Identification of neuropeptides from eyestalk transcriptome profiling analysis of female oriental river prawn (Macrobrachium nipponense) under hypoxia and reoxygenation conditions

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Identification of neuropeptides from eyestalk transcriptome profiling analysis of female oriental river prawn (Macrobrachium nipponense) under hypoxia and reoxygenation conditions

T

⁎

Shengming Suna,b,d,1, Ying Wub,1, Ivan Jakovlićc, Hongtuo Fua,b,d, , Xianping Geb,d, Hui Qiaod, Wenyi Zhangd, Shubo Jind a

Key Laboratory of Exploration and Utilization of Aquatic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, PR China Wuxi Fishery College, Nanjing Agricultural University, Wuxi 214081, PR China Bio-Transduction Lab, Wuhan, PR China d Key Laboratory of Genetic Breeding and Aquaculture Biology of Freshwater Fishes, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, PR China b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Macrobrachium nipponense Transcriptomics Hypoxia Eyestalk Neuropeptides

The oriental river prawn, Macrobrachium nipponense, is a commercial freshwater prawn species in China. It is highly sensitive to hypoxia, and this has posed a challenge to its intensive culturing. To date, the effects of hypoxia on reproduction in female prawns are not entirely clear, as are the underlying mechanisms of the effects of hypoxia. In this work, comparative transcriptome and gene expression analyses of the eyestalk were performed in M. nipponense females under hypoxia and reoxygenation conditions. Sequencing and de novo assembly of the combined reads yielded 43,583 unigenes with an average length of 1726 bp. A total of 711 genes were found to be differentially expressed in the eyestalk under the hypoxia and reoxygenation conditions. With the help of functional and pathway enrichment analysis of the differentially expressed genes, a novel set of transcripts that were associated with several important functions, such as hormone biosynthesis and progesteronemediated oocyte maturation, were identified. Additionally, ten neuropeptides were identified based on the differentially expressed transcripts, and they were validated by quantitative real-time polymerase chain reaction (qRT-PCR) and reverse transcription PCR (RT-PCR) analyses. Three neuropeptide genes were expressed in the neural tissue and ovary of the prawns; this indicates that they were involved in reproductive processes. In particular, RNA interference (RNAi) short neuropeptide F dramatically promoted ovary maturation, as indicated by the gonad somatic index. While the present findings do indicate that hypoxia affects reproductive function in M. nipponense females, in-depth functional analyses of the candidate neuropeptides should be conducted in the future to understand their role in hypoxia adaptation and the associated mechanisms that affect the reproductive capacity of this species.

1. Introduction The oriental river prawn Macrobrachium nipponense (Decapoda, Palaemonidae) is found over a wide geographic range in East Asian countries (Yu and Miyake, 1972; Cai and Ng, 2002). It has considerable importance as a commercial aquaculture species in China: in 2016, the annual M. nipponense production was about 272,592 tons and the annual output value was close to 20 billion RMB (Bureau of Fishery, 2017). A drawback in the culture of this species is that M. nipponense is sensitive to hypoxic conditions, such as those encountered in intensive

culturing. Especially in high temperature seasons, individuals of the oriental river prawn show high levels metabolism and can, sometimes, die as a result of hypoxia. From the economic point of view, it is important to lower the mortality rate of this species. Therefore, it is important to understand the molecules and pathways that are affected in M. nipponense under hypoxic conditions. In particular, hypoxia can disrupt the synthesis and balance of sex hormones and lead to reproductive impairment in shrimp and fish species (Brown-Peterson et al., 2008; Wu et al., 2003). Therefore, understanding the reproductive factors that are adversely affected under hypoxic conditions

⁎

Corresponding author at: Wuxi Fishery College, Nanjing Agricultural University, Wuxi 214081, PR China. E-mail address: fuht@ffrc.cn (H. Fu). 1 These authors contributed equally to the work. https://doi.org/10.1016/j.cbpb.2019.110392 Received 26 August 2019; Received in revised form 5 December 2019; Accepted 12 December 2019 Available online 15 December 2019 1096-4959/ © 2019 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

followed by recovery under normoxic conditions for 3 h. The eyestalk tissue from four prawn in each treatment tank was pooled together as a single replicate (as the tissue content from a single eyestalk did not suffice as a sample), and frozen immediately upon extraction and stored in liquid nitrogen at −80 °C until analysis. All the experiments were performed in triplicate. The study received the approval of the Institutional Animal Care and Use Ethics Committee of Chinese Academy of Fisheries Science.

in this species is of paramount importance. The eyestalk is a major endocrine center for the production and release of several hormones that play a role in crustacean reproduction (Nagaraju, 2010), and eyestalk ablation is usually used to stimulate ovarian maturation and spawning during captive breeding of crustaceans (Bai et al., 2015; Wang et al., 2019). Neurosecretion of reproduction-associated peptides was first demonstrated in the X-organsinus gland (XO-SG) complex of the crustacean eyestalk (Ollivaux et al., 2006; Christie et al., 2010, 2011; Webster et al., 2012). With the advances in molecular biology technologies, more neuropeptides are being identified and characterized in many species of crustaceans (Christie et al., 2008; Jia et al., 2013), and in particular, neuropeptides synthesized and secreted by the XO-SG complex have been widely studied in crustaceans in the last few years (Devaraj and Natarajan, 2006; Hartenstein, 2006; Harzsch et al., 2009; Chang and Mykles, 2011). Since the XO-SG complex located in the eyestalk plays an important role in the complex neuroendocrine system in crustaceans, some of the neuropeptides secreted from this organ may be involved in the hypoxic response in crustaceans. It would be interesting to investigate the gene expression profile of the eyestalk in M. nipponense females under hypoxic conditions, in order to understand how hypoxia may affect reproduction-related peptides and mechanisms in this species. Large-scale parallel sequencing has been widely used to investigate differentially expressed genes (DEGs) and regulatory pathways under specific physiological conditions. For M. nipponense, transcriptomic information is available about genes that are involved in immunological processes (Zhao et al., 2018), sex determination (Jin et al., 2013), developmental stages (Jin et al., 2017), and hypoxia response in the gill, muscle and hepatopancreas tissues of prawns (Sun et al., 2014, 2015), but eyestalk transcriptomic information in M. nipponense in response to hypoxia has not been reported yet. Since the eyestalk from females is known to participate in regulation of the ovary maturation process, we hypothesize that under hypoxic conditions, the production of reproduction-related peptides in the eyestalk is dysregulated. Additionally, since short neuropeptide F (sNPF) has been identified as a neuropeptide that is involved in reproduction in insects (Lee et al., 2008) and crab (Bao et al., 2018), we examined its function in M. nipponense too. In the present study, the transcriptome profile of the eyestalk in female M. nipponense was investigated for the first time using highthroughput screening and de novo assembly under hypoxia and reoxygenation conditions. The aims were (1) to verify the differentially expressed genes (DEGs) and molecular pathways in the eyestalk of M. nipponense females that are affected by hypoxia, (2) to identify and perform bioinformatics analyses of the key neuropeptides derived from the DEGs, and (3) to examine the location and function of sNPF using in situ hybridization and RNA interference. The results of this work provide important insight into how hypoxia affects reproduction in female M. nipponense individuals.

