- Email: [email protected]
Molecular characterization of novel variants of interferon-tau (IFNT) gene in Garole breed of sheep (Ovis aries)
Animal Reproduction Science 104 (2008) 238–247
Molecular characterization of novel variants of interferon-tau (IFNT) gene in Garole breed of sheep (Ovis aries) Konadaka S. Rajaravindra, Pranab Jyoti Das 1 , Kandasamy Sukumar, Sankar Kumar Ghosh 1 , Abhijit Mitra ∗ Genome Analysis Laboratory, Animal Genetics Division, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP India Received 7 September 2006; received in revised form 20 February 2007; accepted 21 February 2007 Available online 23 February 2007
Abstract The survivability of embryo, especially during the early embryonic life is dependant on the effective maternal recognition of pregnancy. Interferon-tau (IFNT), secreted from the elongating blastocyst, acts as the primary signal for maternal recognition of pregnancy in ruminant ungulates. IFNT has been studied extensively in many domesticated and wild ruminant species. In the present study, we have cloned and characterized the IFNT gene of Garole sheep, a popular Indian micro-sheep breed, which is known across the world for its high prolificacy and fecundity. The 588 bp sequences of two variants of IFNT gene described in this study are novel variants, compared to the variants reported previously in sheep. It exhibited more than 96% identity with other ovine IFNT variants and phylogenetically placed in a single clad containing the ovine, caprine and musk ox IFNT variants. The IFNT of Garole sheep demonstrated the highest identity with the genomic derived and highly expressed ovine IFNT variants. © 2007 Elsevier B.V. All rights reserved. Keywords: Sheep; Garole; Interferon-tau (IFNT) variants; Maternal recognition of pregnancy
1. Introduction Early embryonic mortality is a major cause of reproductive wastage in domestic animals (Thatcher et al., 1994). Embryo survivability during initial stages is mostly dependant on the ∗
Corresponding author. Tel.: +91 581 2303384; fax: +91 581 2303284. E-mail address: [email protected] (A. Mitra). 1 Present address: Department of Animal Genetics and Breeding, West Bengal University of Animal and Fisheries Sciences, Kolkata 700037, India. 0378-4320/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.anireprosci.2007.02.012
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
239
efficient maternal recognition of pregnancy (MRP). In ruminant ungulates, MRP initiates with the inhibition of uterine production of luteolytic pulses of PGF2␣ , which is mediated through interferon tau (IFNT) (Bazer et al., 1991; Roberts et al., 1996). The IFNT secreted by the trophectoderm of elongating blastocyst thus acts as a primary signal for MRP (Godkin et al., 1984; Roberts et al., 1991). It exerts the antiluteolytic action through a cascade phenomenon involving either stabilization or up-regulation of progesterone receptors in the endometrium, inhibition of number of endometrial estrogen and oxytocin receptors and/or inducing the synthesis of an inhibitor of enzymes necessary for PGF2␣ synthesis (Bazer et al., 1991; Spencer and Bazer, 2004). Since its first characterization in sheep (Godkin et al., 1982), IFNT genes have been characterized in several domestic (Meyer et al., 1995; Newton et al., 1996) as well as wild ruminant ungulate species (Leaman and Roberts, 1992; Liu et al., 1996; Demmers et al., 1999; Rasmussen et al., 2005, Rajaravindra et al., 2006). Being a member of the Type I interferon family, IFNT is encoded by a cluster of genes (Ealy et al., 2001). To date a total of 21, 12 and 10 polymorphic variants have been identified in sheep (Alexenko et al., 2000), cattle (Ealy et al., 2001) and goat (Ealy et al., 2004), respectively. India has the distinction of possessing 44 descript breeds of sheep that accounts for almost one fifth of the total Asian population (Acharya, 2002). Amongst, Garole is the world’s most prolific breed of sheep that presumably has contributed to the prolificacy gene (FecB) in Australian Booroola Merino sheep (Turner, 1982). In this manuscript, we report the characterization of two novel variants of IFNT gene in Garole sheep. 2. Materials and methods 2.1. DNA isolation Genomic DNA was isolated from the venous blood using standard phenol–chloroform extraction method (Sambrook et al., 1989). The quality and integrity of the genomic DNA was determined using agarose gel (0.7%) electrophoresis and visualization under UV light after staining with ethidium bromide. The purity and quantity of genomic DNA was checked using the spectrophotometric reading at OD260 and OD280. 2.2. Polymerase chain reaction The genomic DNA isolated from one animal of Garole sheep was used as template for amplifying the IFNT gene. A pair of degenerate primers (viz., IFNT/startF-5 ATGGCCTTCGTGCTCTCTCT3 and IFNT/stopR-5 TCAARGTGAGTTCAGATCT3 ) designed on the basis of IFNT sequences of cattle (Acc. No. AF238611–AF238613), sheep (Acc. No. M88773) and goat (Acc. No. M73243) were used. PCR amplification was carried out in a total volume of 25 l of reaction mixture containing 100 ng of genomic DNA, 1X PCR buffer [100 mM Tris–HCl (pH 8.8 at 25 ◦ C), 500 mM KCl and 0.8% Nonidet P40], 1.5 mM MgCl2, 200 M dNTPs, 2 M of each primer and 1.0 unit of Taq DNA polymerase. A negative control with no template DNA was also included. The PCR protocol involved an initial denaturation at 95 ◦ C for 3 min followed by 30 cycles of denaturation (95 ◦ C for 30 s), annealing (56 ◦ C for 30 s) and extension (72 ◦ C for 45 s) proceeded by one cycle of final extension (72 ◦ C for 10 min). The PCR product was checked by agarose gel (1%) electrophoresis in 1X TAE buffer after staining with ethidium bromide.
240
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
2.3. Cloning of amplified fragment The PCR product was cloned into PDrive vector (QIAGEN Inc., U.S.A.) following the manufacturers instructions. Positive recombinant clones were identified using blue and white screening. Further the presence of the insert was confirmed by restriction digestion with EcoRI and using plasmid PCR. 2.4. Sequencing and sequence analysis of IFNT gene The positive clones as well as the direct PCR product were sequenced using an ABI PRISM automatic sequencer (version 2.0) using standard cycle conditions by Sanger’s dideoxy chain termination method with standard sequencing primers (viz., T7 and SP6) and the primers employed for amplification, respectively. The sequences were subjected to BLAST analysis (www.ncbi.nlm.nih.gov/BLAST). The nucleotide as well as deduced amino acid sequences of IFNT were aligned with that of ruminant ungulate species available in the GenBank database using the Clustal method of MegAlign Programme of Lasergene Software (DNASTAR). A phylogram was also constructed to analyze the evolutionary significance. 3. Results 3.1. Amplification, cloning and sequencing of the Garole IFNT gene Agarose gel electrophoresis of the amplicon as expected revealed an amplification of a fragment of approximately 588 bp (Fig. 1). The size of the amplicon was further confirmed by the nucleotide sequencing. A total of five prospective recombinant colonies that contained the 588 bp insert were sequenced. The sequences of insert from two clones showed 95% identity with bovine IFNT and IFN- and 93% identity with ovine IFN-. Since these sequences were found to be pseudogenes having 94% similarity with the bovine IFN␣II pseudogenes available in the GenBank, they were not analyzed further. However, the BLAST search of the sequence obtained by direct sequencing and the sequences of the insert from remaining three clones retrieved IFNT sequences of different domestic and wild species exhibiting more than 80% identity. Interestingly, one among the three clones exhibited 100% identity with the directly sequenced PCR product while the remaining two clones were found to be identical. These two Garole IFNT (garIFNT) variants showed 98.1 and 95.3% identity at nucleotide and deduced amino acid sequences, respectively. Nevertheless, these garIFNT sequences did not exactly match with any of the reported sequences of different ovine IFNT (ovIFNT) variants. Accordingly, these novel sequences of IFNT gene viz., garIFNT1 and garIFNT2 were submitted in the GenBank database under accession numbers DQ149979 and EF405983, respectively. 3.2. Nucleotide and amino acid sequence identity The degree of identity of garIFNT variants with that of different domestic as well as wild ruminant ungulate species is presented in Table 1. At nucleotide sequence level, both the garIFNT variants exhibited 95.6–99.7, 95.6–97.1 and 89.0–90.1% identity with IFNT variants of ovine, caprine and bovine, respectively. At the deduced amino acid level, however, they showed
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
241
Fig. 1. Amplification of IFNT gene from genomic DNA of Garole breed of sheep. Lane 1: negative control; Lane M: 50 bp DNA ladder; Lane 2: amplified PCR product.
