Molecular characterization and functional analysis of IRF3 in tilapia (Oreochromis niloticus)

Developmental and Comparative Immunology 55 (2016) 130e137

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Molecular characterization and functional analysis of IRF3 in tilapia (Oreochromis niloticus) Yi-Feng Gu a, b, 1, Qun Wei c, d, 1, Shou-Jie Tang a, Xiao-Wu Chen a, *, Jin-Liang Zhao a, ** a

Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai, 201306, China Department of Developmental Biology, University of Texas Southwestern Medical Center at Dallas, 6000 Harry Hines Boulevard Dallas, TX, 75390-9133, USA c Department of Surgical Oncology and Institute of Clinical Medicine, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, China d Department of International Medicine, University of Texas Southwestern Medical Center at Dallas, 6000 Harry Hines Boulevard Dallas, TX, 75390-9133, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 6 May 2015 Received in revised form 22 September 2015 Accepted 12 October 2015 Available online 22 October 2015

Interferon regulatory factor 3 (IRF3) plays a key role in interferon (IFN) response and binding to the IFN stimulatory response elements (ISREs) within the promoter of IFN and IFN-stimulated genes followed by virus infection. In the current study, we discovered one IRF3 homologue in tilapia genome and analyzed the characterizations and functions of tilapia IRF3. Tilapia IRF3 contains 1368 bp with an ORF of 455 aa. Structurally, tilapia IRF3 protein typically shares the conserved characterizations with other species' IRF3 homologues, displaying conserved DNA-binding domain, IRF association domain, serine-rich C terminal domain, and tryptophan residue cluster. Phylogenetic analysis illustrated that tilapia IRF3 belongs to the IRF3 subfamily. Real-time PCR revealed a broad expression pattern of tilapia IRF3 in various tissues. Subcellular localization analysis showed that tilapia IRF3 mainly resides in the cytoplasm, Western blot demonstrated that IRF3 was distributed in the cytoplasmic fraction. Functionally, IRF3 was found to be transcriptionally up-regulated by the poly I:C stimulation. Moreover, reporter assay elucidated that tilapia IRF3 serves as a regulator in mediating IFN response by increasing the activity of IFN-b and ISREcontaining promoter. These data supported the view that tilapia IRF3 is a potential molecule in IFN immune defense system against viral infection. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Tilapia IFN (interferon) IRF3 (Interferon regulatory factor 3) ISRE (Interferon-stimulated response element) ISGs (IFN-stimulated genes)

1. Introduction Innate immunity is believed to serve as the first line of defense against different pathogens (Mogensen, 2009). Among the innate immunity systems, interferon (IFN), IFN regulatory factors (IRFs), and IFN-stimulated genes (ISGs) represent the crucial components

Abbreviations: DBD, DNA binding domain; IAD, IRF association domain; IRF, IFN regulatory factor; ISG, IFN-stimulated gene; ISRE, IFN-stimulated regulatory element; ECL, enhanced chemiluminescence; DAPI, 40 ,6-diamidino-2-phenylindole; poly I:C, polyinosinic: polycytidylic acid; FLAG, DYKDDDDK peptide. * Corresponding author. College of Fisheries and Life Science, Shanghai Ocean University, No.999, Huchenghuan Rd., Shanghai 201306, China. ** Corresponding author. College of Fisheries and Life Science, Shanghai Ocean University, No.999, Huchenghuan Rd., Shanghai 201306, China. E-mail addresses: [email protected] (Y.-F. Gu), [email protected] (X.-W. Chen), [email protected] (J.-L. Zhao). 1 Yi-Feng Gu and Qun Wei contributed equally to this work. http://dx.doi.org/10.1016/j.dci.2015.10.011 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

to defend viral infection (Kawai and Akira, 2006). Classical type I IFN induction is triggered by recognizing the viral products through pattern recognition receptors (PRRs) (Takeuchi and Akira, 2007). Generally, well-known Toll-like receptors (TLRs), such as TLR3, monitor viruses from the cell surface or within the endosomal compartment in immune cell lineages (Akira et al., 2006; Meylan et al., 2006), and RIG-I-like receptors, such as RIG-I and MDA5, obtain cytosolic viral products in most cell types (Hou et al., 2011; Kawai and Akira, 2006). Recognition events initiate the recruitment of various adaptors and signaling transductions, leading to the activation of TBK1, which phosphorylates IRF3 to induce the transcription of IFN-a and -b, as well as other IFN-induced genes (Fitzgerald et al., 2003a; Sharma et al., 2003). IRF3 is a member of the IRF family, including 9 members in mammals (Barnes et al., 2002; Taniguchi et al., 2001), 10 members in birds (Huang et al., 2010), and 11 members in fish (Holland et al., 2008; Li et al., 2014; Xiang et al., 2010). IRF3 is characterized by

