic, which reveals possible function differences among those isoforms. However, the LPS binding domains of all the five MnALFs are strongly actionic, whose predicted isoelectric points are more than 9. Depending on their tissue distribution, AMPs ensure either a systemic or a local protection of the host against various pathogens [46]. Previous studies demonstrated that most crustacean ALF transcripts, such as ALFFc from F. chinensis, are mainly expressed in haemocytes and can also be sometimes detected in other tissues [8,18,23]. Some ALF transcripts show the highest level in hepatopancreas, intestine, gill, or other tissues [15,48]. Different tissue distribution patterns of ALFs indicate that these molecules have diverse biological functions. In the present study, transcript expression of MnALFs were detected in all examined tissues of unchallenged freshwater prawns, including haemocytes, hepatopancreas, gill, intestine and muscle, which suggests that ALFs could be multifunctional molecules for the host immune defense responses and thereby provided systemic protection against pathogens. Among the MnALFs, MnALF4 manifests the highest expression levels in all detected tissues, particularly in haemocytes. The universal distribution and strong transcription of MnALF4 indicates its involvement in a broad scope of immune protections. Two other highly expressed genes are MnALF2 and MnALF3, whose highest expression levels appeared in haemocytes and intestine respectively. However, MnALF3 and MnALF5 are expressed at lower levels in haemocytes than in intestine. In crustaceans, haemocytes are systemically circulated and considered to play a key role in both

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

257

Fig. 2. Phylogenetic analysis of crustacean ALFs base on their mature peptides with ALF from Tachypleus tridentatus as outgroup. One thousand bootstraps were performed on the Neighbor-Joining tree to check the repeatability of the result.

258

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

Fig. 3. Multiple alignment of nucleotide sequences of the mature MnALFs from Macrobrachium nipponense with that of ALF-Pm3 (PDB entry: 2job) from Penaeus monodon using CLC Main Workbench 5.5. The LPS binding domains are enclosed with a bracket. The character and size of each sequence logo represent the proportion of an amino acid at the specific site.

Fig. 4. Transcriptional analysis of MnALFs in various tissues of healthy Macrobrachium nipponense by qPCR. The results are based on six independent experiments and expressed as mean values ± S.D. Date (mean ± SD) in the same tissue with different letters (a, b, c, d) are significant (P < 0.05) among the treatments.

cellular and humoral immunity not only by direct sequestration and killing of foreign invaders, but also by synthesis and exocytosis of a battery of bioactive molecules [49e51]. In our previous study, ALFFc from F. chinensis is only detected in haemocytes via in situ hybridization. Transcripts of ALFFc observed in other tissues are probably due to the infiltrating haemocytes [8]. Here in M. nipponense, we didn't find MnALFs that are exclusively expressed in haemocytes. The up-regulation of antimicrobial peptide expression after pathogen infection is a common defense strategy by hosts to rapidly kill invaders. Previous studies showed that the expressions of some ALFs could be induced by bacterial or viral invaders in crustaceans [18,19,23]. Differential expression patterns among different ALFs may suggest a combinational strategy to form a defense network against diverse microbial pathogens. Here, we give a panoramic sketch of ALFs expression profiles in M. nipponense. The

Fig. 5. Transcriptional analyses of MnALFs in different tissues of Macrobrachium nipponense upon bacterial challenge at different time internals. qPCR for MnALF genes was performed with cDNA obtained from gill (a), intestine (b), hepatopancreas (c), and haemocytes (d) followed by Aeromonas hydrophila injection. The results are based on five independent experiments and expressed as mean values ± S.D. Asterisks indicate significant differences (*, P < 0.05; **, P < 0.01) versus the unchallenged samples.

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260 Table 4 The antimicrobial activity of synthetic cMnALF24 peptide determined as MIC. Microorganisms Gram positive bacteria Bacillus cereus Bacillus megaterium Bacillus subtilis Microbacterium oxydans Micrococcus luteus Sporosarcina ureae Staphylococcus aureus Gram negative bacteria Aeromonas hydrophila Agrobacterium tumefaciens Burkholderia stabilis Enterobacter amnigenus Escherichia coli Kluyvera cryocrescens Pseudomonas aeruginosa Pseudomonas fluorescens Salmonella gullinarum Salmonella typhi Salmonella typhimurium Serratia marcescens Shigella dysenteriae Fungi Pichia pastoris Leuconostoc mesenteroides Phytophthora infestans Sickle bacteria