89.0–98.8, 89.9–94.8 and 79.1–83.1% identity, respectively. When compared with the IFNT of different wild ruminant ungulates, the garIFNT variants demonstrated highest and least identity with that of musk ox and musk deer, respectively. 3.3. Phylogenetic analysis The dendograms constructed on the basis of either the nucleotide or deduced amino acid sequences of IFNT gene of all the species available in the GenBank showed almost the similar groupings. IFNT variants of Garole fall into the same clad that contained all the variants of ovine, caprine and musk ox (figure not shown). However, on inclusion of only ovIFNT variants, three distinct classes were formed. Interestingly, garIFNT1 variant was grouped under class A while garIFNT2 was placed under class B (Fig. 2). 4. Discussion To date, 21 ovIFNT variants have been characterized either by sequencing of cDNA from the elongating blastocyst or from genomic DNA (Imakawa et al., 1987; Klemann et al., 1990; Leaman and Roberts, 1992; Nephew et al., 1993; Stewart et al., 1989; Winkelman et al., 1999). These polymorphic variants of ovIFNT have shown differences in their level of expression as well as in their biological activity (Nephew et al., 1993; Ealy et al., 1998). Phylogenetically, these variants are grouped into three distinct classes viz., A, B and C (Winkelman et al., 1999). Interestingly, all the known expressed ovIFNT variants belonged to class A and B, whereas, the variants of
242 Table 1 Identity at nucleotide and deduced amino acid (of mature peptide) level of the garIFNT variants with the IFNT variants of ovine, caprine, bovine and other wild ruminant ungulates available in the GenBank Degree of identity Identity at nucleotide sequence level
Identity at amino acid sequence level
garIFNT1 (DQ149979)
garIFNT2 (EF405983)
garIFNT1 (DQ149979)
garIFNT2 (EF405983)
99.7% SHPO7TP (M88771) 95.6% SHPOTP1B (M73241)
99.7% OATP1P6 (X56343) 96.0% ovIFNT p8v3 (AF158819)
97.7% ovIFNT p8v4 (AF158820) 89.0% SHPOTP1B (M73241)
98.8% OATP1P6 (X56343) 90.7% SHPOTP1B (M73241)
Caprine Highest Least
96.9% cIFNT 3 (AY357329) 95.6% cIFNT 6 (AY357336)
97.1% cIFNT 3 (AY357329) 96.4% cIFNT 6 (AY357336)
93.6% cIFNT 2a (AY357327) 89.9% cIFNT 5 (AY357335)
94.8% cIFNT 2a (AY357327) 91.9% cIFNT 6 (AY357336)
Bovine Highest Least
90.1% bIFNT c2 (AF238612) 89.1% bIFNT 1c (AF196320)
90.0% bIFNT c2 (AF238612) 89.0% bIFNT 1c (AF196320)
82.0% bIFNT 2c (AF196323) 79.1% bIFNT c1 (AF238613)
83.1% bIFNT 3a (AF196324) 80.8% bIFNT c1 (AF238613)
94.4% 89.1% 88.7% 88.8% 87.4% 86.9% 86.6%
95.6% 89.3% 89.0% 88.3% 86.9% 87.1% 86.6%
87.2% 79.1% 79.8% 75.0% 75.0% 75.6% 68.6%
90.7% 82.0% 82.9% 73.8% 75.0% 77.3% 69.8%
Domestic ruminant ungulates Ovine Highest Least
Wild ruminant ungulates Musk Ox (M73244) American Bison (AY643747) Yak (AY455289) Mithun (AY665674) Red Deer (AJ000638) Giraffe (U55050) Musk Deer (DQ139308)
For ovine, caprine and bovine species, IFNT variants exhibiting the highest and the least identity with the garIFNT variants are only shown. The GenBank accession numbers are mentioned in the parenthesis.
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Ruminant species
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
243
Fig. 2. Phylogram on the basis of nucleotide sequences of Garole IFNT and other ovIFNT variants.
class C likely represented pseudogenes and poorly expressed forms. Further, all variants of class C were obtained through genomic cloning (Leaman and Roberts, 1992; Nephew et al., 1993) and none have been detected as cDNA (Winkelman et al., 1999). However, through genomic cloning, Nephew et al. (1993) isolated a variant SHP010TP, a member of the class A, which is reported to be the predominant form of IFNT expressed by ovine conceptuses. Interestingly, the present sequences of garIFNT, which have also been amplified from the genomic DNA, shared greater identity at amino acid level with the variants of class A and class B ovIFNT (94.2–98.8%) than that of class C (90.1–93.0%). We suspect that these variants are one of the most predominantly expressed form of IFNT in Garole breed of sheep. The IFNT genes are believed to have evolved from a common ancestral IFN- by a duplication event that occurred 36 million years ago and maintained among the ungulate ruminants without any change in the size of the gene (Roberts et al., 1997). Like its progenitor IFN-, the 585 bp ORF of the IFNT gene encodes for a 195 amino acid pre-protein of which the first 23 residues is the signal peptide that is cleaved off to yield a mature protein of 172 amino acids (Roberts et al., 1997). The IFNT protein of different species studied so far including the deduced garIFNT protein, possess the conserved Cys residues at four different positions (1, 29, 99 and 139) (Fig. 3) and a Ser-Leu-Gly residue preceding the position −1 Cys as reported earlier (Jarpe et al., 1994; Imakawa et al., 1987). All type I IFN subtypes, including IFNT, possess five ␣-helices separated by loop regions (Senda et al., 1992, 1995a,b; Radhakrishnan et al., 1999). These five helices in garIFNT are predicted as helix A (residues 4–20), helix B (52–68), helix C (79–100), helix D (115–133), and helix E (138–158) (Fig. 3). A high degree of sequence conservation is observed in the hydrophilic AB loop region (residues 24–48) and in the more hydrophobic region between residues 120 and 144 amongst type I IFNs across the mammalian species as well as in IFNTs of ruminant ungulate species (data not shown). These highly conserved residues on AB loop, helix D and the DE loop are predicted to constitute the IFN receptor-2 (IFNR2) binding site (Mitsui et al., 1993). The helix A along with helix C is proposed to interact with signal transducting IFNR1
244
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Fig. 3. An alignment of the mature IFNT proteins (172 amino acids) of Garole breed of sheep with that of other reported variants of ovIFNT accessible in the GenBank. The location of the ␣-helices (helix A: 4–20; helix B: 52–68; helix C: 79–100; helix D: 115–133; helix E: 138–158) are shown as horizontal black bars. The potential glyscosylation site Asn78 is represented by an asterisk.
