Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries)

GENE-40154; No. of pages: 10; 4C: Gene xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries) Yong-Jie Yang a,b, Zeng-Shan Liu a, Shi-Ying Lu a, Chuang Li b, Pan Hu a, Yan-Song Li a, Nan-Nan Liu a, Feng Tang a,c, Yun-Ming Xu a,d, Jun-Hui Zhang a, Zhao-Hui Li a, Xiao-Li Feng a, Yu Zhou a, Hong-Lin Ren a,⁎ a

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin University, Changchun 130062, China Department of Food Science, College of Agriculture, Yanbian University, Yanji 133002, China College of Animal Husbandry and Veterinary, Liaoning Medical University, Jinzhou 121001, China d Department of Husbandry and Veterinary Medicine, Jiangsu Polytechnic College of Agriculture and Forestry, Jurong 212400, China b c

a r t i c l e

i n f o

Article history: Received 5 October 2014 Received in revised form 27 November 2014 Accepted 19 December 2014 Available online xxxx Keywords: PDCD10 Cloning Differential expression Apoptosis Brucellosis

a b s t r a c t Programmed cell death 10 (PDCD10) is a highly conserved adaptor protein. Its mutations result in cerebral cavernous malformations (CCMs). In this study, PDCD10 cDNA from the buffy coat of Small Tail Han sheep (Ovis aries) was cloned from a suppression subtractive hybridization cDNA library, named OaPDCD10. The full-length cDNA of OaPDCD10 was 1343 bp with a 639 bp open reading frame (ORF) encoding 212 amino acid residues. Tissue distribution of OaPDCD10 mRNA determined that it was ubiquitously expressed in all tested tissue samples, and the highest expression was observed in the heart. The differential expression of OaPDCD10 between infected sheep (challenged with Brucella melitensis) and vaccinated sheep (vaccinated with Brucella suis S2) was also investigated. The results revealed that, compared to the control group, the expression of OaPDCD10 from infected and vaccinated sheep was both significantly up-regulated (p b 0.05). Moreover, the expression levels of OaPDCD10 from the vaccinated sheep were significantly higher than the infected sheep (p b 0.05) after 30 days post-inoculation. The recombinant OaPDCD10 (rOaPDCD10) protein was expressed in Escherichia coli BL21 (DE3), and then purified by affinity chromatography. The rOaPDCD10 protein was demonstrated to induce apoptosis and promote cell proliferation. Our studies are intended to discover potential diagnostic biomarkers of brucellosis to discern infected sheep from vaccinated sheep, and OaPDCD10 could be considered as a potential diagnostic biomarker of brucellosis. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Brucellosis remains the most common bacterial zoonosis in the world, which causes abortion in animals and chronic debilitating illness in humans. Since the animals or patients in brucellosis commonly present with atypical clinical symptoms, the disease often remains overlooked, underdiagnosed or misdiagnosed (Franco et al., 2007). Moreover, brucellosis can rarely be cured and may frequently lead to relapse. Therefore, it can pose a severe health threat, as well as possible potentially important economic losses in developing countries. At present, the clinical diagnosis of brucellosis mainly relies on serological testing, which is based on the Abbreviations: Bm, Brucella melitensis; bp, base pairs; CCMs, cerebral cavernous malformations; CFU, colony-forming unit; FAT, focal adhesion targeting; FAK, focal adhesion kinases; GCKIII, germinal center kinase III; HP1, hydrophobic patch 1; McAb, monoclonal antibodies; ORF, open reading frame; PBS, phosphate buffered saline; PDCD10, programmed cell death 10; PI, propidium iodide; rOaPDCD10, recombinant Ovis aries PDCD10 protein; RT-qPCR, reverse transcription quantitative real-time PCR; SDS-PAGE, SDS-polyacrylamide gel electrophoresis; S2, Brucella suis S2. ⁎ Corresponding author. E-mail address: [email protected] (H.-L. Ren).