MIC value (mM) 3e7.5 3e6 36e39 30e37.5 24e27 45e54 15e22.5 27e30 45e60 22.5e30 30e37.5 39e45 22.5e30 42e45 24e27 15e22.5 22.5e30 45 90e120 30e37.5 e e e e

Serial dilutions of peptide (1e120 mM) were tested against bacteria and fungi. MICs are expressed as the interval a-b, where a is the highest concentration tested at which microorganisms are able to grow and b the lowest concentration that causes 100% growth inhibition.

diversity of ALFs in prawn might render the multiple and cooperated functions in host immunity. Considering their differences in structure, tissue distribution, and expression profiles in response to invading pathogen, it was speculated that MnALFs might collectively involve in prawn immunity against various pathogens, and perform antimicrobial activities against some special pathogens

259

either with cooperation or solo performance. We synthesized a peptide, cMnALF24, containing the putative LPS binding domain of MnALF2 to verify its antimicrobial activity. Results of antimicrobial assay showed that cMnALF24 was able to inhibit the growth of both gram positive and negative bacteria tested here with differential potency. It displayed the strongest inhibitory effect on the Gram positive bacteria B. megaterium and B. cereus. Interestingly, cMnALF24 possessed potent antibacterial activities against P. fluorescens, P. aeruginosa, and A. hydrophila, which were found to be highly pathogenic bacteria among many isolated ones from aquatic animals. Significant economic loss to freshwater prawn has been reported owing to opportunistic pathogen infections, including A. hydrophila [52]. It was reported that bacterial endotoxins are the causative agents of crayfish mortality injected with A. hydrophila [53]. So we speculated that ALFs could protect the freshwater prawn from the invading pathogens through neutralizing the toxicity of LPS and killing them directly. In addition, cMnALF24 showed a strong antibacterial activity against S. aureus (MIC ¼ 15e22.5 mM), Salmonella typhi (MIC ¼ 22.5e30 mM) and Shigella dysenteriae (MIC ¼ 30e37.5 mM), which are highly pathogenic for human. This implies that ALFs might be a potential candidate as a substitute for conventional antibiotics. However, no obvious antifungal activity of cMnALF24 was observed against yeast Pichia pastoris, similar to most crustacean ALFs, such as ALFs from S. paramamosain [18], H. americanus [49], S. serrata [54], and E. sinensis [55]. In order to further evaluate the prawn ALFs in terms of therapeutic feature, the toxicity of cMnALF24 considering its effect on rabbit red blood cells was measured. The results showed that cMnALF24 displayed a weak hemolysis activity (around 10%) at 33.5 mM. A stronger hemolysis (around 22%) was observed when the concentration of cMnALF24 reached 67 mM. cMnALF24 is a considerable drug candidate since its toxicity on mammalian cells are not too high. It is promising for pharmaceutical industry to design novel peptides based on these natural antimicrobial peptides, after some necessary modifications to reach minimal side effects on human. Taken together, in this study we cloned the genes, investigated the expression of ALFs and discovered a peptide functioning as a potential drug candidate. However, we didn't investigate antibacterial activities of all the 5 ALF isoforms due to the fund limitation. It will be interesting to study the antibacterial function differences of all the different MnALFs in future, since increasing evidences showed that multiple isoforms of ALF existing in crustaceans exhibit distinct immune functions. Acknowledgments This work was financially supported by Natural Science Foundation of China (31301925), and the Natural Science Foundation of Hebei Province (No. C2014201167, C2015201013). References

Fig. 6. Hemolytic activity of the synthetic peptide cMnALF24. Different concentrations of cMnALF24 were tested for hemolytic activity towards rabbit erythrocytes. Positive control and negative control were determined in Triton X-100 and phosphate buffered saline, respectively. Hemolytic assay was performed with three replicates and error bars represent SD.

[1] K.L. Brown, R.E. Hancock, Cationic host defense (antimicrobial) peptides, Curr. Opin. Immunol. 18 (2006) 24e30. [2] R.E. Hancock, K.L. Brown, N. Mookherjee, Host defence peptides from invertebrateseemerging antimicrobial strategies, Immunobiology 211 (2006) 315e322. [3] N.C. Silva, B. Sarmento, M. Pintado, The importance of antimicrobial peptides and their potential for therapeutic use in ophthalmology, Int. J. Antimicrob. Agents 41 (2013) 5e10. [4] A. Tassanakajon, K. Somboonwiwat, P. Supungul, S. Tang, Discovery of immune molecules and their crucial functions in shrimp immunity, Fish Shellfish Immunol. 34 (2013) 954e967. [5] S. Tanaka, T. Nakamura, T. Morita, S. Iwanaga, Limulus anti-LPS factor: an anticoagulant which inhibits the endotoxin mediated activation of Limulus coagulation system, Biochem. Biophys. Res. Commun. 105 (1982) 717e723.