(Uze et al., 1995). However, large structural differences between ovIFNT and human IFN-alpha in helix B and the BC loop further suggest the involvement of this region in unique function of ovIFNT as antiluteolytic hormone (Radhakrishnan et al., 1999). Reports delineating the biological activities of different IFNT variants are very limited. Despite having close structural similarities, p3 ovIFNT variant (Acc. No. X56341) of class A form was reported to have more potent antiluteolytic activity than another class A ovIFNT variant p8 (Acc. No. X56345) (Ealy et al., 1998; Winkelman et al., 1999). Variants p3 and p8 differed only by three amino acid substitutions at positions 101 (Asp → Gly), 107 (Lys → Glu) and 128 (His → Tyr). Due to its close proximity to a putative receptor binding region (Roberts et al., 1997;
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
245
Radhakrishnan et al., 1999), replacement of Tyr with His at position 128 is probably responsible for improved antiluteolytic activity of p3 variant (Winkelman et al., 1999). Presence of His at position 128 in both garIFNT variants may also provide better antiluteolytic activity. IFNT is known to exist in both glycosylated and non-glycosylated forms. Although, the molecular mass of these two forms varies between 20 and 22 kDa, both the forms are biologically active (Bazer et al., 1994). In bovine, all known IFNT variants contain a potential N-linked glycosylation site at Asn78 and are glycosylated (Ealy et al., 2001). However, while cloning nine IFNT variants in buffalo (Bubalus bubalis), we have observed only four variants with potential N-glycosylation site at Asn78 (unpublished data). Like bovine, mithun (Bos frontalis) IFNT contains a potential glycosylation site at Asn78 (Rajaravindra et al., 2006). On the contrary, in caprine both glycosylated and non-glycosylated forms of IFNT are present and non-glycosylated IFNT variants contain Asp78 instead of Asn78 (Baumbach et al., 1990). In ovine, although, some variants possess a potential glycosylation site at Asn78 , none of them are found to be glycosylated (Anthony et al., 1988; Winkelman et al., 1999). Intriguingly, amongst 21 ovIFNT variants reported so far, all eight variants belonging to class B and C possess the conserved Asn78 . Whereas, potential glycosylation site is absent in all the variants belonging to the class A. Among the two garIFNT variants, as anticipated, garIFNT1 being a member of class A lacks glycosylation site while the garIFNT2 of class B possess the conserved Asn78 (Fig. 3). The reason for such bias in glycosylation pattern between the classes is yet unknown. N-glycosylation, an important post-translational modification in eukaryotic cells, influences the structure and biological function of proteins including protein stability, protein secretion, receptor interaction, and subsequent downstream biological activity (Varki, 1993). Although, multiple genes are known to encode cytokines including IFNs, glycosylation often serves as an additional mechanism for providing heterogeneity to these molecules (Opdenakker et al., 1995). Studies in cattle (Ealy et al., 2001; Klemann et al., 1990) as well as in goat (Guillomot et al., 1998) demonstrated that both the glycosylated and non-glycosylated recombinant IFNT possess identical biological activity. In contrast to this, experimental evidence suggests that glycosylation increases the stability as well as longevity of recombinant human IFN (Runkel et al., 1998). Nevertheless, the structural or functional significance of glycosylation of IFNT molecule in utero is yet to be resolved. The Garole breed of sheep is well known for its remarkably high reproductive potential which is evident from the occurrence of multiple births with a frequency of 55–60% twins, 15–20% triplets and 1–2% quadruplets against only 25–30% singleton (Singh and Bohra, 1996). The prolificacy and fecundity in sheep are reported to be regulated by a single gene FecB (Davis et al., 2002). However, it is quite likely that after fertilization the establishment of pregnancy will be determined by the efficiency of MRP. Since IFNT molecule acts as a primary signal in MRP, we speculated the existence of novel variants of IFNT having potential antiluteolytic property in Garole sheep. In conclusion, we have characterized two novel IFNT variants in Garole breed of sheep, which are the first ever sequences of ovIFNT of any breed of sheep from the Indian subcontinent.We suspect that these variants of garIFNT are representative of several highly expressed forms, however, identification of other novel IFNT variants in Garole sheep could not be ruled out. Acknowledgements Financial assistance provided to KSR in the form of Junior Research Fellowship (ICAR) is duly acknowledged. The authors are grateful to Dr. B.S. Prakash, Head, Division of Dairy Cattle Physiology, National Dairy Research Institute, Karnal, Dr. G.K. Das, Senior Scientist, Division of Animal Reproduction, Indian Veterinary Research Institute, Izatnagar, Dr. A.R. Sirothia, Assoc.
246
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Prof. Dept. of Animal Genetics and Breeding, Nagpur Veterinary College, MAFSU, Nagpur and Dr. M.D. Marcus Leo, PhD Scholar, Division of Pharmacology and Toxicology, Indian Veterinary Research Institute, Izatnagar for critical reading of this manuscript.
References Acharya, R.M., 2002. Handbook of Animal Husbandry, Third revised ed. ICAR, New Delhi, pp. 54–55. Alexenko, A.P., Ealy, A.D., Bixby, J.A., Roberts, R.M., 2000. A classification for the interferon-. J. Interf. Cytok. Res. 20, 817–822. Anthony, R.V., Helmer, S.D., Sharif, S.F., Roberts, R.M., Hansen, P.J., Thatcher, W.W., Bazer, F.W., 1988. Synthesis and processing of ovine trophoblast protein-1 and bovine trophoblast protein-1, conceptus secretory proteins involved in the maternal recognition of pregnancy. Endocrinology 123, 1274–1280. Baumbach, G.A., Duby, R.T., Godkin, J.D., 1990. N-Glycosylated and unglycosylated forms of caprine trophoblast protein-1 are secreted by preimplantation goat conceptuses. Biochem. Biophys. Res. Commun. 172, 16–21. Bazer, F.W., Ott, T.L., Spencer, T.E., 1994. Pregnancy recognition in ruminants, pigs and horses: signals from the trophoblast. Theriogenology 41, 79–94. Bazer, F.W., Thatcher, W.W., Hansen, P.J., Mirando, M.A., Ott, T.L., Plante, C., 1991. Physiological mechanisms of pregnancy recognition in ruminants. J. Reprod. Fert. Suppl. 43, 39–47. Davis, G.H., Galloway, S.M., Ross, I.K., Gregan, S.M., Ward, J., Nimbkar, B.V., Ghalsasi, P.M., Nimbkar, C., Gray, G.D., Subandriyo, Inounu, I., Tiesnamurti, B., Martyniuk, E., Eythorsdottir, E., Mulsant, P., Lecerf, F., Hanrahan, J.P., Bradford, G.E., Wilson, T., 2002. DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation. Biol. Reprod. 