reactivity of antibodies against smooth lipopolysaccharide of Brucella spp. (Franco et al., 2007). The antibodies tend to persist in infected and vaccinated animals, so routine serological diagnosis result in falsepositive results (Nielsen et al., 2004). Thus, it is necessary to establish an effective diagnosis method to discern infected animals from vaccinated animals. Programmed cell death 10 (PDCD10) was originally identified as TFAR15 (TF-1 cell apoptosis related gene-15) for being up-regulated after the induction of apoptosis by serum withdrawal in TF-1 human premyeloid cells (Wang et al., 1999). It was subsequently renamed PDCD10, as it was thought to be involved in the apoptotic pathway (Busch et al., 2004; Chen et al., 2009). PDCD10, also named CCM3, the third and latest gene for cerebral cavernous malformations (CCMs), and is commonly found mutated in patients with CCMs (Faurobert and Albiges-Rizo, 2010; Riant et al., 2010; Stahl et al., 2008; Voss et al., 2007). Evidence shows that PDCD10 plays an essential role in early embryonic angiogenesis and cardiovascular development (Voss et al., 2009; Yoruk et al., 2012). Knockdown of PDCD10 causes an enlarged heart in zebrafish (Zheng et al., 2010), whereas endothelial-specific deletion of PDCD10 leads to severe defects in early angiogenesis, as

http://dx.doi.org/10.1016/j.gene.2014.12.040 0378-1119/© 2014 Elsevier B.V. All rights reserved.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

2

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

well as hematopoiesis in mice (He et al., 2010). In addition, inhibition of PDCD10 in nematode results in early embryonic lethality (Kamath et al., 2003). However, the mechanisms that the loss-of-function of PDCD10 leads to these phenotypic features remain unclear, due to the lack of any known functional domain of PDCD10. Recently, studies have unraveled some of PDCD10 functions. PDCD10, a novel adaptor protein, interacts with a variety of proteins including phosphatidylinositol-3,4,5-trisphosphate (Dibble et al., 2010; Hilder et al., 2007), cell adhesion molecule paxillin (Li et al., 2010), vascular epidermal growth factor receptor 2 (VEGFR2) (He et al., 2010), CCM2 (Liquori et al., 2003), and germinal center kinase III (GCKIII) family (Ceccarelli et al., 2011; Yin et al., 2012). Particularly, CCM3-GCKIII protein interaction is important for proper PDCD10 function because the knockdown of GCKIII proteins in zebrafish gives rise to the same cardiovascular defects as PDCD10 knockdown (Zheng et al., 2010). GCKIII kinases belong to the members of Ste20 kinase family, and are characterized by highly conserved catalytic domains, which share the N-terminal domain of CCM3 (Ceccarelli et al., 2011; Zhang et al., 2013). GCKIII kinases including MST3/STK24, MST4/MASK, and STK25/SOK1/YSK1, are involved in the regulation of apoptosis, cell proliferation, polarity, migration, and cytoskeleton remodeling (Fidalgo et al., 2010; Ma et al., 2007; Zheng et al., 2010). Therefore, PDCD10 is also involved in diverse physiological processes by means of binding to the GCKIII kinases. For example, PDCD10 forms a ternary complex with GCKIII and Golgi matrix protein GM130 to regulate Golgi assembly and cell orientation, as well as migration (Fidalgo et al., 2010). In addition, CCM3 interacts with MST4 to promote cell proliferation and transformation via modulation of the extracellular signal-regulated kinase (ERK) pathway (Ma et al., 2007). In this study, we cloned PDCD10 cDNA from the buffy coat of Small Tail Han sheep (Ovis aries), named OaPDCD10. Since OaPDCD10 was one of the differential genes from a subtracted cDNA library, we investigated and analyzed differential expression levels of OaPDCD10 mRNA between infected sheep (challenged with Brucella melitensis) and vaccinated sheep (vaccinated with Brucella suis S2). Additionally, the recombinant OaPDCD10 protein was expressed and purified to elucidate its function. This study was intended to discover potential diagnostic biomarkers for brucellosis to discern infected sheep from vaccinated sheep. 2. Materials and methods 2.1. Preparation of challenge materials B. melitensis (smooth virulent strain, Bm) was isolated from the blood of Small Tail Han sheep (O. aries) in brucellosis and identified by the Institute of Zoonosis (Jilin University, Changchun, China). B. suis S2 (live rough avirulent strain, S2) was obtained from a commercially available brucellosis vaccine (Harbin Pharmaceutical Group Co. Ltd, China). First, the rehydrated freeze-dried S2 and glycerol-preserved Bm were cultured separately on tryptic soy agar (TSA) plates containing 5% sterile bovine serum at 37 °C in 10% CO2 for 48 h. Next, a single colony was randomly selected to be grown in tryptic soy broth (TSB) with 220 rpm of agitation for 72 h at 37 °C. Finally, Bm and S2 were harvested respectively by centrifugation for 10 min at 4 °C at 3000 g. Bacteria were then respectively washed twice with sterile phosphate buffered saline (PBS), and then re-suspended in sterile PBS at the concentrations of 2.2 × 1010 CFU/ml for the preparation of a bacterial suspension used for the bacterial challenge. All manipulations of the live Brucella were performed in biosafety level 3 facilities. 2.2. Animals and sampling A total of nine male Small Tail Han sheep (O. aries), aged ten months old, were used for this study. All animals purchased from the Sangang farm (Jilin province, P. R. China) were in good health and tested negative for Bm and S2 by the rose-bengal plate agglutination test (RBPT). All animal protocols were approved by the Institutional Animal Care and Use