260

Y. Wang et al. / Fish & Shellfish Immunology 46 (2015) 252e260

[6] P.S. Gross, T.C. Bartlett, C.L. Browdy, R.W. Chapman, G.W. Warr, Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus, Dev. Comp. Immunol. 25 (2001) 565e577. [7] S. Li, S. Guo, F. Li, J. Xiang, Characterization and function analysis of an antilipopolysaccharide factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis, Dev. Comp. Immunol. 46 (2014) 349e355. [8] F. Liu, Y. Liu, F. Li, B. Dong, J. Xiang, Molecular cloning and expression profile of putative antilipopolysaccharide factor in Chinese shrimp (Fenneropenaeus chinensis), Mar. Biotechnol. (NY) 7 (2005) 600e608. [9] T. Tang, L. Li, L. Sun, J. Bu, S. Xie, F. Liu, Functional analysis of Fenneropenaeus chinensis anti-lipopolysaccharide factor promoter regulated by lipopolysaccharide and (1,3)-beta-D-glucan, Fish Shellfish Immunol. 38 (2014) 348e353. [10] K. Somboonwiwat, M. Marcos, A. Tassanakajon, S. Klinbunga, A. Aumelas, B. Romestand, et al., Recombinant expression and anti-microbial activity of anti-lipopolysaccharide factor (ALF) from the black tiger shrimp Penaeus monodon, Dev. Comp. Immunol. 29 (2005) 841e851. [11] H. Nagoshi, H. Inagawa, K. Morii, H. Harada, C. Kohchi, T. Nishizawa, et al., Cloning and characterization of a LPS-regulatory gene having an LPS binding domain in kuruma prawn Marsupenaeus japonicus, Mol. Immunol. 43 (2006) 2061e2069. [12] E. de la Vega, N.A. O'Leary, J.E. Shockey, J. Robalino, C. Payne, C.L. Browdy, et al., Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection, Mol. Immunol. 45 (2008) 1916e1925. [13] R.D. Rosa, P.H. Stoco, M.A. Barracco, Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps, Fish Shellfish Immunol. 25 (2008) 693e696. [14] C.C. Liu, C.P. Chung, C.Y. Lin, H.H. Sung, Function of an anti-lipopolysaccharide factor (ALF) isoform isolated from the hemocytes of the giant freshwater prawn Macrobrachium rosenbergii in protecting against bacterial infection, J. Invertebr. Pathol. 116 (2014) 1e7. [15] Q. Ren, Z.Q. Du, M. Li, C.Y. Zhang, K.P. Chen, Cloning and expression analysis of an anti-lipopolysaccharide factor from giant freshwater prawn, Macrobrachium rosenbergii, Mol. Biol. Rep. 39 (2012) 7673e7680. [16] C. Sun, W.T. Xu, H.W. Zhang, L.P. Dong, T. Zhang, X.F. Zhao, et al., An antilipopolysaccharide factor from red swamp crayfish, Procambarus clarkii, exhibited antimicrobial activities in vitro and in vivo, Fish Shellfish Immunol. 30 (2011) 295e303. [17] C. Imjongjirak, P. Amparyup, A. Tassanakajon, Molecular cloning, genomic organization and antibacterial activity of a second isoform of antilipopolysaccharide factor (ALF) from the mud crab, Scylla paramamosain, Fish Shellfish Immunol. 