66, 1869–1874. Demmers, K.J., Kaluz, S., Deakin, D.W., Jabbour, H.N., Flint, A.P., 1999. Production of interferon by the conceptus in red deer (Cervus elaphus). J. Reprod. Fert. 115, 59–65. Ealy, A.D., Green, J.A., Alexenko, A.P., Keisler, D.H., Roberts, R.M., 1998. Different ovine interferon- genes are not expressed identically and their protein products display different activities. Biol. Reprod. 58, 566–573. Ealy, A.D., Lanson, S.F., Liu, L., Alexenko, A.P., Winkelman, G.L., Kubisch, H.M., Bixby, J.A., Roberts, R.M., 2001. Polymorphic forms of expressed bovine interferon- genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 142, 2906– 2915. Ealy, A.D., Wagner, S.K., Sheils, A.E., Whitley, N.C., Kiesling, D.O., Johnson, S.E., Barbato, G.F., 2004. Identification of interferon- isoforms expressed by the peri-implantation goat (Capra hircus) conceptus. Domest. Anim. Endocrinol. 27, 39–49. Godkin, J.D., Bazer, F.W., Moffat, J., Sessions, F., Roberts, R.M., 1982. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts on day 13–21. J. Reprod. Fert. 65, 141– 150. Godkin, J.D., Bazer, F.W., Roberts, R.M., 1984. Ovine trophoblast protein-1, an early secreted blastocyst protein binds specifically to uterine endometrium and affects protein synthesis. Endocrinology 114, 120–130. Guillomot, M., Reinaud, P., La Bonnardiere, C., Charpigny, G., 1998. Characterization of conceptus-produced goat interferon tau and analysis of its temporal and cellular distribution during early pregnancy. J. Reprod. Fert. 112, 149–156. Imakawa, K., Anthony, R.V., Kazemi, M., Marotti, K.R., Polites, H.G., Roberts, R.M, 1987. Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature 330, 377–379. Jarpe, M.A., Johnson, H.M., Bazer, F.W., Ott, T.L., Curto, E.V., Krishna, N.R., Pontzer, C.H., 1994. Predicted structural motif of IFNT. Prot. Eng. 7, 863–867. Klemann, S.W., Li, J., Imakawa, K., Cross, J.C., Francis, H., Roberts, R.M., 1990. The production, purification, and bioactivity of recombinant bovine trophoblast protein-1 (bovine trophoblast interferon). Mol. Endocrinol. 4, 1506–1514. Leaman, D.W., Roberts, R.M., 1992. Genes for the trophoblast interferons in sheep, goat, and musk ox and distribution of related genes among mammals. J. Interf. Res. 12, 1–11. Liu, L., Leaman, D.W., Roberts, R.M., 1996. The interferon- genes of the giraffe, a non bovid species. J. Interf. Cytok. Res. 16, 949–951. Meyer, M.D., Hansen, P.J., Thatcher, W.W., Drost, M., Badinga, L., 1995. Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2␣ of cows in response to recombinant interferon-. J. Dairy Sci. 78, 1921–1931.
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
247
Mitsui, Y., Senda, T., Shimazu, T., Matsuda, S., Utsumi, J., 1993. Structural, functional and evolutionary implications of the three-dimensional crystal structure of murine interferon-beta. Pharmacol. Ther. 58, 93–132. Nephew, K.P., Whaley, A.E., Christenson, R.K., Imakawa, K., 1993. Differential expression of distinct mRNAs for ovine trophoblast protein-1 and related sheep type I interferons. Biol. Reprod. 48, 768–778. Newton, G.R., Ott, T.L., Woldesenbet, S., Shelton, A.H., Bazer, F.W., 1996. Biochemical and immunological properties of related small ruminant trophoblast interferons. Theriogenology 46, 703–716. Opdenakker, G., Rudd, P.M., Wormald, M., Dwek, R.A., Van Damme, J., 1995. Cells regulate the activities of cytokines by glycosylation. FASEB J. 9, 453–457. Radhakrishnan, R., Walter, L.J., Subramaniam, P.S., Johnson, H.M., Walter, M.R., 1999. Crystal structure of ovine ˚ resolution. J. Mol. Biol. 286, 151–162. interferon-tau at 2.1 A Rajaravindra, K.S., Mitra, A., Sharma, A.K., Deb, S.M., Sharma, A., 2006. Molecular characterization of the interferon-tau gene of the Mithun (Bos frontalis). Zool. Sci. 23, 607–611. Rasmussen, T.A., Ealy, A.D., Kubisch, H.M., 2005. Identification of bovine and novel interferon- alleles in the American plains bison (Bison bison) by analysis of hybrid cattle × bison blastocysts. Mol. Reprod. Dev. 70, 228–234. Roberts, R.M., Klemann, S.W., Leaman, D.W., Bixby, J.A., Cross, J.C., Farin, C.E., Imakawa, K., Hansen, T.R., 1991. The polypeptides and genes for ovine and bovine trophoblast protein-1. J. Reprod. Fert. Suppl. 43, 3–12. Roberts, R.M., Liu, L., Alexenko, A.P., 1997. New and atypical families of type I interferons in mammals: comparative functions, structures and evolutionary relationships. Prog. Nucl. A: Res. Mol. Biol. 56, 287–325. Roberts, R.M., Xie, S., Mathialagan, N., 1996. Maternal recognition of pregnancy. Biol. Reprod. 54, 294–302. Runkel, L., Meier, W., Pepinsky, R.B., Karpusas, M., Whitty, A., Kimball, K., Brickelmaier, M., Muldowney, C., Jones, W., Goelz, S.E., 1998. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm. Res. 15, 641–649. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, vol. 3, 2nd ed. Cold Spring Harbour Library Press, pp. 6.3–6.4. Senda, T., Shimazu, T., Matsuda, S., Kawano, G., Shimazu, H., Nakamura, K.T., Mitsui, Y., 1992. Three dimensional crystal structure of recombinant murine interferon-. EMBO J. 11, 3193–3201. ˚ resolution. Senda, T., Saitoh, S.-I., Mitsui, Y., 1995a. Refined crystal structure of recombinant murine interferon-b at 2.15 A J. Mol. Biol. 253, 187–207. Senda, T., Saitoh, S.I., Mitsui, Y., Li, J., Roberts, R.M., 1995b. A three-dimensional model of interferon-tau. J. Interf. Cytok. Res. 15, 1053–1060. Singh, R.N., Bohra, S.D.J., 1996. Garole sheep: a profile (Bengal breed of sheep locally known as Garole). Ind. J. Small Rum. 2, 38–42. Spencer, T.E., Bazer, F.W., 2004. Conceptus signals for establishment and maintenance of pregnancy. Reprod. Biol. Endocrinol. 2, 49–58. Stewart, H.J., McCann, S.H., Northrop, A.J., Lamming, G.E., Flint, A.P., 1989. Sheep antiluteolytic interferon: cDNA sequence and analysis of mRNA levels. J. Mol. Endocrinol. 2, 65–70. Thatcher, W.W., Staples, C.R., Danet-Desnoyers, G., Oldick, B., Schmidt, E.P., 1994. Embryo health and mortality in sheep and cattle. J. Anim. Sci. 72, 16–30. Turner, H.N., 1982. Origins of the CSIRO Booroola. In: Piper, L.R., Bindon, B.M., Nethery, R.D. (Eds.), The Booroola Merino. CSIRO, Melbourne, pp. 1–7. Uze, G., Lutfalla, G., Mogensen, K.E., 1995. Alpha and beta interferons and their receptor and their friends and relations. J. Interf. Cytok. Res. 15, 3–26. Varki, A., 1993. Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3, 97–130. Winkelman, G.L., Roberts, R.M., Peterson, A.J., Alexenko, A.P., Ealy, A.D., 1999. Identification of the expressed forms of ovine interferon- in the peri-implantation conceptus: sequence relationships and comparative biological Activities. Biol. Reprod. 61, 1592–1600.