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

displaying the DNA-binding domain (DBD) in the N-terminal, basically containing five conserved tryptophan (W) resides forming a helix-turn-helix motif, which facilitates affinitive binding to the IFN-stimulated response elements (ISRE) element on the promoter of IFN-b and ISGs (Honda and Taniguchi, 2006; Paun and Pitha, 2007). In addition to DBD, IRF3 encompasses an IRF association domain (IAD), which conducts the interaction with other IRF family members or transcription factors to the promoters of downstream genes (Bergstroem et al., 2010; Clement et al., 2008; Panne et al., 2007). IRF3 function has been extensively studied. IRF3 is demonstrated to be an indispensable regulator in the induction of type I IFN followed by viral infection. Stimulated by viral infection, PRRs mediate signaling transduction and activate TBK1 kinase to phosphorylate a couple of serine and threonine residues in the C-terminal serine-rich region of IRF3, in which phosphorylated IRF3 is translocated to the nuclei and mediates the transcription of IFN-a and -b, as well as other IFN-induced genes (Fitzgerald et al., 2003a; Tanaka and Chen, 2012). Recently, great progress has been made in fish innate immunity, which is similar to mammalian innate immunity; fish have an IFN induction system against viral infection (Aggad et al., 2010; Briolat et al., 2014; Levraud et al., 2007). Fish IFN induction by viral infection represents antiviral activity and promotes the expression of ISGs to inhibit viral replication (Lopez-Munoz et al., 2009). A series of IRFs has been retrieved in the fish genome (Feng et al., 2011; Hu et al., 2011; Li et al., 2014; Shi et al., 2013; Yao et al., 2012), among which IRF3 has been reported to play key roles in modulating IFN response (Holland et al., 2008; Sun et al., 2010). In the present study, we identified the full-length cDNA of tilapia IRF3, which is considered the homologue of IRF3 using the protein structure and phylogenetic analysis. Further experiments confirmed that tilapia IRF3 is a positive regulator that triggers the activity of IFN-b and ISRE-containing promoter. The current study can improve understanding of IFN-associated signaling and response in fish immunity. 2. Materials and methods 2.1. Experimental fish Two-month-old tilapia (Oreochromis niloticus) with average weight of 60 g and 12 cm length of both sexes were raised in running water at 24  C in large aquariums and fed with brine shrimp twice a day. The fish were maintained in the laboratory for three weeks prior to experiments to allow acclimatization and evaluation of overall health. Only healthy fish were used for experiment, judging by the following criteria: fish with normal body color; no bleeding or wounds found at the body surface and gills; no obvious symptoms of infection by bacteria or fungal; fish with normal diet; competing for snatching bait. All animal experimental procedures were performed in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved and authorized by the State Council of People's Republic of China.

131

Table 1 The primers used in the present study. Primer

Sequence 50 e30

Use

Tilapia IRF3-FL-F Tilapia IRF3-FL-R IRF3-qPCR-F IRF3-qPCR-R IRF3-FLAG-F IRF3-FLAG-R b-actin-F b-actin-R

ATGTTAGAAGACGTGTTCGG TCAAATCTGGTTCGGGAAC ACCGACGGCTTTACAGAGAA TCCTCGTCACTGCAGTCTTT GCTTCTAGAATGTTAGAAGACGTG GCCGGATCCTCAAATCTGGTTCGG TCCACCTTCCAGCAGATGTG AGCATTTGCGGTGGACGAT

ORF amplification ORF amplification Real-time PCR Real-time PCR Vector construction Vector construction Real-time PCR Real-time PCR

GAC GTG TTC GG and Tilapia IRF3-FL-R: 50 -TCA AAT CTG GTT CGG GAA C were designed based on the predicted sequence of tilapia IRF3. PCR products were purified by a gel extraction kit (Qiagen) and cloned into the pMD18-T vector (Takara) for competent cell transformation. The positive clones were sent out to Invitrogen Company for sequencing. 2.3. RT-PCR and real-time PCR Total RNA was extracted using Trizol (Invitrogen) from different tissues of tilapia. First-strand cDNA synthesis was conducted using the BD SMART RACE cDNA Amplification kit (Clontech). PCR was conducted to amplify tilapia IRF3 using a specific primer. The following PCR conditions were used: initial denaturation at 94  C for 3 min; followed by 35 cycles of 94  C for 30 s, 55  C for 30 s, and 72  C for 90 s; and a final extension at 72  C for 10 min. To determine the tissue distribution of tilapia IRF3, total RNA from various tissues, including brain, gill, skin, head kidney, spleen, liver, intestine, ovary, and testis, in experimental (10 fish were intraperitoneally injected with 10 ml of 1 mg/ml poly I:C for 12 h) and control (10 fish with PBS treatment) fish groups was extracted. Real-time PCR amplification was performed on the BioRad PCR system using iTaq Universal SYBR Green Supermix (BioRad) following the manufacturer's instructions. In brief, all realtime PCR reactions were performed in a 20 ml reaction volume. The experimental conditions were as follows: initial denaturation for 20 s at 95  C; 40 cycles for 5 s at 95  C; 15 s at 60  C; and melting curve analysis using 65  Ce95  C, at 0.5  C increments for 2e5 s. Relative IRF3 mRNA expression was evaluated by the 2DDCT method with initial normalization of IRF3 against b-actin. In all experiments, each PCR trial was conducted with triplicate samples and repeated at least three times. The real-time PCR primer is shown in Table 1. 2.4. Structural characterization of IRF3 and phylogenetic tree construction Multiple alignments were performed with ClustalX program (version 1.83). The functional domain was validated by SMART (smart.embl-heidelberg.de). The phylogenetic tree was constructed by the neighbor-joining method with MEGA 3.0 for 100 replicates.