30 (2011) 58e66. [18] C. Imjongjirak, P. Amparyup, A. Tassanakajon, S. Sittipraneed, Antilipopolysaccharide factor (ALF) of mud crab Scylla paramamosain: molecular cloning, genomic organization and the antimicrobial activity of its synthetic LPS binding domain, Mol. Immunol. 44 (2007) 3195e3203. [19] L. Zhu, J.F. Lan, Y.Q. Huang, C. Zhang, J.F. Zhou, W.H. Fang, et al., SpALF4: a newly identified anti-lipopolysaccharide factor from the mud crab Scylla paramamosain with broad spectrum antimicrobial activity, Fish Shellfish Immunol. 36 (2014) 172e180. [20] V.V. Afsal, S.P. Antony, N. Sathyan, R. Philip, Molecular characterization and phylogenetic analysis of two antimicrobial peptides: anti-lipopolysaccharide factor and crustin from the brown mud crab, Scylla serrata, Results Immunol. 1 (2011) 6e10. [21] S. Sharma, R.D. Yedery, M.S. Patgaonkar, C. Selvaakumar, K.V. Reddy, Antibacterial activity of a synthetic peptide that mimics the LPS binding domain of Indian mud crab, Scylla serrata anti-lipopolysaccharide factor (SsALF) also involved in the modulation of vaginal immune functions through NF-kB signaling, Microb. Pathog. 50 (2011) 179e191. [22] H. Liu, P. Jiravanichpaisal, I. Soderhall, L. Cerenius, K. Soderhall, Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus, J. Virol. 80 (2006) 10365e10371. [23] C. Li, J. Zhao, L. Song, C. Mu, H. Zhang, Y. Gai, et al., Molecular cloning, genomic organization and functional analysis of an anti-lipopolysaccharide factor from Chinese mitten crab Eriocheir sinensis, Dev. Comp. Immunol. 32 (2008) 784e794. [24] Y. Liu, Z. Cui, X. Li, C. Song, Q. Li, S. Wang, Molecular cloning, expression pattern and antimicrobial activity of a new isoform of anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus, Fish Shellfish Immunol. 33 (2012) 85e91. [25] Y. Liu, Z. Cui, X. Li, C. Song, Q. Li, S. Wang, A new anti-lipopolysaccharide factor isoform (PtALF4) from the swimming crab Portunus trituberculatus exhibited structural and functional diversity of ALFs, Fish Shellfish Immunol. 32 (2012) 724e731. [26] Y. Liu, Z. Cui, X. Li, C. Song, G. Shi, A newly identified anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus with broad spectrum antimicrobial activity, Fish Shellfish Immunol. 34 (2013) 463e470. [27] Y. Liu, Z. Cui, X. Li, C. Song, G. Shi, C. Wang, Molecular cloning, genomic structure and antimicrobial activity of PtALF7, a unique isoform of antilipopolysaccharide factor from the swimming crab Portunus trituberculatus, Fish Shellfish Immunol. 34 (2013) 652e659. [28] Y. Liu, Z. Cui, W. Luan, C. Song, Q. Nie, S. Wang, et al., Three isoforms of anti-