Molecular characterization of novel variants of interferon-tau (IFNT) gene in Garole breed of sheep (Ovis aries) Konadaka S. Rajaravindra, Pranab Jyoti Das 1 , Kandasamy Sukumar, Sankar Kumar Ghosh 1 , Abhijit Mitra ∗ Genome Analysis Laboratory, Animal Genetics Division, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP India Received 7 September 2006; received in revised form 20 February 2007; accepted 21 February 2007 Available online 23 February 2007
Abstract The survivability of embryo, especially during the early embryonic life is dependant on the effective maternal recognition of pregnancy. Interferon-tau (IFNT), secreted from the elongating blastocyst, acts as the primary signal for maternal recognition of pregnancy in ruminant ungulates. IFNT has been studied extensively in many domesticated and wild ruminant species. In the present study, we have cloned and characterized the IFNT gene of Garole sheep, a popular Indian micro-sheep breed, which is known across the world for its high prolificacy and fecundity. The 588 bp sequences of two variants of IFNT gene described in this study are novel variants, compared to the variants reported previously in sheep. It exhibited more than 96% identity with other ovine IFNT variants and phylogenetically placed in a single clad containing the ovine, caprine and musk ox IFNT variants. The IFNT of Garole sheep demonstrated the highest identity with the genomic derived and highly expressed ovine IFNT variants. © 2007 Elsevier B.V. All rights reserved. Keywords: Sheep; Garole; Interferon-tau (IFNT) variants; Maternal recognition of pregnancy
1. Introduction Early embryonic mortality is a major cause of reproductive wastage in domestic animals (Thatcher et al., 1994). Embryo survivability during initial stages is mostly dependant on the ∗
Corresponding author. Tel.: +91 581 2303384; fax: +91 581 2303284. E-mail address: [email protected] (A. Mitra). 1 Present address: Department of Animal Genetics and Breeding, West Bengal University of Animal and Fisheries Sciences, Kolkata 700037, India. 0378-4320/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.anireprosci.2007.02.012
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
239
efficient maternal recognition of pregnancy (MRP). In ruminant ungulates, MRP initiates with the inhibition of uterine production of luteolytic pulses of PGF2␣ , which is mediated through interferon tau (IFNT) (Bazer et al., 1991; Roberts et al., 1996). The IFNT secreted by the trophectoderm of elongating blastocyst thus acts as a primary signal for MRP (Godkin et al., 1984; Roberts et al., 1991). It exerts the antiluteolytic action through a cascade phenomenon involving either stabilization or up-regulation of progesterone receptors in the endometrium, inhibition of number of endometrial estrogen and oxytocin receptors and/or inducing the synthesis of an inhibitor of enzymes necessary for PGF2␣ synthesis (Bazer et al., 1991; Spencer and Bazer, 2004). Since its first characterization in sheep (Godkin et al., 1982), IFNT genes have been characterized in several domestic (Meyer et al., 1995; Newton et al., 1996) as well as wild ruminant ungulate species (Leaman and Roberts, 1992; Liu et al., 1996; Demmers et al., 1999; Rasmussen et al., 2005, Rajaravindra et al., 2006). Being a member of the Type I interferon family, IFNT is encoded by a cluster of genes (Ealy et al., 2001). To date a total of 21, 12 and 10 polymorphic variants have been identified in sheep (Alexenko et al., 2000), cattle (Ealy et al., 2001) and goat (Ealy et al., 2004), respectively. India has the distinction of possessing 44 descript breeds of sheep that accounts for almost one fifth of the total Asian population (Acharya, 2002). Amongst, Garole is the world’s most prolific breed of sheep that presumably has contributed to the prolificacy gene (FecB) in Australian Booroola Merino sheep (Turner, 1982). In this manuscript, we report the characterization of two novel variants of IFNT gene in Garole sheep. 2. Materials and methods 2.1. DNA isolation Genomic DNA was isolated from the venous blood using standard phenol–chloroform extraction method (Sambrook et al., 1989). The quality and integrity of the genomic DNA was determined using agarose gel (0.7%) electrophoresis and visualization under UV light after staining with ethidium bromide. The purity and quantity of genomic DNA was checked using the spectrophotometric reading at OD260 and OD280. 2.2. Polymerase chain reaction The genomic DNA isolated from one animal of Garole sheep was used as template for amplifying the IFNT gene. A pair of degenerate primers (viz., IFNT/startF-5 ATGGCCTTCGTGCTCTCTCT3 and IFNT/stopR-5 TCAARGTGAGTTCAGATCT3 ) designed on the basis of IFNT sequences of cattle (Acc. No. AF238611–AF238613), sheep (Acc. No. M88773) and goat (Acc. No. M73243) were used. PCR amplification was carried out in a total volume of 25 l of reaction mixture containing 100 ng of genomic DNA, 1X PCR buffer [100 mM Tris–HCl (pH 8.8 at 25 ◦ C), 500 mM KCl and 0.8% Nonidet P40], 1.5 mM MgCl2, 200 M dNTPs, 2 M of each primer and 1.0 unit of Taq DNA polymerase. A negative control with no template DNA was also included. The PCR protocol involved an initial denaturation at 95 ◦ C for 3 min followed by 30 cycles of denaturation (95 ◦ C for 30 s), annealing (56 ◦ C for 30 s) and extension (72 ◦ C for 45 s) proceeded by one cycle of final extension (72 ◦ C for 10 min). The PCR product was checked by agarose gel (1%) electrophoresis in 1X TAE buffer after staining with ethidium bromide.
240
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
2.3. Cloning of amplified fragment The PCR product was cloned into PDrive vector (QIAGEN Inc., U.S.A.) following the manufacturers instructions. Positive recombinant clones were identified using blue and white screening. Further the presence of the insert was confirmed by restriction digestion with EcoRI and using plasmid PCR. 2.4. Sequencing and sequence analysis of IFNT gene The positive clones as well as the direct PCR product were sequenced using an ABI PRISM automatic sequencer (version 2.0) using standard cycle conditions by Sanger’s dideoxy chain termination method with standard sequencing primers (viz., T7 and SP6) and the primers employed for amplification, respectively. The sequences were subjected to BLAST analysis (www.ncbi.nlm.nih.gov/BLAST). The nucleotide as well as deduced amino acid sequences of IFNT were aligned with that of ruminant ungulate species available in the GenBank database using the Clustal method of MegAlign Programme of Lasergene Software (DNASTAR). A phylogram was also constructed to analyze the evolutionary significance. 3. Results 3.1. Amplification, cloning and sequencing of the Garole IFNT gene Agarose gel electrophoresis of the amplicon as expected revealed an amplification of a fragment of approximately 588 bp (Fig. 1). The size of the amplicon was further confirmed by the nucleotide sequencing. A total of five prospective recombinant colonies that contained the 588 bp insert were sequenced. The sequences of insert from two clones showed 95% identity with bovine IFNT and IFN- and 93% identity with ovine IFN-. Since these sequences were found to be pseudogenes having 94% similarity with the bovine IFN␣II pseudogenes available in the GenBank, they were not analyzed further. However, the BLAST search of the sequence obtained by direct sequencing and the sequences of the insert from remaining three clones retrieved IFNT sequences of different domestic and wild species exhibiting more than 80% identity. Interestingly, one among the three clones exhibited 100% identity with the directly sequenced PCR product while the remaining two clones were found to be identical. These two Garole IFNT (garIFNT) variants showed 98.1 and 95.3% identity at nucleotide and deduced amino acid sequences, respectively. Nevertheless, these garIFNT sequences did not exactly match with any of the reported sequences of different ovine IFNT (ovIFNT) variants. Accordingly, these novel sequences of IFNT gene viz., garIFNT1 and garIFNT2 were submitted in the GenBank database under accession numbers DQ149979 and EF405983, respectively. 3.2. Nucleotide and amino acid sequence identity The degree of identity of garIFNT variants with that of different domestic as well as wild ruminant ungulate species is presented in Table 1. At nucleotide sequence level, both the garIFNT variants exhibited 95.6–99.7, 95.6–97.1 and 89.0–90.1% identity with IFNT variants of ovine, caprine and bovine, respectively. At the deduced amino acid level, however, they showed
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
241
Fig. 1. Amplification of IFNT gene from genomic DNA of Garole breed of sheep. Lane 1: negative control; Lane M: 50 bp DNA ladder; Lane 2: amplified PCR product.