2.2. Sequence retrieval and molecular cloning of tilapia IRF3

2.5. Plasmid construction, transfection, and luciferase assays

Tilapia IRF3 sequence was found in the tilapia genome of the UCSC database using zebrafish IRF3 protein sequence (NP_001137376.1) as probe. The retrieved sequence was validated by Genscan and BLAST. The testis cDNA for PCR was synthesized by a BD SMART RACE cDNA Amplification kit (Clontech). To verify whether IRF3 cDNA is correct and really exist in the Tilapia tissues, the specific primers (Table 1), Tilapia IRF3-FL-F: 50 -ATG TTA GAA

To verify the potential function of tilapia IRF3, the overexpression plasmid was made. Xba I and BamH I restriction sites were respectively introduced to the upstream and downstream of IRF3 by PCR amplification with primers IRF3-FLAG-F: 50 - GCT TCT AGA ATG TTA GAA GAC GTG and IRF3-FLAG-R: 50 - GCC GGA TCC TCA AAT CTG GTT CGG. The amplified IRF3 with restriction sites was inserted into pCMV3-FLAG (Sigma) to generate pCMV3-

132

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

FLAG-IRF3 in which FLAG tag was fused to the N-terminal of tilapia. For IFN-b luciferase reporter plasmid, human interferon-b promoter (300 to þ25) was cloned into luciferase vector (Clontech). HeLa and 293T cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, penicillin (100 U/ml), and streptomycin (100 mg/ml) at 37  C in 5% CO2. Cells were transfected with plasmid using Lipofectamine 2000 according to the manufacturer's protocol. 293T cells were seeded on a 24-well plate and co-transfected with different doses of pCMV3-FLAG-IRF3, 100 ng of luciferase reporter plasmid of human IFN-b promoter or ISRE-containing promoter (Clontech), and 10 ng of pRL-TK (Promega). At 24 h posttransfection, 293T cells were lysed using Reporter Lysis Buffer (Promega), and luciferase activity was measured using DualLuciferase Assay Reagent (Promega).

2.6. Cytoplasmic and nuclear fractions, Western blot, and immunostaining pCMV3-FLAG-IRF3 was transfected into HeLa cells. At 48 h post-transfection, whole cell lysates were solubilized in Western lysis buffer (50 mM TriseHCl (pH 7.4), 250 mM NaCl, 0.5% NP-40), whereas cytoplasm and nuclei were extracted by hypotonic buffer (20 mM TriseHCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.1% NP40). In brief, FLAG-IRF3-transfected HeLa cells were washed twice with PBS and suspended in hypotonic buffer for 15 min, followed by centrifugation at 13,000 rpm at 4  C. The supernatant was cytoplasmic fraction, and the remaining cell pellets were the nuclei, which were solubilized in Western lysis buffer. For Western blot, equal amounts of protein fraction with 25 ml of 1.5 mg/ml were separated on 10% SDS-PAGE gels and then electrophoretically transferred to a PVDF membrane. The membrane was blocked

Fig. 1. Structural characterizations of tilapia IRF3. (A) Full-length cDNA of tilapia IRF3. The initiation codon (ATG) and stop codon (TGA) are shown in bold. (B) Deduced amino acid sequence of tilapia IRF3. (C) Left image: chromosome synteny of three homologous IRF3 genes. Right image: functional domain of IRF3 homologues.

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

with 5% bovine serum albumin for 1 h, incubated with rabbit antiFLAG antibodies (Cell Signaling #14793, 1:1000 dilution) at room temperature for 2 h, and incubated with goat anti-Rabbit IgG at room temperature for 1 h. The membrane was washed three times with TBST buffer (25 mM TriseHCl (pH 7.5), 150 mM NaCl, and 0.1% Tween 20) and then developed by ECL solution. In addition, the membranes were also blotted with Tubulin (Cell Signaling #2144, 1:5000 dilution) and Menin (Bethyl Laboratories, 1:5000 dilution). For immunostaining, pCMV3-FLAG-IRF3 was transfected into HeLa cells. At 48 h post-transfection, cells were fixed with 3% (v/v) formaldehyde for 10 min and then permeabilized with 0.2% Triton X-100 in PBS for 15 min. The fixed cell was blocked with 5% (v/v) goat serum at 37  C for 1 h and incubated with rabbit anti-FLAG antibodies (1:200 dilution) at 37  C for 1 h, followed by FITClabeled goat anti-rabbit IgG secondary antibodies at 37  C for 1 h. Furthermore, the cells were dyed with DAPI (nuclei marker) for 1 min, and the fluorescence image was captured under a fluorescent microscope. 2.7. Statistical analysis Statistical evaluation of differences between experimental group means was conducted by ANOVA and multiple Student t tests. The p values *p < 0.05 and **p < 0.01 means statistical significance. The sample numbers of each group were ten fish of equal body weight. Data points were analyzed from at least three independent experiments. All mean values are presented with