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36]

[37]

[38]

[39]

[40]

[41] [42] [43] [44]

[45]

[46] [47] [48]

[49]

[50] [51] [52]

[53]

[54]

[55]

lipopolysaccharide factor identified from eyestalk cDNA library of swimming crab Portunus trituberculatus, Fish Shellfish Immunol. 30 (2011) 583e591. S. Ponprateep, S. Tharntada, K. Somboonwiwat, A. Tassanakajon, Gene silencing reveals a crucial role for anti-lipopolysaccharide factors from Penaeus monodon in the protection against microbial infections, Fish Shellfish Immunol. 32 (2012) 26e34. P. Supungul, S. Klinbunga, R. Pichyangkura, I. Hirono, T. Aoki, A. Tassanakajon, Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach, Dis. Aquat. Org. 61 (2004) 123e135. S. Li, X. Zhang, Z. Sun, F. Li, J. Xiang, Transcriptome analysis on Chinese shrimp Fenneropenaeus chinensis during WSSV acute infection, PLoS One 8 (2013) e58627. S. Ponprateep, K. Somboonwiwat, A. Tassanakajon, Recombinant antilipopolysaccharide factor isoform 3 and the prevention of vibriosis in the black tiger shrimp, Penaeus monodon, Aquaculture 289 (2009) 219e224. S. Tharntada, S. Ponprateep, K. Somboonwiwat, H.P. Liu, I. Soderhall, K. Soderhall, et al., Role of anti-lipopolysaccharide factor from the black tiger shrimp, Penaeus monodon, in protection from white spot syndrome virus infection, J. Gen. Virol. 90 (2009) 1491e1498. S. Tharntada, K. Somboonwiwat, V. Rimphanitchayakit, A. Tassanakajon, Antilipopolysaccharide factors from the black tiger shrimp, Penaeus monodon, are encoded by two genomic loci, Fish Shellfish Immunol. 24 (2008) 46e54. K. Ma, J. Feng, J. Lin, J. Li, The complete mitochondrial genome of Macrobrachium nipponense, Gene 487 (2011) 160e165. Z. Ding, Y. Kong, L. Chen, J. Qin, S. Sun, M. Li, et al., A clip-domain serine proteinase homolog (SPH) in oriental river prawn, Macrobrachium nipponense provides insights into its role in innate immune response, Fish Shellfish Immunol. 39 (2014) 336e342. S. Jin, H. Fu, Q. Zhou, S. Sun, S. Jiang, Y. Xiong, et al., Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000, PLoS One 8 (2013) e76840. K. Ma, G. Qiu, J. Feng, J. Li, Transcriptome analysis of the oriental river prawn, Macrobrachium nipponense using 454 pyrosequencing for discovery of genes and markers, PLoS One 7 (2012) e39727. K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 2731e2739. Y. Yang, H. Boze, P. Chemardin, A. Padilla, G. Moulin, A. Tassanakajon, et al., NMR structure of rALF-Pm3, an anti-lipopolysaccharide factor from shrimp: model of the possible lipid A-binding site, Biopolymers 91 (2009) 207e220. T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protoc. 3 (2008) 1101e1108. M.L. Swift, GraphPad prism, data analysis, and scientific graphing, J. Chem. Inf. Comput. Sci. 37 (1997) 411e412. T. Tang, X. Li, X. Yang, X. Yu, J. Wang, F. Liu, et al., Transcriptional response of Musca domestica larvae to bacterial infection, PLoS One 9 (2014) e104867. P. Casteels, C. Ampe, F. Jacobs, P. Tempst, Functional and chemical characterization of Hymenoptaecin, an antibacterial polypeptide that is infectioninducible in the honeybee (Apis mellifera), J. Biol. Chem. 268 (1993) 7044e7054. M. Dathe, M. Schumann, T. Wieprecht, A. Winkler, M. Beyermann, E. Krause, et al., Peptide helicity and membrane surface charge modulate the balance of electrostatic and hydrophobic interactions with lipid bilayers and biological membranes, Biochemistry 35 (1996) 12612e12622. P. Bulet, R. Stocklin, L. Menin, Anti-microbial peptides: from invertebrates to vertebrates, Immunol. Rev. 198 (2004) 169e184. Z. Oren, Y. Shai, Mode of action of linear amphipathic alpha-helical antimicrobial peptides, Biopolymers 47 (1998) 451e463. Y. Zhang, L. Wang, L. Wang, J. Yang, Y. Gai, L. Qiu, et al., The second antilipopolysaccharide factor (EsALF-2) with antimicrobial activity from Eriocheir sinensis, Dev. Comp. Immunol. 34 (2010) 945e952. K.M. Beale, D.W. Towle, N. Jayasundara, C.M. Smith, J.D. Shields, H.J. Small, et al., Anti-lipopolysaccharide factors in the American lobster Homarus americanus: molecular characterization and transcriptional response to Vibrio fluvialis challenge, Comp. Biochem. Physiol. D Genomics Proteomics 3 (2008) 263e269. P. Roch, Defense mechanisms and disease prevention in farmed marine invertebrates, Aquaculture 172 (1999) 125e145. V.J. Smith, J.H. Brown, C. Hauton, Immunostimulation in crustaceans: does it really protect against infection? Fish Shellfish Immunol. 15 (2003) 71e90. J. Shen, D. Qian, W. Liu, W. Yin, Z. Shen, Z. Cao, Y. Wu, N. Zhang, Studies on the pathogens of bacterial diseases of Macrobrachium nipponense [J], J. Zhejiang Ocean Univ. 3 (2000) 004. P. Jiravanichpaisal, S. Roos, L. Edsman, H. Liu, K. Soderhall, A highly virulent pathogen, Aeromonas hydrophila, from the freshwater crayfish Pacifastacus leniusculus, J. Invertebr. Pathol. 101 (2009) 56e66. R.D. Yedery, K.V. Reddy, Identification, cloning, characterization and recombinant expression of an anti-lipopolysaccharide factor from the hemocytes of Indian mud crab, Scylla serrata, Fish Shellfish Immunol. 27 (2009) 275e284. L. Wang, Y. Zhang, J. Yang, Z. Zhou, Y. Gai, L. Qiu, et al., A new antilipopolysaccharide factor (EsALF-3) from Eriocheir sinensis with antimicrobial activity, Afr. J. Biotechnol. 10 (2013) 17678e17689.