89.0–98.8, 89.9–94.8 and 79.1–83.1% identity, respectively. When compared with the IFNT of different wild ruminant ungulates, the garIFNT variants demonstrated highest and least identity with that of musk ox and musk deer, respectively. 3.3. Phylogenetic analysis The dendograms constructed on the basis of either the nucleotide or deduced amino acid sequences of IFNT gene of all the species available in the GenBank showed almost the similar groupings. IFNT variants of Garole fall into the same clad that contained all the variants of ovine, caprine and musk ox (figure not shown). However, on inclusion of only ovIFNT variants, three distinct classes were formed. Interestingly, garIFNT1 variant was grouped under class A while garIFNT2 was placed under class B (Fig. 2). 4. Discussion To date, 21 ovIFNT variants have been characterized either by sequencing of cDNA from the elongating blastocyst or from genomic DNA (Imakawa et al., 1987; Klemann et al., 1990; Leaman and Roberts, 1992; Nephew et al., 1993; Stewart et al., 1989; Winkelman et al., 1999). These polymorphic variants of ovIFNT have shown differences in their level of expression as well as in their biological activity (Nephew et al., 1993; Ealy et al., 1998). Phylogenetically, these variants are grouped into three distinct classes viz., A, B and C (Winkelman et al., 1999). Interestingly, all the known expressed ovIFNT variants belonged to class A and B, whereas, the variants of
242 Table 1 Identity at nucleotide and deduced amino acid (of mature peptide) level of the garIFNT variants with the IFNT variants of ovine, caprine, bovine and other wild ruminant ungulates available in the GenBank Degree of identity Identity at nucleotide sequence level
Identity at amino acid sequence level
garIFNT1 (DQ149979)
garIFNT2 (EF405983)
garIFNT1 (DQ149979)
garIFNT2 (EF405983)
99.7% SHPO7TP (M88771) 95.6% SHPOTP1B (M73241)
99.7% OATP1P6 (X56343) 96.0% ovIFNT p8v3 (AF158819)
97.7% ovIFNT p8v4 (AF158820) 89.0% SHPOTP1B (M73241)
98.8% OATP1P6 (X56343) 90.7% SHPOTP1B (M73241)
Caprine Highest Least
96.9% cIFNT 3 (AY357329) 95.6% cIFNT 6 (AY357336)
97.1% cIFNT 3 (AY357329) 96.4% cIFNT 6 (AY357336)
93.6% cIFNT 2a (AY357327) 89.9% cIFNT 5 (AY357335)
94.8% cIFNT 2a (AY357327) 91.9% cIFNT 6 (AY357336)
Bovine Highest Least
90.1% bIFNT c2 (AF238612) 89.1% bIFNT 1c (AF196320)
90.0% bIFNT c2 (AF238612) 89.0% bIFNT 1c (AF196320)
82.0% bIFNT 2c (AF196323) 79.1% bIFNT c1 (AF238613)
83.1% bIFNT 3a (AF196324) 80.8% bIFNT c1 (AF238613)
94.4% 89.1% 88.7% 88.8% 87.4% 86.9% 86.6%
95.6% 89.3% 89.0% 88.3% 86.9% 87.1% 86.6%
87.2% 79.1% 79.8% 75.0% 75.0% 75.6% 68.6%
90.7% 82.0% 82.9% 73.8% 75.0% 77.3% 69.8%
Domestic ruminant ungulates Ovine Highest Least
Wild ruminant ungulates Musk Ox (M73244) American Bison (AY643747) Yak (AY455289) Mithun (AY665674) Red Deer (AJ000638) Giraffe (U55050) Musk Deer (DQ139308)
For ovine, caprine and bovine species, IFNT variants exhibiting the highest and the least identity with the garIFNT variants are only shown. The GenBank accession numbers are mentioned in the parenthesis.
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Ruminant species
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
243
Fig. 2. Phylogram on the basis of nucleotide sequences of Garole IFNT and other ovIFNT variants.
class C likely represented pseudogenes and poorly expressed forms. Further, all variants of class C were obtained through genomic cloning (Leaman and Roberts, 1992; Nephew et al., 1993) and none have been detected as cDNA (Winkelman et al., 1999). However, through genomic cloning, Nephew et al. (1993) isolated a variant SHP010TP, a member of the class A, which is reported to be the predominant form of IFNT expressed by ovine conceptuses. Interestingly, the present sequences of garIFNT, which have also been amplified from the genomic DNA, shared greater identity at amino acid level with the variants of class A and class B ovIFNT (94.2–98.8%) than that of class C (90.1–93.0%). We suspect that these variants are one of the most predominantly expressed form of IFNT in Garole breed of sheep. The IFNT genes are believed to have evolved from a common ancestral IFN- by a duplication event that occurred 36 million years ago and maintained among the ungulate ruminants without any change in the size of the gene (Roberts et al., 1997). Like its progenitor IFN-, the 585 bp ORF of the IFNT gene encodes for a 195 amino acid pre-protein of which the first 23 residues is the signal peptide that is cleaved off to yield a mature protein of 172 amino acids (Roberts et al., 1997). The IFNT protein of different species studied so far including the deduced garIFNT protein, possess the conserved Cys residues at four different positions (1, 29, 99 and 139) (Fig. 3) and a Ser-Leu-Gly residue preceding the position −1 Cys as reported earlier (Jarpe et al., 1994; Imakawa et al., 1987). All type I IFN subtypes, including IFNT, possess five ␣-helices separated by loop regions (Senda et al., 1992, 1995a,b; Radhakrishnan et al., 1999). These five helices in garIFNT are predicted as helix A (residues 4–20), helix B (52–68), helix C (79–100), helix D (115–133), and helix E (138–158) (Fig. 3). A high degree of sequence conservation is observed in the hydrophilic AB loop region (residues 24–48) and in the more hydrophobic region between residues 120 and 144 amongst type I IFNs across the mammalian species as well as in IFNTs of ruminant ungulate species (data not shown). These highly conserved residues on AB loop, helix D and the DE loop are predicted to constitute the IFN receptor-2 (IFNR2) binding site (Mitsui et al., 1993). The helix A along with helix C is proposed to interact with signal transducting IFNR1
244
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Fig. 3. An alignment of the mature IFNT proteins (172 amino acids) of Garole breed of sheep with that of other reported variants of ovIFNT accessible in the GenBank. The location of the ␣-helices (helix A: 4–20; helix B: 52–68; helix C: 79–100; helix D: 115–133; helix E: 138–158) are shown as horizontal black bars. The potential glyscosylation site Asn78 is represented by an asterisk.