133

the standard deviation. 3. Results 3.1. Characterization of tilapia IRF3 The tilapia IRF3 gene sequence was retrieved by searching the UCSC genome database with zebrafish IFR3. Based on the searched sequence, the specific primers were designed to amplify the fulllength cDNA of tilapia IRF3. The nucleotides and deduced amino acids are shown in Fig. 1A and B. The full-length transcripts of tilapia IRF3 is 1368 bp long with an ORF of 455 aa, with a theoretical molecular weight of 51,817.65 and isoelectric point of 5.5. Tilapia IRF3 displays high homology with various vertebrates (Fig. 2) containing putative DBD and IAD. The conservation is found in the signature of four W residues, which constitute the “W cluster” in the DBD. In addition, the conserved serine-rich domain is predicted in the carboxy-terminal region. Prediction of tilapia IRF3 protein domains by SMART online software indicates the IRF and IRF3 domains in the N- and C-terminals, respectively, and both domains are also analogously found in mammals and other teleosts (Fig. 1C). By blasting the full-length tilapia IRF3 with the corresponding genomic sequences, the organization of IRF3 genes is illustrated in Fig. 1C. The tilapia gene is located on the chromosome LG7 within a 4.5 kb genomic fragment containing 10 exons and 9 introns, and the conserved canonical splice sites GT/AT are found at the 50 and 30 ends of introns. To some degree, the number of IRF3 exons of tilapia differs between teleosts and mammals.

Fig. 2. Multiple alignment of tilapia IRF3 with other homologues. Residues shaded in black are completely conserved across all species, and residues shaded in gray are similar with respect to side chains. Dashes in the amino acid sequences indicate gaps introduced to maximize alignment. Putative DNA-binding domain (DBD) in the N-terminal and interaction association domain (IAD) in the C-terminal are underlined. Serine-rich C terminal domain is boxed. Black triangle represents the tryptophan residue clusters.

134

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

Dicentrarchus labrax CBN81356.1 IRF3 Larimichthys crocea AFE88606.1 IRF3 Paralichthys olivaceus ACY69212.1 IRF3(V1) 73 73 Scophthalmus maximus ADQ52415.1 IRF3 100 Oncorhynchus mykiss NP 001244191.1 IRF3 Salmo salar NP 001165753.1 IRF3 99 Oreochromis niloticus XP 005448376.1 IRF3(like X1) 53 100 100 Oreochromis niloticus XP 005448377.1 IRF3(like X2) Oryzias latipes XP 004080549.1 IRF3-like Cyprinus carpio ADZ55456.1 IRF3 69 Danio rerio NP 001137376.1 IRF3 100 100 Xenopus (Silurana) tropicalis XP 002940288.1 IRF3-like Xenopus laevis NP 001079588.1 IRF3 Homo sapiens NP 001562.1 IRF3 50 Mus musculus NP 058545.1 IRF3 100 Rattus norvegicus NP 001006970.1 IRF3 100 97 Bos taurus NP 001098510.1 IRF7 77 Sus scrofa NP 001090897.1 IRF7 100 Homo sapiens NP 004022.2 IRF7(isoform d) Mus musculus NP 001239530.1 IRF7(isoform 3) 99 Rattus norvegicus NP 001028863.1 IRF7 100 Gallus gallus AAK58583.1 IRF3 100 Gallus gallus NP 990703.1 IRF3 100 78 Cyprinus carpio ADZ55457.1 IRF7 Danio rerio NP 956971.1 IRF7 Salmo salar NP 001130020.1 IRF7 99 Oreochromis niloticus XP 003440542.2 IRF3-like 99 Scophthalmus maximus ADQ52413.1 IRF7 89 Larimichthys crocea ADD14594.1 IRF7 63 Paralichthys olivaceus ACY69214.1 IRF7 67 Mus musculus NP 058547.2 IRF6 100 Rattus norvegicus NP 001102329.1 IRF6 70 Homo sapiens NP 006138.1 IRF6(isoform 1) 100 Gallus gallus XP 417990.4 IRF6 Danio rerio NP 956892.1 IRF6 Gallus gallus NP 001026758.1 IRF5 100 99 Salmo salar NP 001133324.1 IRF5 65 Danio rerio XP 005164675.1 IRF5(isoform X1) Homo sapiens NP 001092097.2 IRF5 44 Mus musculus NP 001239311.1 IRF5(isoform 1) 100 97 Rattus norvegicus NP 001100056.1 IRF5 97 Mus musculus NP 001152889.1 IRF9(isoform 1) 100 Rattus norvegicus NP 001012041.1 IRF9 96 Homo sapiens NP 006075.3 IRF9 Danio rerio NP 991273.1 IRF9 35 Homo sapiens XP 006721250.1 IRF8(isoform X1) 85 Rattus norvegicus NP 001008722.1 IRF8 98 Mus musculus NP 032346.1 IRF8 100 100 Gallus gallus NP 990747.1 IRF8 Danio rerio NP 001002622.1 IRF8 100 Gallus gallus NP 989889.1 IRF10 35 Danio rerio NP 989889.1 IRF10 Salmo salar NP 001133454.1 IRF4 52 Gallus gallus NP 989630.1 IRF4 100 Homo sapiens NP 001182215.1IRF4(isoform 2) 100 Mus musculus NP 038702.1 IRF4 95 Rattus norvegicus NP 001099578.1 IRF4 Danio rerio NP 001035442.1 IRF1 96 Homo sapiens NP 990527.1 IRF2 100 Mus musculus NP 032417.3 IRF2 79 Gallus gallus NP 990527.1 IRF2 Oncorhynchus mykiss NP 001117910.1 IRF2 97 100 100 Salmo salar NP 001239280.1 IRF2 Danio rerio NP 001008614.1 IRF2 100 Oncorhynchus mykiss NP 001117765.1 IRF1 100 100 Salmo salar NP 001239290.1 IRF1 Danio rerio NP 991310.1 IRF1 Gallus gallus NP 990746.1 IRF1 83 Mus musculus NP 032416.1 IRF1 93 Homo sapiens NP 002189.1 IRF1 100 42 Rattus norvegicus NP 036723.1 IRF1 75