2.2. Construction of cDNA library and sequencing The twelve eyestalk samples from the four treatments described above were harvested to extract total RNA. Total RNA was isolated using the RNAiso Plus Reagent (TaKaRa, Japan) according to the manufacturer's protocols, and twelve cDNA libraries were prepared with 2.5 μg of total RNA, following the protocol of the Illumina TruSeq RNA Sample Preparation Kit (Illumina). The library obtained was sequenced on Illumina HiSeq 2000 with 100-bp paired-end reads (Sun et al., 2015). The raw sequencing data have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (Accession no. SRP110812, https://www.ncbi.nlm.nih.gov/ sra/?term=SRP110812). 2.3. De novo transcriptome assembly and gene annotation Raw reads from sequencing were filtered in order to eliminate reads that contain adaptors, unknown nucleotides (> 5%), and low-quality reads (> 20% of low-quality bases); the method used has been published in our previous study (Qiao et al., 2017). Clean reads were used for sequence assembly with the Trinity software (version 2.3.2; Plymouth, MA, United States), by using default parameters and a minimum contig length of 200 bp for assembly generation (Grabherr et al., 2011). All unigenes were annotated based on the following databases with a cut-off E value of 1.0 × 10−5: Non-redundant (Nr) (http://www.ncbi. nlm.nih.gov), Swiss-Prot (http://www.expasy.ch/sprot), Clusters of Orthologous Groups (COG) (http://www.ncbi.nlm.nih.gov/), and Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www. genome.jp/kegg). The predicted protein sequences were submitted to Pfam databases (version 27.0) for Pfam domain/family annotation using the HMMER software, v3.0 (Finn et al., 2017). Further, the BLAST2 GO program was used for GO analysis (http://www. geneontology.org/), and COG classification and signal pathway annotation of unigenes was performed by conducting BLASTx searches against the COG database and KEGG database. Assembly metrics and annotation completeness were obtained by using BUSCO 3.0.1 (Simão et al., 2015) with the arthropoda_odb9 dataset. 2.4. Identification of DEGs and enrichment analysis Mapping of the clean reads to our current assembled reference transcriptome was performed using Bowtie v0.12.9 (Marioni et al., 2008), and the read count for each gene was obtained from the mapping results with the Expectation-Maximization (RSEM) software, which was bundled with Trinity package v2.4.0 (Li and Dewey, 2011). Seventy percent of the clean reads obtained from each sample were successfully mapped (Table 1). The data were normalized for variation with a sequencing depth using the reads per kilobase of exon model per million mapped reads (RPKM) method, and normalized data were input into Empirical analysis of Digital Gene Expression (edgeR) (Robinson et al., 2010) for differential expression analysis. The resulting P values were adjusted using the Benjamini and Hochberg approach for controlling the false discovery rate (FDR). FDR ≤ 0.001 and |log2 (fold change) | > 1 were defined as the threshold for significant differential expression. Functional enrichment analyses were conducted using the aforementioned method to determine which DEGs showed significant enrichment for GO terms and KEGG pathways with P-values < .05

2. Materials and methods 2.1. Sample preparation Healthy female oriental river prawns (wet weight, 1.05–1.85 g) were obtained from a commercial farm near Tai Lake in Wuxi, China. The prawns were reared in the laboratory for 2 weeks in order to allow them to adapt to the environment. After the acclimation period, normoxic conditions, with a dissolved oxygen concentration of 6.5 ± 0.2 mg/L, were maintained for the control group. For the hypoxic group, a dissolved oxygen concentration of 2.0 ± 0.1 mg/L was maintained over 24 h through the addition of N2 gas. A total of 360 prawn were randomly divided equally between 12 tanks (30 in each tank, with four treatments conducted in triplicate): hypoxia for 0 h (control group), hypoxia for 3 h, hypoxia for 24 h, and hypoxia for 24 h 2

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Table 1 Primers used for quantitative PCR and RNA inference. Primer name

Sequence (5′ → 3′)

Purpose

sNPF-Q-F sNPF-Q-R ISH anti-sense probe ISH sense probe sNPF-QI-F sNPF-QI-R β-Actin F β-Actin R

TGTACGAACTGCTGTCCCAC GTAGCGGAGTCTGAGCGAAG GTCCCTTAGCGCACACTTCATTCCTAC ACCAATCCAG CATCCACGGTGCCTACTCCACCTGACTACGAT TAATACGACTCACTATAGGGCTTCGCTCAGACTCCGCTAC TAATACGACTCACTATAGGGGATGCTTCTTCGTCCTGTCC TATGCACTTCCTCATGCCATC AGGAGGCGGCAGTGGTCAT

Primer for sNPF expression Primer for sNPF expression Probe for ISH analysis Probe for ISH analysis Primer for sNPF dsRNA detection Primer for sNPF dsRNA detection Primer for β-actin expression Primer for β-actin expression

ISH: in situ hybridization.

SNPs > 5.

Table 2 Sequencing data across the 12 libraries of M. nipponense. Sample

Clean reads

Clean data

GC content (%)

Q30 ratio (%)

Control-1 Control-2 Control-3 Hypoxia 3 h-1 Hypoxia 3 h-2 Hypoxia 3 h-3 Hypoxia 24 h-1 Hypoxia 24 h-2 Hypoxia 24 h-3 Reoxygenation 3 h-1 Reoxygenation 3 h-2 Reoxygenation 3 h-3 Total number Total length N50 length Mean length

25,604,808 28,377,499 24,973,806 30,024,755 25,813,233 32,728,507 24,431,101 20,524,587 21,982,219 23,751,185

7,681,442,400 8,513,249,700 7,492,141,800 9,007,426,500 7,743,969,900 9,818,552,100 7,329,330,300 6,157,376,100 6,594,665,700 7,125,355,500

44.77 44.89 44.02 44.53 44.89 45.12 45.25 44.94 44.99 43.66

85.07 85.57 88.53 84.52 86.05 87.43 86.18 89.79 89.34 88.42

27,310,063

8,193,018,900

43.75

89.26

26,453,754

7,936,126,200

44.82

87.41

All unigenes

2.6. Bioinformatics analyses of DEGs to identify relevant neuropeptides In order to identify the neuropeptides that were affected by hypoxia, the annotated sequences and open reading frame (ORF) file obtained were searched for previously published neuropeptides and conserved amino acid sequences respectively. Searches with arthropod neuropeptides were also conducted by performing tBLASTn searches of all unigenes assembled from combined datasets against other known peptides, which were reported by a previous transcriptome study (Saowaros Suwansa-ard et al., 2015). BLAST searches were performed using CLC Main Workbench Version 6.0 (Ruder et al., 2013). Structure prediction of mature peptides was conducted using a well-established method (Christie, 2014). The predicted precursor peptides were examined for signal peptides with the help of SignalP 4.1 (http://www. cbs.dtu.dk/services/SignalP/) (Petersen et al., 2011).