(Uze et al., 1995). However, large structural differences between ovIFNT and human IFN-alpha in helix B and the BC loop further suggest the involvement of this region in unique function of ovIFNT as antiluteolytic hormone (Radhakrishnan et al., 1999). Reports delineating the biological activities of different IFNT variants are very limited. Despite having close structural similarities, p3 ovIFNT variant (Acc. No. X56341) of class A form was reported to have more potent antiluteolytic activity than another class A ovIFNT variant p8 (Acc. No. X56345) (Ealy et al., 1998; Winkelman et al., 1999). Variants p3 and p8 differed only by three amino acid substitutions at positions 101 (Asp → Gly), 107 (Lys → Glu) and 128 (His → Tyr). Due to its close proximity to a putative receptor binding region (Roberts et al., 1997;
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
245
Radhakrishnan et al., 1999), replacement of Tyr with His at position 128 is probably responsible for improved antiluteolytic activity of p3 variant (Winkelman et al., 1999). Presence of His at position 128 in both garIFNT variants may also provide better antiluteolytic activity. IFNT is known to exist in both glycosylated and non-glycosylated forms. Although, the molecular mass of these two forms varies between 20 and 22 kDa, both the forms are biologically active (Bazer et al., 1994). In bovine, all known IFNT variants contain a potential N-linked glycosylation site at Asn78 and are glycosylated (Ealy et al., 2001). However, while cloning nine IFNT variants in buffalo (Bubalus bubalis), we have observed only four variants with potential N-glycosylation site at Asn78 (unpublished data). Like bovine, mithun (Bos frontalis) IFNT contains a potential glycosylation site at Asn78 (Rajaravindra et al., 2006). On the contrary, in caprine both glycosylated and non-glycosylated forms of IFNT are present and non-glycosylated IFNT variants contain Asp78 instead of Asn78 (Baumbach et al., 1990). In ovine, although, some variants possess a potential glycosylation site at Asn78 , none of them are found to be glycosylated (Anthony et al., 1988; Winkelman et al., 1999). Intriguingly, amongst 21 ovIFNT variants reported so far, all eight variants belonging to class B and C possess the conserved Asn78 . Whereas, potential glycosylation site is absent in all the variants belonging to the class A. Among the two garIFNT variants, as anticipated, garIFNT1 being a member of class A lacks glycosylation site while the garIFNT2 of class B possess the conserved Asn78 (Fig. 3). The reason for such bias in glycosylation pattern between the classes is yet unknown. N-glycosylation, an important post-translational modification in eukaryotic cells, influences the structure and biological function of proteins including protein stability, protein secretion, receptor interaction, and subsequent downstream biological activity (Varki, 1993). Although, multiple genes are known to encode cytokines including IFNs, glycosylation often serves as an additional mechanism for providing heterogeneity to these molecules (Opdenakker et al., 1995). Studies in cattle (Ealy et al., 2001; Klemann et al., 1990) as well as in goat (Guillomot et al., 1998) demonstrated that both the glycosylated and non-glycosylated recombinant IFNT possess identical biological activity. In contrast to this, experimental evidence suggests that glycosylation increases the stability as well as longevity of recombinant human IFN (Runkel et al., 1998). Nevertheless, the structural or functional significance of glycosylation of IFNT molecule in utero is yet to be resolved. The Garole breed of sheep is well known for its remarkably high reproductive potential which is evident from the occurrence of multiple births with a frequency of 55–60% twins, 15–20% triplets and 1–2% quadruplets against only 25–30% singleton (Singh and Bohra, 1996). The prolificacy and fecundity in sheep are reported to be regulated by a single gene FecB (Davis et al., 2002). However, it is quite likely that after fertilization the establishment of pregnancy will be determined by the efficiency of MRP. Since IFNT molecule acts as a primary signal in MRP, we speculated the existence of novel variants of IFNT having potential antiluteolytic property in Garole sheep. In conclusion, we have characterized two novel IFNT variants in Garole breed of sheep, which are the first ever sequences of ovIFNT of any breed of sheep from the Indian subcontinent.We suspect that these variants of garIFNT are representative of several highly expressed forms, however, identification of other novel IFNT variants in Garole sheep could not be ruled out. Acknowledgements Financial assistance provided to KSR in the form of Junior Research Fellowship (ICAR) is duly acknowledged. The authors are grateful to Dr. B.S. Prakash, Head, Division of Dairy Cattle Physiology, National Dairy Research Institute, Karnal, Dr. G.K. Das, Senior Scientist, Division of Animal Reproduction, Indian Veterinary Research Institute, Izatnagar, Dr. A.R. Sirothia, Assoc.
246
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
Prof. Dept. of Animal Genetics and Breeding, Nagpur Veterinary College, MAFSU, Nagpur and Dr. M.D. Marcus Leo, PhD Scholar, Division of Pharmacology and Toxicology, Indian Veterinary Research Institute, Izatnagar for critical reading of this manuscript.
References Acharya, R.M., 2002. Handbook of Animal Husbandry, Third revised ed. ICAR, New Delhi, pp. 54–55. Alexenko, A.P., Ealy, A.D., Bixby, J.A., Roberts, R.M., 2000. A classification for the interferon-. J. Interf. Cytok. Res. 20, 817–822. Anthony, R.V., Helmer, S.D., Sharif, S.F., Roberts, R.M., Hansen, P.J., Thatcher, W.W., Bazer, F.W., 1988. Synthesis and processing of ovine trophoblast protein-1 and bovine trophoblast protein-1, conceptus secretory proteins involved in the maternal recognition of pregnancy. Endocrinology 123, 1274–1280. Baumbach, G.A., Duby, R.T., Godkin, J.D., 1990. N-Glycosylated and unglycosylated forms of caprine trophoblast protein-1 are secreted by preimplantation goat conceptuses. Biochem. Biophys. Res. Commun. 172, 16–21. Bazer, F.W., Ott, T.L., Spencer, T.E., 1994. Pregnancy recognition in ruminants, pigs and horses: signals from the trophoblast. Theriogenology 41, 79–94. Bazer, F.W., Thatcher, W.W., Hansen, P.J., Mirando, M.A., Ott, T.L., Plante, C., 1991. Physiological mechanisms of pregnancy recognition in ruminants. J. Reprod. Fert. Suppl. 43, 39–47. Davis, G.H., Galloway, S.M., Ross, I.K., Gregan, S.M., Ward, J., Nimbkar, B.V., Ghalsasi, P.M., Nimbkar, C., Gray, G.D., Subandriyo, Inounu, I., Tiesnamurti, B., Martyniuk, E., Eythorsdottir, E., Mulsant, P., Lecerf, F., Hanrahan, J.P., Bradford, G.E., Wilson, T., 2002. DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation. Biol. Reprod. 