0.1

IRF5 Subfamily IRF4 Subfamily

41

IRF1 Subfamily

95

IRF3 Subfamily

51

Fig. 3. Phylogenetic tree of IRF family members was constructed with the neighbor-joining method by Mega 3.0. Node values represent percent bootstrap confidence derived from 100 replicates.

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

3.5. Tilapia IRF3 up-regulates the interferon-b and ISRE signaling pathway

3.2. Phylogenetic analysis of IRF3 A phylogenetic tree was constructed by comparing the IRF1IRF10 subfamily members of various species using the neighborjoining method. The results demonstrated that tilapia IRF3 belongs to the IRF3 subfamily with high bootstrap support (Fig. 3). Noticeably, tilapia IRF3 was found to be merged into the teleost subgroup, and amphibian and mammalian homologues are clustered into their corresponding subgroups. 3.3. IRF3 mRNA expression profile Real-time PCR was applied to validate the mRNA expression trends of tilapia IRF3 in different tissues of healthy and poly I:C treatment fish. PCR confirmed that tilapia IRF3 was widely distributed in brain, gill, skin, head kidney, spleen, liver, intestine, ovary, and testis. After poly I:C stimulation for 12 h, a significant increase in mRNA expression was observed in most of the tissues compared with untreated fish (Fig. 4). 3.4. Subcellular localization of tilapia IRF3 To detect the subcellular localization of tilapia IRF3, the N-terminal FLAG-tagged IRF3 over-expression plasmid (pCMV3-FLAGIRF3) and empty plasmids (control) were each transfected into HeLa cells. After 48 h post-transfection, some transfected cells were lysed for Western blot. Meanwhile, the cytoplasmic and nuclear fractions of the transfected cells were extracted by hypertonic buffer. Western blot results proved that tilapia IRF3 protein was expressed in HeLa cells with correct molecular weight of approximately 53 kDa (Fig. 5A). Subsequent data indicated that tilapia IRF3 protein was distributed in the cytoplasmic fraction but not in the nuclear fraction through Western blot (Fig. 5A). Furthermore, the imaging data of the FITC-anti-FLAG-labeled IRF3 displayed its cytoplasm subcellular localization in the majority of the transfected cells (Fig. 5B). Therefore, the findings of biochemistry detection and fluorescence imaging showed good agreement, which suggested that tilapia IRF3 was localized in the cytoplasm.

Relative IRF3 expression level

6

*

*

5

*

4

*

*

PBS Poly I:C

*

3

* 2

135

*

*

1 0

Fig. 4. Transcriptional induction of tilapia IRF3 with poly I:C stimulation. Real-time PCR data illustrated the tilapia IRF3 expression pattern in various tissues in control fish and poly I:C treatment fish. IRF3 mRNA expression was evaluated using real-time quantitative PCR, and the findings are expressed relative to the gene expression of bactin (IRF3/b-actin). Values are the mean ± SEM. The quantitative PCR value was averaged from three duplicates, each of which contained >10 fish. *p < 0.05.