91,451 70,448,195 1726 896.12

2.7. qRT-PCR analysis and tissue distribution of the predicted neuropeptides Eyestalk, ventral ganglion, ovary, and brain tissue were collected from four healthy female prawn and immediately frozen in liquid nitrogen until analysis. Tissue distribution of crustacean cardioactive peptide, short neuropeptide F, and neuroparsins was analyzed by RTPCR according to a previously published method (Bao et al., 2015). Briefly, total RNA was isolated using RNAiso Plus Reagent (TaKaRa, Japan), and then 2 μg of total RNA per tissue was used for cDNA synthesis using the Prime Script RT reagent kit (TaKaRa, Japan). Each tissue sample was tested in triplicate in a 25-μL reaction system; the housekeeping gene β-actin and gene-specific forward and reverse primers used are shown in Table S1. PCR reactions were performed following a routine protocol that was optimized for individual neuropeptide genes: 94 °C for 2 min, followed by 32–36 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s. PCR products were separated by 1.2% agarose gel electrophoresis and amplicons were purified (QIAquick gel extraction kit; Qiagen, Germany) for sequencing. The DEG results were validated using qRT-PCR. The qRT-PCR assays were performed on the Bio-Rad iCycler iQ5 Real Time System (Biorad Inc., Berkeley, CA, USA) with three replicates, and β-actin was used as an internal control (Shan et al., 2018). The primers (which were designed using Primer Express 3.0) and their sequences can be found in Table S1. The cDNAs from eyestalk tissue of prawn from the four treatment groups were synthesized from total DNA-free RNA (1 μg) using a Prime Script RT reagent kit (TaKaRa, Japan) following the manufacturer's instructions. The PCR temperature profile and reaction conditions were based on the instructions of the SYBR Premix Ex Taq kit (TaKaRa, Dalian, China). The efficiency of amplification for each primer was estimated using the standard curves obtained by serial dilutions of the pure cDNA samples, and the efficiency values range from 0.9 to 1.02. The relative mRNA copy number was determined using the comparative 2-ΔΔCT method (Livak and Schmittgen, 2012).

Note: Clean reads denote the number of paired-end reads obtained from the cleaned data. Clean data denote the total number of the bases in the cleaned data. Q30 ratio (%) denotes the percentage of bases of the clean data with a quality value of at least 30. Table 3 Length distribution of the transcripts and unigenes identified from the de novo assembly. Length range (bp)

n (%)

300–500 500–1000 1000–2000 > 2000

93,347 58,249 40,004 50,876

Unigenes n (%) (38.50%) (24.02%) (16.50%) (20.98%)

70,600 38,072 16,660 15,896

(49.99%) (26.96%) (11.80%) (11.26%)

(Kanehisa et al., 2006, 2008).

2.5. Identification of simple sequence repeats and single nucleotide polymorphisms A microsatellite identification software available online (http:// pgrc.ipk-gatersleben.de/misa/) was used to identify simple sequence repeats (SSRs) in the unigenes, according to our previously published method (Qiao et al., 2017). We chose the di-, tri-, tetra-, penta- and hexa-nucelotide motifs and set the minimum number of repeat units as 6, 5, 5, 5 and 5, respectively. Single nucleotide polymorphisms (SNPs) were identified using the SOAP software (release 2.21) (Li et al., 2009). Based on the alignment results, the SOAPsnp package was employed to call SNPs. The SOAPsnp results were filtered using the following standards: a base quality score not < 20 and a distance between two 3

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Fig. 1. Analysis of differentially expressed genes. (A) Principal component analysis (PCA) plot of the transcriptome analysis data obtained for the twelve samples of the control group and the three treatment groups. (B) Number of DEGs identified in the control vs. 3-h hypoxia, the control vs. 24-h hypoxia, and the control vs. 3-h reoxygenation group. Notes: Up- and downregulated unigenes are shown in blue and red, respectively. The X-axis shows two comparisons. The Y-axis represents the total number of DEGs. (C) Each unigene is presented as a point. The X- and Y-axis show the log2-fold change and the log10 P-value of the normalized expression level (FPKM) of the gene between the two compared groups, respectively. The red dots represent significantly differentially expressed genes, while the grey dots indicate similarly expressed genes.

homolog of vertebrate neuropeptide Y, which plays an important role in reproduction in the mud crab (Bao et al., 2018), the antisense and sense probes used in the in situ hybridization (ISH) study with DIG signaling were designed with the Primer 5 software based on the cDNA sequence of sNPF and synthesized by Shanghai Sangon Biotech Company

2.8. In situ hybridization For the in situ experiments, prawn eyes were dissected from mature female prawns and fixed in a 4% paraformaldehyde-containing phosphate buffered saline (pH 7.4) at 4 °C overnight. Since sNPF is a 4

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Fig. 2. GO classification analyses of DEGs in the control vs. 3-h hypoxia, the control vs. 24-h hypoxia, and the control vs. 3-h reoxygenation group. Notes: DEGs are indicated for (A) the control vs. 3-h hypoxia, (B) the control vs. 24-h hypoxia, and (C) the control vs. 3-h reoxygenation group.

5

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Figure 3. KEGG pathway classification of DEGs. Significant KEGG pathway classifications (corrected p-value < .05) of DEGs are shown for (A) the control vs. 3-h hypoxia, (B) the control vs. 24-h hypoxia, and (C) the control vs. 3-h reoxygenation group.

Figure 4. Validation of the identified DEGs by qRT-PCR. Comparison of the RNA-Seq and qRT-PCR validation results. The X axis presents genes in the eyestalk tissue validated in this study; the Y axis shows the Log2Ratio of expression in Macrobrachium nipponense in response to hypoxia and reoxygenation. No significant differences were found between the qRT-PCR and Illumina data (Pearson's correlation coefficient [r] = 0.93).

6

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

after the injections. GSI was defined as the percentage of ovary weight divided by the total body weight of the prawn. 2.10. Statistical analysis Data are expressed as mean ± S.E.M. Expression levels were compared using a two-sided t-test, with the SPSS 19.0 software. P < .05 was considered to imply significance. 3. Results 3.1. Nucleotide sequences, transcripts and unigenes In order to obtain an overview of the eyestalk transcriptome of M. nipponense and identify the neuropeptide genes involved in the response to hypoxia and reoxygenation, twelve cDNA libraries with triplicates were prepared under the four experimental conditions, and sequenced using the Illumina Solexa platform. The sequencing analysis produced 311,975,517 clean reads that corresponded to 93,592,655,100 clean nucleotides. A minimum of 20 million reads, which was equivalent to > 7 GB of data, were obtained for each sample. The Q30 percentage and GC content for the entire data set were 87.30% and 44.64%, respectively (Table 2). From the de novo assembly experiments, 141,228 transcripts were obtained: their total length was over 172,367,274 bp. From the assembled transcripts, 91,451 unigenes were identified (total length, 70,448,195 bp). The main sequencing and de novo assembly data can be found in Table 3. The BUSCO pipeline identified the presence of > 91% of the arthropoda orthologs in the assembled poison ivy transcriptome (Complete BUSCOs (C): 91.7% [Single-copy BUSCOs (S): 86.2%, Duplicate (D): 5.7%, Fragmented (F): 2.4%, Missing (M): 2.7%, n: 1066]).

Fig. 5. Tissue distribution of Macrobranchium nipponense neuropeptide transcripts as determined by RT-PCR. The crustacean cardioactive protein (CCAP), neuropeptide (NP), and short neuropeptide F (SNP) transcripts were detected by RT-PCR in five tissues of prawns: M, marker; B, brain; E, eyestalk; V, ventral ganglion; Ov, ovary. β-actin was used as the reference gene.