Committee (IACUC), at Jilin University. Nine sheep were randomly divided into three groups that included an infected group, a vaccinated group, and a control group. Each group had three sheep that were separately raised under the same culture conditions. The infected group was challenged with Bm with 100 μl 2.2 × 1010 CFU/ml bacterial suspension per sheep (50 μl administered conjunctivally and 50 μl intrapreputially). The vaccinated group was inoculated with S2 with the same dose and mode, while the control group was inoculated with 100 μl sterile PBS with the same mode. The anticoagulant blood of the sheep was collected respectively at fourteen, thirty, forty and sixty days post-inoculation, and then the buffy coat was isolated by horizontal centrifugation for 20 min at 800 g at 4 °C. Tissue samples including heart, liver, spleen, lung, kidney, rumen, small intestine, skeletal muscle, and buffy coat, were collected separately from healthy sheep of the control group after slaughtering, and were frozen immediately in liquid nitrogen. All samples were stored at −80 °C until use. 2.3. Full-length cDNA cloning of OaPDCD10 Total RNA was extracted from the buffy coat of sheep using TRIzol Reagent (Invitrogen, USA) and reverse transcribed using PrimeScript®RT reagent Kit With gDNA Eraser (TaKaRa, Japan) following the manufacturer's instructions. Subtracted cDNA library was constructed by suppression subtractive hybridization (SSH) using PCR Select™ cDNA Subtraction Kit (Clontech, USA) following the manufacturer's instructions. A pool of cDNA from infected sheep was used as the driver, and the cDNA pool from vaccinated sheep as the tester. Full-length cDNA of OaPDCD10 were obtained by 5′- and 3′- rapid amplification of cDNA ends (RACE) using the SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer's instructions. The primers for RACE were designed based on the partial sequence of OaPDCD10 from the SSH cDNA library (Table 1). 2.4. Sequence analysis of OaPDCD10 The cDNA of OaPDCD10 and its deduced amino acid sequence were analyzed using DNAstar5.0 software (DNASTAR, USA). The homology search of OaPDCD10 nucleotide sequence was conducted with the BLASTx algorithm (http://www.ncbi.nlm.nih.gov/BLAST/). The conserved domains (CDs) were analyzed by the CD-Search service based on NCBI's conserved domain database (CDD) (http://www.ncbi.nlm. nih.gov/Structure/cdd/cdd.shtml). Multiple alignments were performed with ClustalX 2.0 software (UCD, Ireland). A phylogenetic tree was constructed using neighbor-joining (NJ) method with 1000 bootstrap replicates by means of MAGA5.1 software (Sudhir Kumar, USA). The signal peptide was predicted by the SignalP 4.1 Server (http:// www.cbs.dtu.dk/services/SignalP/). The transmembrane domain was predicted by the TMHMM Server V.2.0 (http://www.cbs.dtu.dk/ Table 1 Primers used for PCR amplification. Primer