The family of IRF transcription factors is believed to play important roles in the regulation of IFN expression in response to viral infection and the induction of ISGs. To investigate whether tilapia IRF3 is involved in the IFN-b and ISRE signaling pathway, the typical promoter of IFN-b and ISRE-containing dual luciferase reporter assay was performed. As shown in Fig. 6A, the dual luciferase reporter assay showed that the over-expression of tilapia IRF3 in 293T cells significantly activated IFN-b promoter activity compared with empty vector (p < 0.01). Moreover, the ISRE-containing promoter was further found to be activated in a dose-dependent manner in the presence of tilapia IRF3 (p < 0.01) (Fig. 6B). These data strongly suggested that tilapia IRF3 is supposed to be involved in the IFN signaling pathway in innate immunity. 4. Discussion Lower vertebrate teleosts evolve to contain the relatively intact innate immunity system to defend pathogen invasion. Some key transcription factors are found in teleosts involved in regulating the immunity response, including NF-kB, JAK-STAT, and IRFs (Zhu et al., 2013). Notably, IRF3, a main focus in teleosts, is considered an essential transcription factor regulating IFN expression to defend viral infection (Holland et al., 2008; Sun et al., 2010). In the present study, the full-length cDNA of tilapia IRF3 was retrieved, which is 1368 bp long with a prediction of 455 aa. By BLAST analysis of IRF3 cDNA with the UCSC genome database, tilapia IRF3 is found to consist of 10 exons and 9 introns, similar to the stickleback IRF3 (10 exons, 9 introns) gene (Huang et al., 2010), but it is considerably different not only with other fish species, such as zebrafish (8 exons and 7 introns) and Scophthalmus maximus (9 exons and 8 introns) (Huang et al., 2010) but also different from mammalian human (8 exons and 7 introns) homologues. These differences suggested that the gene size and exons of IRF3 genes varied among the vertebrates. Deduced tilapia protein encompassed an IRF domain in the Nterminal, functioning as a DBD, which is also found in other fish and mammals (Honda and Taniguchi, 2006; Sun et al., 2010). Similar to mammals, IRF3 displayed five cluster W residues in DBD, and these W residues are indispensable for DNA binding in mammals (Paun and Pitha, 2007). By contrast, one IRF3 domain was also uncovered at the C-terminal, which exerts great influence on activating the double-stranded RNA-activated factor 1 and defense against viral infection (Kawai and Akira, 2006). All these characterizations indicated that tilapia IRF3 played key roles in IFN activation and other immune responses. In mammals, tilapia IRF3 was detected to be constitutively distributed in various tissues examined. Currently, fish are believed to contain many molecules of the ligands, receptors, and signaling adaptors necessary for antiviral response (Briolat et al., 2014; Levraud et al., 2007; Zhu et al., 2013). Structurally, poly I:C is similar to double-stranded RNA, which is present in some viruses and is a “natural” stimulant of TLR3 (Fortier et al., 2004). In mammals, IRF3, which is a downstream adaptor of the TLR3 signaling pathway, is activated to trigger IFN response by poly I:C stimulation (Taniguchi et al., 2001). In the present study, similar to other fish IRF3, tilapia IRF3 was significantly induced upon poly I:C stimulation, suggesting that fish IRF3 might play key roles in viral infection. Mammalian IRF3 is predominantly distributed in the cytoplasm, activated, and shuttles to the nuclei following by viral infection or poly I:C stimulation (Fitzgerald et al., 2003b). However, the nuclei of fish IRF3 diverge. Crucian carp IR3 is not detectable in nuclei without any stimulation, but it shows more accumulation in the nuclei in the presence of poly I:C (Sun et al., 2010). Trout IRF3

136

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

Fig. 5. Subcellular localization of tilapia IRF3. (A) FLAG-IRF3 plasmids were transfected into HeLa cells. At 48 h post-transfection, the whole cell lysis, cytoplasm, and nuclei were extracted for Western blot using FLAG antibodies. As shown in the pictures, IRF3 fused with FLAG tag was ectopically expressed in HeLa cells compared with empty vectors. Further Western blot results showed that IRF3 expression was predominantly found in the cytoplasmic fraction. Tubulin, cytoplasmic marker. Menin, nuclear marker. WCL, whole cell lysis; Cy, cytoplasmic fraction; Nu, nuclear fraction. (B) FLAG-IRF3 was transfected into HeLa cells. At 48 h post-transfection, cells were fixed and stained with FITC-anti-FLAG antibodies and DAPI (nuclear counterstain). As shown in the picture, tilapia IRF3 predominantly resides in the cytoplasm. Bar, 50 mm.

resides both in the cytoplasm and nuclei in the absence of poly I:C (Holland et al., 2008), and no migration from the cytoplasm to the nuclei was observed with poly I:C stimulation. In the present study, to investigate the potential roles of tilapia IRF3, the FLAG-tagged

B

IFN Rel. lucif. act.

0.25

**

0.2 0.15 0.1 0.05 0 EV

IRF3 200ng

IRF3 400ng

IRF3 600ng

0.16

ISRE Rel. lucif. act.