(Table 1). Then, formalin-fixed paraffin-embedded sections of 5 μm thickness were subjected to ISH according to a published method (Li et al., 2018). Briefly, the standard deparaffinization technique started with 10 min of incubation in 3% H2O2, followed by rinsing in deionized water (DW) and target retrieval using pepsin digestion in a humidity chamber for 10 min. Next, the slides were incubated in EDTA solution at 95 °C for 15 min after washing in DW. The slides were again washed in DW and drained off, and 20 μL of the ISH probe was poured over each slide. Denaturation at 5 °C for 5 min was subsequently followed by hybridization at 37 °C for 60 min in the Thermobrite TM hybridization chamber (Vysis Inc., USA). Washing with Tris-buffered-saline (TBS) at 55 °C and room temperature, each for five min, was performed concurrently. Mouse-anti-DIG (Zyto Vision GmBH, Germany) was poured drop-wise over each slide, and incubated in a humidity chamber at 37 °C for 30 min. Three washings, each for a minute, with TBS were done, before and after incubating the slides in anti-mouse-HRP-polymer for 30 min at room temperature. 3,3′-Diaminobenzidine (DAB) solution was prepared as per the guidelines (Zytofast PLUS CISH), and 50 μL of the solution was poured on each slide and incubated for 10 min at room temperature. After washing, hematoxylin was used for counterstaining. Slides were dehydrated in graded alcohol solutions, air dried and mounted with DPX.

3.2. GO terms and COGs Of the unigenes that were identified, 43,583 showed significant similarity with a sequence (cut-off E-value, 10−5) in at least one of the databases that were searched. Specifically, 41,691 of the unigenes were homologous to annotations in the NCBI NR database (Table S2). In the GO analysis, 13,642 unigenes were enriched for at least one GO term. The enriched terms were divided into three groups that were further segregated into 55 functional subgroups (Fig. S1). Based on COG analysis, 11,180 of the unigenes were allocated to 25 COGs according to the degree of homology (Fig. S2). 3.3. SSRs and SNPs We identified 31,847 SSRs from 16,596 unigenes with a size of > 1 Kb; 7817 of the unigenes contained more than one SSR (Table S3). Further, a greater number of heterozygous SNPs (5,623,602, Hete SNPs) than homozygous SNPs (1,302,061, Homo SNPs) were identified (Table S4).

2.9. RNA interference (RNAi) The specific primers containing the T7 promoter site for the RNAi experiments were designed using Snap Dragon (http://www.flyrnai. org/cgi-bin/RNAi_find_primers.pl) (Table 1). sNPF-specific dsRNA was synthesized in vitro according to our previously described method (Bai et al., 2015, 2016), in accordance with the instructions of the Transcript AidTM T7 High Yield Transcription kit (Fermentas Inc., USA). The purity and integrity of the dsRNA were examined by standard agarose gel electrophoresis. The concentration of dsRNA was measured at 260 nm using a BioPhotometer (Eppendorf, Hamburg, Germany). For the long-term in vivo dsRNA injection experiment, 120 healthy mature female M. nipponense (each weighing 1.8–2.4 g) were assigned to two groups, in triplicate. Each prawn in the control group and treatment group was injected with 4 μg/g body weight of sNPF-dsRNA or 4 μg/g body weight of dsEGFP dissolved in the injection buffer (Bai et al., 2015, 2016). Considering the results for sNPF expression in ovarian tissue, the sNPF mRNA expression levels in the ovary and gonad somatic index (GSI) were determined at 1, 3, 5, 7, 9, 11, 13, and 15 days

3.4. DEGs and their functional analysis PCA of the entire gene expression dataset indicated that the molecular pathways and corresponding gene expression are significantly different under normoxic, hypoxic and reoxygenation conditions (Fig. 1A). A total of 711 DEGs were identified in the eyestalk (false discovery rate, ≤0.01; fold-change, ≥2). Of the identified DEGs, 117, 214, and 380 genes were differentially expressed under hypoxia at 3 h, hypoxia at 24 h and reoxygenation at 3 h, respectively (Fig. 1B&C). Functional annotation analyses, including COG, GO, and KEGG pathway analysis, were conducted with the Swissprot and NCBI NR databases (Table S5). The biological functions of the DEGs were determined using GO functional annotation (Fig. 2). The top 10 GO terms that were significantly over-represented (p < .05, FDR < 0.01) are 7

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

(caption on next page)

8

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Figure 6. Multiple sequence alignment of the deduced amino acid sequences of four neuropeptides genes of Macrobrachium nipponense by DNAman. Similar residues are shaded, with the degree of homology ranging from dark blue (100% identity) to rose (100% to 75%), and gaps introduced to maximize the alignment. (A) All neuroparsin (NP) proteins have similar structural organization: the 12 positionally conserved cysteine residues are marked with a red box. The GenBank accession numbers of the genes are as follows: Scylla paramamosain NP 1 (Sp-NP1: ALQ28570.1), S. paramamosain NP 2 (Sp-NP2: ALQ28588.1), S. paramamosain NP 3 (Sp-NP3: ALQ28589.1), S. paramamosain NP 4 (Sp-NP 4: ALQ28571.1), Metapenaeus ensis NP (Me-NP: AHX39208.1), Jasus lalandii NP (Jl-NP: AHG98659.1), Penaeus monodon NP (Pm-NP: ALO17555.1). (B) All crustacean cardioactive protein (CCAP) proteins have similar structural organization: a signal peptide, the CCAP peptide, AP1, AP2, AP3 and AP4. The GenBank accession numbers of the genes are as follows: Cherax quadricarinatus CCAP (Cq-CCAP: AWK57511.1), Procambarus clarki CCAP (PcCCAP: BAF34909.1), S. paramamosain CCAP (Sp-CCAP: ALQ28577.1), Homarus gammarus CCAP (Hg-CCAP: ABB46292.1), Carcinus maenas CCAP (Cm-CCAP: ABB46291.1), Portunus trituberculatus CCAP (Pt-CCAP: AVK43051.1), Penaeus vannamei CCAP (Pv-CCAP: ALP06206.1). (C) All short neuropeptide F (sNPF) proteins have similar structural organization: a signal peptide and mature peptides. The GenBank accession numbers of the genes are as follows: C. quadricarinatus sNPF (CqsNPF: AWK57543.1), S. paramamosain sNPF (Sp-sNPF: ALQ28574.1), Aedes aegypti sNPF (Aa-sNPF: ABE72968.1), Anoplophora glabripennis sNPF (Ag-sNPF: XP_018580110.1), Leptinotarsa decemlineata sNPF (Ld-sNPF: XP_023021371.1), P. vannamei sNPF (Pv-sNPF: XP_027208512.1), Athalia rosae sNPF (Ar-sNPF: XP_012260485.1), Bemisia tabaci sNPF (Bt-sNPF: XP_018908145.1). (D) Schematic representation of the Macrobranchium nipponense neuropeptides CCAP, sNPF and NP.

shown in Table S7; the terms include “mitochondrion” (GO: 0046982), “cellular response to stimulus” (GO: 0051716), “iron ion binding” (GO: 0005506), “respiratory chain” (GO: 0070469), and “oxidoreductase activity” (GO: 0016491) (Table S6). From the KEGG pathway enrichment analysis, the 20 most significant pathways (Q < 0.05) associated with hypoxia 24 h and reoxygenation 3 h were identified (Fig. 3). Under hypoxic conditions, the most significant pathways were “progesteronemediated oocyte maturation” and “insect hormone biosynthesis.”