66, 1869–1874. Demmers, K.J., Kaluz, S., Deakin, D.W., Jabbour, H.N., Flint, A.P., 1999. Production of interferon by the conceptus in red deer (Cervus elaphus). J. Reprod. Fert. 115, 59–65. Ealy, A.D., Green, J.A., Alexenko, A.P., Keisler, D.H., Roberts, R.M., 1998. Different ovine interferon- genes are not expressed identically and their protein products display different activities. Biol. Reprod. 58, 566–573. Ealy, A.D., Lanson, S.F., Liu, L., Alexenko, A.P., Winkelman, G.L., Kubisch, H.M., Bixby, J.A., Roberts, R.M., 2001. Polymorphic forms of expressed bovine interferon- genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 142, 2906– 2915. Ealy, A.D., Wagner, S.K., Sheils, A.E., Whitley, N.C., Kiesling, D.O., Johnson, S.E., Barbato, G.F., 2004. Identification of interferon- isoforms expressed by the peri-implantation goat (Capra hircus) conceptus. Domest. Anim. Endocrinol. 27, 39–49. Godkin, J.D., Bazer, F.W., Moffat, J., Sessions, F., Roberts, R.M., 1982. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts on day 13–21. J. Reprod. Fert. 65, 141– 150. Godkin, J.D., Bazer, F.W., Roberts, R.M., 1984. Ovine trophoblast protein-1, an early secreted blastocyst protein binds specifically to uterine endometrium and affects protein synthesis. Endocrinology 114, 120–130. Guillomot, M., Reinaud, P., La Bonnardiere, C., Charpigny, G., 1998. Characterization of conceptus-produced goat interferon tau and analysis of its temporal and cellular distribution during early pregnancy. J. Reprod. Fert. 112, 149–156. Imakawa, K., Anthony, R.V., Kazemi, M., Marotti, K.R., Polites, H.G., Roberts, R.M, 1987. Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature 330, 377–379. Jarpe, M.A., Johnson, H.M., Bazer, F.W., Ott, T.L., Curto, E.V., Krishna, N.R., Pontzer, C.H., 1994. Predicted structural motif of IFNT. Prot. Eng. 7, 863–867. Klemann, S.W., Li, J., Imakawa, K., Cross, J.C., Francis, H., Roberts, R.M., 1990. The production, purification, and bioactivity of recombinant bovine trophoblast protein-1 (bovine trophoblast interferon). Mol. Endocrinol. 4, 1506–1514. Leaman, D.W., Roberts, R.M., 1992. Genes for the trophoblast interferons in sheep, goat, and musk ox and distribution of related genes among mammals. J. Interf. Res. 12, 1–11. Liu, L., Leaman, D.W., Roberts, R.M., 1996. The interferon- genes of the giraffe, a non bovid species. J. Interf. Cytok. Res. 16, 949–951. Meyer, M.D., Hansen, P.J., Thatcher, W.W., Drost, M., Badinga, L., 1995. Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2␣ of cows in response to recombinant interferon-. J. Dairy Sci. 78, 1921–1931.
K.S. Rajaravindra et al. / Animal Reproduction Science 104 (2008) 238–247
247
Mitsui, Y., Senda, T., Shimazu, T., Matsuda, S., Utsumi, J., 1993. Structural, functional and evolutionary implications of the three-dimensional crystal structure of murine interferon-beta. Pharmacol. Ther. 58, 93–132. Nephew, K.P., Whaley, A.E., Christenson, R.K., Imakawa, K., 1993. Differential expression of distinct mRNAs for ovine trophoblast protein-1 and related sheep type I interferons. Biol. Reprod. 48, 768–778. Newton, G.R., Ott, T.L., Woldesenbet, S., Shelton, A.H., Bazer, F.W., 1996. Biochemical and immunological properties of related small ruminant trophoblast interferons. Theriogenology 46, 703–716. Opdenakker, G., Rudd, P.M., Wormald, M., Dwek, R.A., Van Damme, J., 1995. Cells regulate the activities of cytokines by glycosylation. FASEB J. 9, 453–457. Radhakrishnan, R., Walter, L.J., Subramaniam, P.S., Johnson, H.M., Walter, M.R., 1999. Crystal structure of ovine ˚ resolution. J. Mol. Biol. 286, 151–162. interferon-tau at 2.1 A Rajaravindra, K.S., Mitra, A., Sharma, A.K., Deb, S.M., Sharma, A., 2006. Molecular characterization of the interferon-tau gene of the Mithun (Bos frontalis). Zool. Sci. 23, 607–611. Rasmussen, T.A., Ealy, A.D., Kubisch, H.M., 2005. Identification of bovine and novel interferon- alleles in the American plains bison (Bison bison) by analysis of hybrid cattle × bison blastocysts. Mol. Reprod. Dev. 70, 228–234. Roberts, R.M., Klemann, S.W., Leaman, D.W., Bixby, J.A., Cross, J.C., Farin, C.E., Imakawa, K., Hansen, T.R., 1991. The polypeptides and genes for ovine and bovine trophoblast protein-1. J. Reprod. Fert. Suppl. 43, 3–12. Roberts, R.M., Liu, L., Alexenko, A.P., 1997. New and atypical families of type I interferons in mammals: comparative functions, structures and evolutionary relationships. Prog. Nucl. A: Res. Mol. Biol. 56, 287–325. Roberts, R.M., Xie, S., Mathialagan, N., 1996. Maternal recognition of pregnancy. Biol. Reprod. 54, 294–302. Runkel, L., Meier, W., Pepinsky, R.B., Karpusas, M., Whitty, A., Kimball, K., Brickelmaier, M., Muldowney, C., Jones, W., Goelz, S.E., 1998. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm. Res. 15, 641–649. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, vol. 3, 2nd ed. Cold Spring Harbour Library Press, pp. 6.3–6.4. Senda, T., Shimazu, T., Matsuda, S., Kawano, G., Shimazu, H., Nakamura, K.T., Mitsui, Y., 1992. Three dimensional crystal structure of recombinant murine interferon-. EMBO J. 11, 3193–3201. ˚ resolution. Senda, T., Saitoh, S.-I., Mitsui, Y., 1995a. Refined crystal structure of recombinant murine interferon-b at 2.15 A J. Mol. Biol. 253, 187–207. Senda, T., Saitoh, S.I., Mitsui, Y., Li, J., Roberts, R.M., 1995b. A three-dimensional model of interferon-tau. J. Interf. Cytok. Res. 15, 1053–1060. Singh, R.N., Bohra, S.D.J., 1996. Garole sheep: a profile (Bengal breed of sheep locally known as Garole). Ind. J. Small Rum. 2, 38–42. Spencer, T.E., Bazer, F.W., 2004. Conceptus signals for establishment and maintenance of pregnancy. Reprod. Biol. Endocrinol. 2, 49–58. Stewart, H.J., McCann, S.H., Northrop, A.J., Lamming, G.E., Flint, A.P., 1989. Sheep antiluteolytic interferon: cDNA sequence and analysis of mRNA levels. J. Mol. Endocrinol. 2, 65–70. Thatcher, W.W., Staples, C.R., Danet-Desnoyers, G., Oldick, B., Schmidt, E.P., 1994. Embryo health and mortality in sheep and cattle. J. Anim. Sci. 72, 16–30. Turner, H.N., 1982. Origins of the CSIRO Booroola. In: Piper, L.R., Bindon, B.M., Nethery, R.D. (Eds.), The Booroola Merino. CSIRO, Melbourne, pp. 1–7. Uze, G., Lutfalla, G., Mogensen, K.E., 1995. Alpha and beta interferons and their receptor and their friends and relations. J. Interf. Cytok. Res. 15, 3–26. Varki, A., 1993. Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3, 97–130. Winkelman, G.L., Roberts, R.M., Peterson, A.J., Alexenko, A.P., Ealy, A.D., 1999. Identification of the expressed forms of ovine interferon- in the peri-implantation conceptus: sequence relationships and comparative biological Activities. Biol. Reprod. 61, 1592–1600.