A

tilapia IRF3 was over-expressed in HeLa cells. Subsequent Western blot confirmed that tilapia was expressed with the correct molecular weight in HeLa cells. Simultaneously, tilapia was found to be distributed in the cytoplasmic fraction but not in the nuclear

**

0.14 0.12

**

0.1 0.08 0.06

*

0.04 0.02 0 EV

IRF3 IRF3 IRF3 200ng 400ng 600ng

Fig. 6. Tilapia IRF3 activates the activity of IFN-b- or ISRE-containing promoter. FALG-IRF3 or empty vector (negative control) along with luciferase reporter plasmids (IFN-b- or ISRE-containing promoter) and pRL-TK plasmids (internal control reporter) were co-transfected into 293T cells. At 24 h post-transfection, the cells were lysed for luciferase assay. Reporter assay indicated that tilapia IRF3 was able to activate both IFN-b- (A) and ISRE-containing (B) promoter activity in a dose-dependent manner, suggesting that IRF3 may be involved in IFN signaling pathway in innate immunity.

Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

fraction. Furthermore, HeLa cells were transfected with FLAG-IRF3, fixed, and stained with FITC-anti FLAG antibodies. The immunostaining images showed that tilapia IRF3 was mainly localized in the cytoplasm, which mirrored the distribution of tilapia IRF3 in the cytoplasmic fraction by Western blot. This results suggested that tilapia IRF3 initially displayed cytoplasm localization in the absence of viral infection or poly I:C stimulation. The dynamic process by which tilapia IRF3 shuttles from the cytoplasm to nuclei needs further studies. Mammalian IRF3 serves as the key transcriptional factor in mediating type I IFN-dependent immune responses defending DNA or RNA viral infection (Honda and Taniguchi, 2006; Taniguchi et al., 2001). Mammalian IRF3 is proven to activate the mRNA transcription of type I IFN genes (IFN-a and -b) and ISGs by binding to the ISRE on their promoters (Honda and Taniguchi, 2006; Paun and Pitha, 2007). The potential roles of fish IRF3 in IFN response were recently confirmed by the evidence that over-expressed fish IRF3 can induce the activity of IFN-b and ISRE-containing promoter (Holland et al., 2008; Sun et al., 2010). Subsequent luciferase reporter assays in this study indicated that the ectopic expression of tilapia IRF3 could elicit significant activation of IFN-b and ISREcontaining promoter in mammalian 293T cells. Together with the characterization of IRF3 function domain, tilapia IRF3 was suggested to be a functional and crucial regulator in the IFN response signaling pathway. In this study, the protein structure and expression pattern of tilapia IRF3 were identified and described. Subcellular localization and functional characterizations indicated that tilapia IRF3 served as a regulator in triggering the activity of IFN promoter and ISREcontaining promoter, notably implicating an evolutionary conservation of the IFN response signaling pathway from fish to mammals. These findings may improve our understanding of innate immune systems in fish. Acknowledgments This research was supported by Grants from the China Agriculture Research System (Grant no. CARS-49), Key Laboratory of Healthy Mariculture for the East China Sea (Grant no: 2013ESHML10) and Shanghai Universities First-class Disciplines Project of Fisheries. References Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P., Lutfalla, G., Leptin, M., 2010. In vivo analysis of Ifn-gamma1 and Ifn-gamma2 signaling in zebrafish. J. Immunol. 185, 6774e6782. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783e801. Barnes, B., Lubyova, B., Pitha, P.M., 2002. On the role of IRF in host defense. Journal of interferon & cytokine research. Off. J. Int. Soc. Interferon Cytokine Res. 22, 59e71. Bergstroem, B., Johnsen, I.B., Nguyen, T.T., Hagen, L., Slupphaug, G., Thommesen, L., Anthonsen, M.W., 2010. Identification of a novel in vivo virus-targeted phosphorylation site in interferon regulatory factor-3 (IRF3). J. Biol. Chem. 285, 24904e24914. Briolat, V., Jouneau, L., Carvalho, R., Palha, N., Langevin, C., Herbomel, P., Schwartz, O., Spaink, H.P., Levraud, J.P., Boudinot, P., 2014. Contrasted innate responses to two viruses in zebrafish: insights into the ancestral repertoire of vertebrate IFN-stimulated genes. J. Immunol. 192, 4328e4341. Clement, J.F., Bibeau-Poirier, A., Gravel, S.P., Grandvaux, N., Bonneil, E., Thibault, P., Meloche, S., Servant, M.J., 2008. Phosphorylation of IRF-3 on Ser 339 generates a hyperactive form of IRF-3 through regulation of dimerization and CBP