3.7. Localization of sNPF mRNA in the eyestalk Since the expression of sNPF was significantly affected by hypoxia and reoxygenation, the function of this peptide was examined by ISH analysis of its distribution and localization in the eyestalk tissue of M. nipponense during hypoxia. The detailed eye structure of M. nipponense is presented in Fig. 7A &B. The X-organ (XO) appears purple in H&E stained sections due a high density of nuclei located in the MT, and the sinus gland (SG) has strong pink/red with eosin due to a high concentration of neuropeptides and low density of nuclei (Pitts and Mykles, 2017). Sense probes were used as negative controls (Fig. 7C), and the antisense probe exhibited a positive signal in neuroendocrine cells, with a few transcripts found in the rhabdoms of retinular cells (Fig. 7D) under normoxic conditions, and a strong signal detected under hypoxic conditions that are apparently not part of the XO (Fig. 7E). A schematic diagram of the organization of the prawn eyestalk is shown in Fig. 7F.

3.5. Neuropeptide verification by qRT-PCR and RT-PCR Fifteen transcripts encoding neuropeptide precursors (12 complete and 3 partial) were identified, with a total of 52 distinct mature peptides predicted from the identified DEGs. The deduced M. nipponense peptides include isoforms of allatostatin (AST)-A, ASTeB, ASTeC, sNPF, FLRFamide, neuroparsins (NP), gonad-inhibiting hormone (GIH), molt-inhibiting hormone (MIH), crustacean cardioactive peptide (CCAP), eclosion hormone (EH), GSEFLamide, HIGSLYRamide, and tachykinin (TK), as well as pigment-dispersing hormone (PDH). Among these peptides, ten of the predicted significantly differentially expressed neuropeptide genes were subjected to qRT-PCR (Table S7). The qRTPCR findings verified the nine neuropeptide DEGs identified (Fig. 4), the expression of six of these genes was significantly lower in the 24-h hypoxia group than in the normoxia group: these genes corresponded to CCAP, PDH, NP I, NP II, and NP III. However, the expression of these genes showed the opposite trend in the reoxygenation group as compared to the normoxia group. Additionally, AST, GIH, MIH, and sNPF showed continuous significant upregulation in the 24-h hypoxia group; however, these neuropeptides were downregulated in the reoxygenation stage. Based on these findings, the expression of CCAP, sNPF, and NP was examined in the ventral ganglion, ovary, eyestalk, and brain of M. nipponense by RT-PCR analysis (Fig. 5). The transcripts of the three genes were detected in the three nervous tissues, and they also showed remarkable distribution in ovary tissue.

3.8. Functional analysis of sNPF by RNAi In order to study the function of sNPF in the process of ovarian development, RNAi was used to observe GSI (Fig. 8A) and sNPF expression pattern data (Fig. 8B). The expression patterns for GSI differed between the dsRNA-injected group and the EGFP-injected group. An interesting observation was that the GSI expression in the EGFP group reached a peak at 13 days, but it peaked at only 11 days in the dsRNA group. Significant sNPF gene knockdown was observed in the dsRNAinjected prawn after 3 days, as compared to the EGFP-injected prawn, and the level of sNPF expression in the former group returned to control levels after 11 days. 4. Discussion Previous transcriptome analyses have provided data on sex determination and reproduction in M. nipponense (Jin et al., 2013; Qiao et al., 2017). The present study focuses on reproduction-associated genes and peptides and presents the first large-scale RNA sequencing analysis of the eyestalk in the female oriental river prawn under normoxic, hypoxic (3 h and 24 h of hypoxia exposure) and reoxygenation (3 h) conditions. Genomic data for this species are still lacking, so we were able to perform annotation for only 25% of the DEGs, and we were therefore able to identify only 10 neuropeptides (CCAP, PDH, NP I, NP II, NP III, sNPF, JH, GIH, MIH and AST) that played a significant role in the response to hypoxia and reoxygenation. The signaling pathways that were identified as being significantly affected by hypoxia (by KEGG analysis), such as “insect hormone biosynthesis,” were similar to those reported in a previous study on the transcriptome of the eyestalk in the red swamp crayfish Procambarus clarkia and Australian crayfish Cherax quadricarinatus (Manfrin et al., 2015; Nguyen et al., 2016). Interestingly, in the present study, some of the DEGs were associated with “progesterone-mediated oocyte maturation” and were categorized under the reproduction process. Similar

3.6. Bioinformatics analysis of neuropeptides and peptide prediction Of the verified neuropeptides, NP I, NP II, and NP III were found to putatively encode complete precursors with a length of 97–106 aa. All three sequences had a predicted signal peptide of 25–29 aa. With the exception of the last cysteine residue of NP3, the remaining 12 cysteine residues of the mature peptides were in alignment (Fig. 6A). The neuropeptide CCAP was comprised of a 28-aa signal peptide and a mature 111-aa peptide, along with a probable cleavage site at positions 28–29 in the signal peptide (Fig. 6B). Finally, a complete sNPF precursor with a length of 127 aa was found to be putatively encoded: it was predicted to contain a 25-aa signal peptide and three peptides that were 9- to 12aa long with a XPXRLRFamide conserved motif (Fig. 6C). A schematic representation of the CCAP, NP and sNPF precursors is provided in Fig. 6D. 9

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Fig. 7. Localization by in situ hybridization of M. nipponense short neuropeptide F (Mn-sNPF) transcripts in the eyestalk tissues. A. Photograph of M. nipponense eye including sinus gland (SG), X-organ (XO), medulla externa (ME), medulla interna (MI), medulla terminalis (MT). B. Retinal cryosection of M. nipponense showing overall eye structure including cornea (C), crystalline cones (CC), crystalline tract (CT), distal pigment (DPG), rhabdom (R), the basement membrane (B), neuroendocrine cells (NC). C. Sense probes, used as negative controls, showed no signal. D. Mn-sNPF express in eyestalk of prawns in response to normoxia. E. Mn-sNPF mainly express in neuroendocrine cells with a strong signal of prawns in response to 24-h hypoxia (scale bar = 50 μm). F. A schematic diagram of the organization of the prawn eyestalk. E1-E3, neuroendocrine cell populations.

findings have been reported in the tiger shrimp Penaeus monodon, in which progesterone was found to induce vitellogenesis and reproductive maturation (Merlin et al., 2015; Yang et al., 2018). Thus, hypoxic conditions may affect the secretion of peptides by the XO-SG complex that may affect the secretion of gonadotropin-releasing hormones in M. nipponense females. In the present study, 10 neuropeptides were identified in the

eyestalk that showed significantly different transcript levels under normoxic, hypoxic (24-h hypoxia) and reoxygenation conditions. These peptides and their potential role in reproductive mechanisms have been studied in depth in some insects (Christie et al., 2011, 2017; Christie and Chi, 2015). Among the identified peptides, CCAP (which was significantly downregulated under hypoxia) has been reported in the central nervous system of crustaceans and insects and participates in 10

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

Fig. 8. Real-time PCR analysis after injection with sNPF dsRNA. (A) Effects of sNPF knockdown on the gonad stimulation index (GSI) of prawns; (B) Relative sNPF expression levels in the ovary of prawns after RNA interference. Each data point represents the mean and standard deviation (n ≥ 3). Statistical analyses were performed with one-way ANOVA analysis (asterisks indicate a significant difference between the EGFP injection and dsRNA injection group).