137

association. J. Virol. 82, 3984e3996. Feng, H., Liu, H., Kong, R., Wang, L., Wang, Y., Hu, W., Guo, Q., 2011. Expression profiles of carp IRF-3/-7 correlate with the up-regulation of RIG-I/MAVS/TRAF3/ TBK1, four pivotal molecules in RIG-I signaling pathway. Fish Shellfish Immunol. 30, 1159e1169. Fitzgerald, K.A., McWhirter, S.M., Faia, K.L., Rowe, D.C., Latz, E., Golenbock, D.T., Coyle, A.J., Liao, S.M., Maniatis, T., 2003a. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4, 491e496. Fitzgerald, K.A., Rowe, D.C., Barnes, B.J., Caffrey, D.R., Visintin, A., Latz, E., Monks, B., Pitha, P.M., Golenbock, D.T., 2003b. LPS-TLR4 signaling to IRF-3/7 and NFkappaB involves the toll adapters TRAM and TRIF. J. Exp. Med. 198, 1043e1055. Fortier, M.E., Kent, S., Ashdown, H., Poole, S., Boksa, P., Luheshi, G.N., 2004. The viral mimic, polyinosinic:polycytidylic acid, induces fever in rats via an interleukin1-dependent mechanism. Am. J. Physiol. Regul. Integr. Comp. Physiol. 287, R759eR766. Holland, J.W., Bird, S., Williamson, B., Woudstra, C., Mustafa, A., Wang, T., Zou, J., Blaney, S.C., Collet, B., Secombes, C.J., 2008. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: functional analysis and transcriptional modulation. Mol. Immunol. 46, 269e285. Honda, K., Taniguchi, T., 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nature Rev. Immunol. 6, 644e658. Hou, F., Sun, L., Zheng, H., Skaug, B., Jiang, Q.X., Chen, Z.J., 2011. MAVS forms functional prion-like aggregates to activate and propagate antiviral innate immune response. Cell 146, 448e461. Hu, G.B., Xia, J., Lou, H.M., Chen, X.L., Li, J., Liu, Q.M., 2011. An IRF-3 homolog that is up-regulated by DNA virus and poly I: C in turbot, Scophthalmus maximus. Fish Shellfish Immunol. 31, 1224e1231. Huang, B., Qi, Z.T., Xu, Z., Nie, P., 2010. Global characterization of interferon regulatory factor (IRF) genes in vertebrates: glimpse of the diversification in evolution. BMC Immunol. 11, 22. Kawai, T., Akira, S., 2006. Innate immune recognition of viral infection. Nat. Immunol. 131e137. Levraud, J.P., Boudinot, P., Colin, I., Benmansour, A., Peyrieras, N., Herbomel, P., Lutfalla, G., 2007. Identification of the zebrafish IFN receptor: implications for the origin of the vertebrate IFN system. J. Immunol. 178, 4385e4394. Li, S., Lu, L.F., Feng, H., Wu, N., Chen, D.D., Zhang, Y.B., Gui, J.F., Nie, P., Zhang, Y.A., 2014. IFN regulatory factor 10 is a negative regulator of the IFN responses in fish. J. Immunol. 193, 1100e1109. Lopez-Munoz, A., Roca, F.J., Meseguer, J., Mulero, V., 2009. New insights into the evolution of IFNs: zebrafish group II IFNs induce a rapid and transient expression of IFN-dependent genes and display powerful antiviral activities. J. Immunol. 182, 3440e3449. Meylan, E., Tschopp, J., Karin, M., 2006. Intracellular pattern recognition receptors in the host response. Nature 442, 39e44. Mogensen, T.H., 2009. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 22, 240e273. Table of Contents. Panne, D., McWhirter, S.M., Maniatis, T., Harrison, S.C., 2007. Interferon regulatory factor 3 is regulated by a dual phosphorylation-dependent switch. J. Biol. Chem. 282, 22816e22822. Paun, A., Pitha, P.M., 2007. The IRF family, revisited. Biochimie 89, 744e753. Sharma, S., tenOever, B.R., Grandvaux, N., Zhou, G.P., Lin, R., Hiscott, J., 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300, 1148e1151. Shi, J., Zhang, Y.B., Zhang, J.S., Gui, J.F., 2013. Expression regulation of zebrafish interferon regulatory factor 9 by promoter analysis. Dev. Comp. Immunol. 41, 534e543. Sun, F., Zhang, Y.B., Liu, T.K., Gan, L., Yu, F.F., Liu, Y., Gui, J.F., 2010. Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates. J. Immunol. 185, 7573e7582. Takeuchi, O., Akira, S., 2007. Recognition of viruses by innate immunity. Immunol. Rev. 220, 214e224. Tanaka, Y., Chen, Z.J., 2012. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal. 5, ra20. Taniguchi, T., Ogasawara, K., Takaoka, A., Tanaka, N., 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19, 623e655. Xiang, L.X., He, D., Dong, W.R., Zhang, Y.W., Shao, J.Z., 2010. Deep sequencing-based transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus reveals insight into the immune-relevant genes in marine fish. BMC Genom. 11, 472. Yao, C.L., Huang, X.N., Fan, Z., Kong, P., Wang, Z.Y., 2012. Cloning and expression analysis of interferon regulatory factor (IRF) 3 and 7 in large yellow croaker, Larimichthys crocea. Fish Shellfish Immunol. 32, 869e878. Zhu, L.Y., Nie, L., Zhu, G., Xiang, L.X., Shao, J.Z., 2013. Advances in research of fish immune-relevant genes: a comparative overview of innate and adaptive immunity in teleosts. Dev. Comp. Immunol. 39, 39e62.