sNPF was localized in neuroendocrine cells of the eyestalk, with a strong signal observed in the prawns in response to hypoxia for 24 h. This is similar to the results of a previous study in which sNPF neuropeptide genes have been reported to be located in diverse types of neuronal cells (Kapan et al., 2012). In fact, we found that the sNPF transcripts of M. nipponense females were not only expressed in the nervous system but were also highly expressed in the ovary. This finding implies that sNPF may act as a neuroregulator in reproduction in this species. In order to further investigate its reproductive function, its expression was silenced in the ovary tissue of prawns using dsRNA. The GSI expression results showed that treatment with sNPF-dsRNA effectively accelerated ovary development. The present results indicate that prawn sNPF plays a negative regulatory role in reproductive maturation in M. nipponense. This is consistent with a recent report in which short neuropeptide F from the mud crab Scylla paramamosain was found to have inhibitory functions in vitellogenesis and oocyte maturation (Bao et al., 2018). NPs have been reported to play an important role in female reproduction in insects (Badisco et al., 2011). In the present study, the expression of three NPs (NP I, NP II, and NP III) was downregulated in response to hypoxia. It has been reported that in vivo gene silencing of

processes such as adaptation to environmental stressors, cardiac function, digestion, and reproduction (Donini and Lange, 2002; Dulcis et al., 2005; Chung et al., 2006; Fort et al., 2007; Shan et al., 2018). Although a role for CCAP in reproduction in M. rosenbergii has been indicated (Suwansa-ard S et al., 2015), the reproduction-related functions of CCAP and how these functions are affected by hypoxic conditions in M. nipponense females still need to be investigated in detail. ASTs (also reported here) are pleiotropic neuropeptides that have an inhibitory effect on juvenile hormone (JH), which plays essential roles in reproduction in female insects (Barbara and Stephen, 2007). In the present study, the significant higher expression levels of ASTs detected during hypoxia might mean that there is an enhanced suppressive effect on female reproductive functions. sNPF plays multiple roles in insects, such as the regulation of feeding, growth and metabolic homeostasis (Dick and Christian, 2011; Pieter et al., 2013). However, although sNPF has been shown to have an inhibitory effect on JH (Yamanaka et al., 2008; Yu and Kiyoshi, 2014), the expression pattern of sNPF in this study is similar to that of ASTs. The present findings showed that sNPF was expressed at higher levels in the eyestalk of prawn exposed to hypoxia than in the control group. Further, ISH analysis of prawn sNPF mRNA in the eyestalk showed that 11

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

References

NP resulted in a significant decrease in the vitellogenin transcript levels in the hepatopancreas and ovary in the sand shrimp Metapenaeus ensis (Yang et al., 2014). Another study reported that knockdown of NPs resulted in a significant increase in the expression of two vitellogenin genes in the desert locust (Badisco et al., 2011). The difference in these studies may be indicative of the difference in the role of NP between crustaceans and insects. Nonetheless, based on these findings, it can be deduced that hypoxia has a significant effect on the regulation of reproduction in crustaceans. The expression of PDH, which is another neuropeptide identified in the present study, was maintained at low levels in the eyestalk of female prawns in response to hypoxia but returned to the initial level in the reoxygenation stage. PDH is known as a light-adapting hormone that plays a role in regulating circadian rhythm (Fernlund, 1976). Thus, PDH may play an important role in hypoxia adaptation in M. nipponense. The GIH and MIH genes have been cloned in M. nipponense (Qiao et al., 2015; Qiao et al., 2018). GIH is known to play a major role in the inhibition of ovarian maturation in crustaceans (Treerattrakool et al., 2008; Devaraj et al., 2012), while MIH secreted from the XO-SG complex inhibits ecdysteroid synthesis in Y-organs and suppresses molting (Ohira et al., 2005; Chen et al., 2007; Huang et al., 2015). In the present study, the findings indicate that hypoxia could also upregulate GIH and MIH gene expression levels. Thus, there might be a strong correlation between hypoxia and growth in M. nipponense. In the present study, three of the neuropeptide genes were found to be located in nervous tissue; thus, their transcripts were probably synthesized in the eyestalk of M. nipponense. Additionally, the neuropeptide genes were also expressed in ovary tissue. This indicates that they play a role in ovarian maturation (Barbara and Stephen, 2007). Overall, the findings related to the expression of these neuropeptide genes and their role in vitellogenesis and ovarian maturation indicate that hypoxia affects the reproduction mechanisms in female prawns.

Badisco, L., et al., 2011. RNA interference of insulin-related peptide and neuroparsins affects vitellogenesis in the desert locust Schistocerca gregaria. Peptides 32, 573–580. Bai, H.K., Qiao, H., Li, F.J., Fu, H.T., Sun, S.M., Zhang, W.Y., Jin, S.B., Gong, Y.S., Jiang, S.F., Xiong, Y.W., 2015. Molecular characterization and developmental expression of vitellogenin in the oriental river prawn Macrobrachium nipponense and the effects of RNA interference and eyestalk ablation on ovarian maturation. Gene 562, 22–31. Bai, H.K., Qiao, H., Li, F.J., Fu, H.T., Jiang, S.F., Zhang, W.Y., Yan, Y.D., Xiong, Y.W., Sun, S.M., Jin, S.B., Gong, Y.S., Wu, Y., 2016. Molecular and functional characterization of the vitellogenin receptor in oriental river prawn, Macrobrachium nipponense. Comp. Biochem. Physiol. A 194, 45–55. Bao, C.H., Yang, Y.N., Huang, H.Y., Ye, H.H., 2015. Neuropeptides in the cerebral ganglia of the mud crab, Scylla paramamosain: transcriptomic analysis and expression profiles during vitellogenesis. Sci. Rep. 5, 17055. Bao, C.C., Yang, Y.N., Huang, H.Y., Ye, H.H., 2018. Inhibitory role of the mud crab short neuropeptide F in vitellogenesis and oocyte maturation via autocrine/paracrine signaling. Front. Endocrinol. 9, 390. Barbara, S., Stephen, S.T., 2007. The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annu. Rev. Entomol. 52, 277–299. Brown-Peterson, N.J., Manning, C.S., Patel, V., Denslow, N.D., Brouwer, M., 2008. Effects of cyclic hypoxia on gene expression and reproduction in a grass shrimp, Palaemonetes pugio. Biol. Bull. 214, 6–16. Bureau of Fishery, 2017. Ministry of Agriculture, P.R.C. Fisheries economic statistics. In: China Fishery Yearbook. China Agricultural Press, Beijing, pp. 236. Cai, Y., Ng, P.K.L., 2002. The freshwater palaemonid prawns of Myanmar (Crustacea: Decapoda: Caridea). Hydrobiologia 487, 59–83. Chang, E.S., Mykles, D.L., 2011. Regulation of crustacean molting: a review and our perspectives. Gen. Comp. Endocrinol. 17, 323–330. Chen, H.Y., Watson, R.D., Chen, J.C., Liu, H.F., Lee, C.Y., 2007. Molecular characterization and gene expression pattern of two putative molt-inhibiting hormones from Litopenaeus vannamei. Gen. Comp. Endocrinol. 151, 72–81. Christie, A.E., 2014. Prediction of the peptidomes of Tigriopus californicus and Lepeophtheirus salmonis (Copepoda, Crustacea). Gen. Comp. Endocrinol. 201, 87–106. Christie, A.E., Chi, M., 2015. Prediction of the neuropeptidomes of members of the Astacidea (Crustacea, Decapoda) using publicly accessible transcriptome shotgun assembly (TSA) sequence data. Gen. Comp. Endocrinol. 224, 38–60. Christie, A.E., Cashman, C.R., Brennan, H.R., Ma, M., Sousa, G.L., Li, L., Stemmler, E.A., Dickinson, P.S., 2008. Identification of putative crustacean neuropeptides using in silico analyses of publicly accessible expressed sequence tags. Gen. Comp. Endocrinol. 156, 246–264. Christie, A.E., Stemmler, E.A., Dickinson, P.S., 2010. Crustacean neuropeptides. Cell. Mol. Life Sci. 67, 4135–4169. Christie, A.E., Chapline, M.C., Jackson, J.M., Dowda, J.K., Hartline, N., Malecha, S.R., Lenz, P.H., 2011. Identification, tissue distribution and orexigenic activity of neuropeptide F (NPF) in penaeid shrimp. J. Exp. Biol. 214, 1386–1396. Christie, A.E., Roncalli, V., Cieslak, M.C., Pascual, M.G., Yu, A., Lameyer, T.J., Stanhope, M.E., Dickinson, P.S., 2017. Prediction of a neuropeptidome for the eyestalk ganglia of the lobster Homarus americanus using a tissue-specific de novo assembled transcriptome. Gen. Comp. Endocrinol. 243, 96–119. Chung, J.S., Wilcockson, D.C., Zmora, N., Zohar, Y., Dircksen, H., Webster, S.G., 2006. Identification and developmental expression of mRNAs encoding crustacean cardioactive peptide (CCAP) in decapods crustaceans. J. Exp. Biol. 209, 3862–3872. Devaraj, H., Natarajan, A., 2006. Molecular mechanisms regulating molting in a crustacean. FEBS J. 273, 839–846. Devaraj, H., Saravanakumar, M., Thiyagu, M., 2012. Induction of ovarian maturation in Penaeus monodon by molecular signal interventional approach. J. Exp. Zool. B Mol. Dev. Evol. 318, 572–585. Dick, R.N., Christian, W.A., 2011. Comparative review of short and long neuropeptide F signaling in invertebrates: any similarities to vertebrate neuropeptide Y signaling. Peptides 32, 1335–1355. Donini, A., Lange, A.B., 2002. The effects of crustacean cardioactive peptide on locust oviducts are calcium-dependent. Peptides 23, 683–691. Dulcis, D., Levine, R.B., Ewer, J., 2005. Role of the neuropeptide CCAP in Drosophila cardiac function. Dev. Neurobiol. 64, 259–274. Fernlund, P., 1976. Structure of a light-adapting hormone from the shrimp, Pandalus borealis. Biochim. Biophys. Acta 439, 17–25. Finn, R.D., Attwood, T.K., Babbitt, P.C., et al., 2017. InterPro in 2017-beyond protein family and domain annotations. Nucleic. Acids. Res. 45, D190–D199. Fort, T.J., García-Crescioni, K., Brezina, V., Miller, M.W., 2007. Regulation of the crab heartbeat by crustacean cardioactive peptide (CCAP): central and peripheral actions. J. Neurophysiol. 97, 3407–3420. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., et al., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652. Hartenstein, V., 2006. The neuroendocrine system of invertebrates: a developmental and evolutionary perspective. J. Endocrinol. 190 (3), 555–570. Harzsch, S., Dircksen, H., Beltz, B.S., 2009. Development of pigment-dispersing hormone immunoreactive neurons in the American lobster: homology to the insect circadian pacemaker system? Cell Tissue Res. 335, 417–429. Huang, H.Y., Fu, C.R., Chen, X.L., Gong, J., Huang, X.S., Ye, H.H., 2015. Molt-inhibiting hormone (MIH) gene from the green mud crab Scylla paramamosain and its expression during the molting and ovarian cycle. Aquac. Res. 46, 2665–2675. Jia, C., Lietz, C.B., Ye, H., Hui, L., Yu, Q., Yoo, S., Li, L., 2013. A multi-scale strategy for discovery of novel endogenous neuropeptides in the crustacean nervous system. J.

5. Conclusion In conclusion, the comparative transcriptome analysis conducted in the present study demonstrates that some of the neuropeptides secreted by the eyestalk play an important role in growth, progesterone-mediated oocyte maturation, and insect hormone biosynthesis in M. nipponense females. In particular, the qPCR results indicate that hypoxia can significantly upregulate the expression levels of sNPF, which can regulate ovarian development and subsequently affect reproduction. Thus, this study may serve as a useful resource for understanding the role of prawn neuropeptides in mediating the effects of hypoxia on reproduction. The findings also lay the foundation for future investigations on neuropeptide function in reproduction in this prawn species. Declaration of Competing Interest The authors state that this research is free of conflicts of interests. Acknowledgement This work was supported by the National Natural Science Foundation of China (Grant No. 31672633), the China Central Governmental Research Institutional Basic Special Research Project from Public Welfare Fund (2019HY-XKQ02), the Six Talent Peaks Project of Jiangsu Province (Grant No. NY-112), the China Agriculture Research System-48 (Grant No. CARS-48); the New Cultivar Breeding Major Project of Jiangsu Province (Grant No. PZCZ201745). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cbpb.2019.110392. 12

Comparative Biochemistry and Physiology, Part B 241 (2020) 110392

S. Sun, et al.

temperature. Comp. Biochem. Physiol. A 185, 1–8. Qiao, H., Fu, H.T., Xiong, Y.W., Jiang, S.F., Zhang, W.Y., Sun, S.M., Jin, S.B., Gong, Y.S., Wang, Y.B., Shan, D.Y., Li, F., Wu, Y., 2017. Molecular insights into reproduction regulation of female oriental river prawns Macrobrachium nipponense through comparative transcriptomic analysis. Sci. Rep. 7, 12161. Qiao, H., Jiang, F., Xiong, Y.W., Jiang, S.F., Fu, H.T., Li, F., Zhang, W.Y., Sun, S.M., Jin, S.B., Gong, Y.S., Wu, Y., 2018. Characterization, expression patterns of molt-inhibiting hormone gene of Macrobrachium nipponense and its roles in molting and growth. PLoS One 13, e0198861. Robinson, M.D., McCarthy, D.J., Smyth, G.K., 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140. Ruder, T., Sunagar, K., Undheim, E.A., Ali, S.A., Wai, T.C., Low, D.H., et al., 2013. Molecular phylogeny and evolution of the proteins encoded by coleoid (cuttlefish, octopus, and squid) posterior venom glands. J. Mol. Evol. 76, 192–204. Shan, D.Y., Fu, H.T., Qiao, H., Sun, S.M., Zhang, W.Y., Jin, S.B., Jiang, S.F., Gong, Y.S., Xiong, Y.W., Wu, Y., 2018. Molecular cloning, characterization, and expression of crustacean Cardioactive peptide in oriental river prawn, Macrobrachium nipponense, during acute hypoxia and reoxygenation. J. World Aquacult. Soc. 49, 356–365. Simão, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V., Zdobnov, E.M., 2015. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 31, 3210–3212. Sun, S.M., Xuan, F.J., Ge, X.P., Fu, H.Y., Zhu, J., Zhang, S.Y., 2014. Identification of differentially expressed genes in hepatopancreas of oriental river prawn, Macrobrachium nipponense exposed to environmental hypoxia. Gene 534, 298–306. Sun, S.M., Xuan, F.J., Fu, H.Y., Zhu, J., Ge, X.P., Gu, Z.M., 2015. Transciptomic and histological analysis of hepatopancreas, muscle and gill tissues of oriental river prawn (Macrobrachium nipponense) in response to chronic hypoxia. BMC Genomics 16, 491. Suwansa-ard, S., Thongbuakaew, T., Wang, T., Zhao, M., Elizur, A., Hanna, P.J., et al., 2015. In silico Neuropeptidome of female Macrobrachium rosenbergii based on transcriptome and peptide Mining of Eyestalk, central nervous system and ovary. PLoS One 10 (5), e0123848. Treerattrakool, S., Panyim, S., Chan, S.M., Withyachumnarnkul, B., Udomkit, A., 2008. Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference. FEBS J. 275, 970–980. Wang, Z.K., Luan, S., Meng, X.H., Cao, B.X., Luo, K., Kong, J., 2019. Comparative transcriptomic characterization of the eyestalk in Pacific white shrimp (Litopenaeus vannamei) during ovarian maturation. Gen. Com. Endocr. 274, 60–72. Webster, S.G., Keller, R., Dircksen, H., 2012. The CHH-superfamily of multifunctional peptide hormones controlling crustacean metabolism, osmoregulation, moulting, and reproduction. Gen. Comp. Endocrinol. 175, 217–233. Wu, R.S., Zhou, B.S., Randall, D.J., Woo, N.Y., Lam, P.K., 2003. Aquatic hypoxia is an endocrine disrupter and impairs fish reproduction. Environ. Sci. Technol. 37, 1137–1141. Yamanaka, N., et al., 2008. Neuropeptide receptor transcriptome reveals unidentified neuroendocrine pathways. PLoS One 3, e3048. Yang, S.P., He, J.G., Sun, C.B., Chan, S.F., 2014. Characterization of the shrimp neuroparsin (MeNPLP): RNAi silencing resulted in inhibition of vitellogenesis. FEBS. Open. Bio. 4, 976–986. Yang, L., Liu, M.M., Gong, J., Cheng, Y.X., Wu, X.G., 2018. Effect of exogenous estrogen on the ovarian development and gene expression in the female swimming crab Portunus trituberculatus (Miers, 1876) (Decapoda: Brachyura: Portunidae). J. Crustacean Boil. 38, 367–373. Yu, K., Kiyoshi, H., 2014. Short neuropeptide F (sNPF) is a stage-specific suppressor for juvenile hormone biosynthesis by corpora allata, and a critical factor for the initiation of insect metamorphosis. Dev. Biol. 393, 312–319. Yu, H.P., Miyake, S., 1972. Five species of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae) from Taiwan. Ohmu 3, 45–55. Zhao, C.Y., Fu, H.T., Sun, S.M., Qiao, H., Zhang, W.Y., Jin, S.B., Jiang, S.F., Xiong, Y.W., Gong, Y.S., 2018. A transcriptome study on Macrobrachium nipponense hepatopancreas experimentally challenged with white spot syndrome virus (WSSV). PLoS One 13, e0200222.

Proteome 91, 1–12. Jin, S.B., Fu, H.T., Zhou, Q., Sun, S.M., Jiang, S.F., Xiong, Y.W., Gong, Y.S., Qiao, H., Zhang, W.Y., 2013. Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000. PLoS One 8, e76840. Jin, S.B., Fu, H.T., Sun, S.M., Jiang, S.F., Xiong, Y.W., Gong, Y.S., Qiao, H., Zhang, W.Y., Wu, Y., 2017. Integrated analysis of microRNA and mRNA expression profiles during the sex-differentiation sensitive period in oriental river prawn, Macrobrachium nipponense. Sci. Rep. 7, 12011. Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K.F., Itoh, M., Kawashima, S., et al., 2006. From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res. 34, D354–D357. Kanehisa, M., Araki, M., Goto, S., Hattori, M., Hirakawa, M., Itoh, M., et al., 2008. KEGG for linking genomes to life and the environment. Nucleic. Acids. Res. 36, D480–D484. Kapan, N., Lushchak, V., Luo, J., Nässel, D.R., 2012. Identified peptidergic neurons in the Drosophila brain regulate insulin-producing cells, stress responses and metabolism by coexpressed short neuropeptide F and corazonin. Cell. Mol. Life Sci. 69, 4051–4066. Lee, K.S., Kwon, O.Y., Lee, J.H., Kwon, K., Min, K.J., Jung, S.A., et al., 2008. Drosophila short neuropeptide F signalling regulates growth by ERK-mediated insulin signalling. Nat. Cell Biol. 10, 468–475. Li, B., Dewey, C.N., 2011. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics. 12, 323. Li, R., Li, Y., Fang, X., Yang, H., Wang, J., 2009. Kristiansen K SNP detection for massively parallel whole-genome resequencing. Genome Res. 19, 1124–1132. Li, F., Qiao, H., Fu, H.T., Sun, S.M., Zhang, W.Y., Jin, S.B., Jiang, S.F., Gong, Y.S., Xiong, Y.W., Wu, Y., Hu, Y.N., Shan, D.Y., 2018. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Com. Biochem.Physiol B 218, 1–12. Livak, K.J., Schmittgen, T.D., 2012. Analysis of relative gene expression data using realtime quantitative PCR and the 2 (−Delta Delta C (T)) method. Methods 5, 402–408. Manfrin, C., Tom, M., Moro, G.D., Gerdol, M., Giulianini, P.G., Pallavicini, A., 2015. The eyestalk transcriptome of red swamp crayfish Procambarus clarkia. Gene 557, 28–34. Marioni, J.C., Mason, C.E., Mane, S.M., Stephens, M., Gilad, Y., 2008. RNA-seq an assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 18, 1509–1517. Merlin, J., Mohanlal, D.L., Balasubramanian, C.P., 2015. Induction of vitellogenesis and reproductive maturation in tiger shrimp, Penaeus monodon by 17β-estradiol and 17αhydroxyprogesterone: in vivo and in vitro studies. Invertebr. Reprod. Dev. 59, 166–175. Nagaraju, G.P.C., 2010. Reproductive regulators in decapod crustaceans: an overview. J. Exp. Biol. 214, 3–16. Nguyen, T.V., Cummins, S.F., Elizur, A., Ventura, T., 2016. Transcriptomic characterization and curation of candidate neuropeptides regulating reproduction in the eyestalk ganglia of the Australian crayfish, Cherax quadricarinatus. Sci. Rep. 6, 38658. Ohira, T., Katayama, H., Tominaga, S., Takasuka, T., Nakatsuj, T., Sonobe, H., et al., 2005. Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn Marsupenaeus japonicus. Peptides 26, 259–268. Ollivaux, C., Vinh, J., Soyez, D., Toullec, J.Y., 2006. Crustacean hyperglycemic and vitellogenesis-inhibiting hormones in the lobster Homarus gammarus: implications for structural and functional evolution of a neuropeptide family. FEBS J. 273, 2151–2160. Petersen, T.N., Brunak, S., von Heijne, G., Nielen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Pieter, V.W., Niels, W., Senne, D., 2013. Neuropeptide F regulates male reproductive processes in the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 43, 252–259. Pitts, N.L., Mykles, D.L., 2017. Localization and expression of molt-inhibiting hormone and nitric oxide synthase in the central nervous system of the green shore crab, Carcinus maenas, and the blackback land crab, Gecarcinus lateralis. Comp. Biochem. Physiol. A 203, 328–340. Qiao, H., Xiong, Y., Zhang, W., Fu, H., Jiang, S., Sun, S., Bai, H., Jin, S., Gong, Y., 2015. Characterization, expression, and function analysis of gonad-inhibiting hormone in oriental river prawn, Macrobrachium nipponense and its induced expression by

13