Nucleotide sequence (5′–3′)

Function

PDCD10 S1 PDCD10 S2 PDCD10 A11 PDCD10 A12 PDCD10 A21 PDCD10 A22 PDCD10 S PDCD10 A β-actin S β-actin A 30aPDCD10Nde S

GGCAGTATTGGACTGCCTTTATCTG TCTCACACTGAAGATTTTGCATCAC TATCTTGCAGCATATCGCTTTCAAG AAAGTGATGCAAAATCTTCAGTGTG CATGAAACTGGAACTGAATCCGTAG TTTCAAAGGGCATAACCCGAGTCAC TCCAGGACCTAAATGAAAAGGCACG TGGTTTGATGAATTAGTCGGTTGGC CCCAAGGCCAACCGTGAGAAGATGA CGAAGTCCAGGGCCACGTAGCAGAG CATATGAGGATGACAATGGAAGAG ATGAAGAATG CTCGAGGGCCACAGTTTTGAAGGTCT GAAG

3′-RACE; outer 3′-RACE; inner 1st 5′-RACE; outer 1st 5′-RACE; inner 2nd 5′-RACE; outer 2nd 5′-RACE; inner Real-time PCR Real-time PCR Real-time PCR Real-time PCR Amplification of ORF for expression Amplification of ORF for expression

30aPDCD10Xho A

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

3

services/TMHMM/). The phosphorylated sites were predicted by KinasePhos2.0 services (http://kinasephos2.mbc.nctu.edu.tw/index. html). The secondary and tertiary structure of OaPDCD10 was predicted by the Phyre service (http://www.sbg.bio.ic.ac.uk/~phyre/).

China). The chemiluminescent detection was performed with BeyoECL Plus (Beyotime, China).

2.5. Reverse transcription quantitative real-time PCR (RT-qPCR)

The human embryonic kidney cell line (HEK) 293T cells were obtained from Prof. Ou Yang in Jilin University. In all cases, 293T cells were cultured in DMEM (Thermo, USA) supplemented with 10% fetal bovine serum at 37 °C with 5% CO2 overnight, and then treated with rOaPDCD10 of 50 μg/ml or left untreated (control).

RT-qPCR was carried out to investigate tissue distribution and the differential expression of OaPDCD10 mRNA. Total RNA were obtained from fresh tissues of healthy sheep for investigating tissue distribution, and from the buffy coat of sheep for analyzing differential expression among the three groups. Then, cDNA were generated by reverse transcription using the PrimeScript®RT Reagent Kit (TaKaRa, Japan) following the manufacturer's instructions. Two pairs of primers were used for qPCR (Table 1). OaPDCD10 cDNA was amplified to produce a fragment of 306 bp. β-actin cDNA of sheep (GenBank accession number U39357), used as an endogenous control, was amplified to produce a fragment of 337 bp. Quantitative PCR was performed in a total volume of 20 μl with 10 μl SYBR® Premix Ex Taq™ (2 ×) (TAKARA, Japan), 2.0 μl cDNA templates, 0.4 μl of each primer (10 μM), and 0.4 μl ROX Reference DyeII (50×) (TAKARA, Japan). The reaction was 95 °C for 30 s, then 40 cycles of 95 °C for 30 s, 63 °C for 34 s. Melting curves were analyzed to confirm the specificity of the amplified products. Relative gene expression was analyzed by the comparative Ct method (2−ΔΔCT method), and the results were presented as the relative quantity values that Ct values of OaPDCD10 were normalized to β-actin. All treatments were run in triplicate.

2.8. Cell culture and treatment

2.9. Apoptosis assays Apoptosis was assessed by two assays: the hoechst33342/propidium iodide (PI) assay and the Annexin V-PE/7-AAD assay. First, apoptotic cells were determined by the hoechst33342 and PI staining assay using confocal laser microscopy (Olympus FV1000, Japan). Briefly, 293T cells (1 × 105) were cultured on coverslips in 12-well plates overnight. At 12 h post-treatment, hoechst33342 was added to the medium to a final concentration of 6 μg/ml for 10 min at 37 °C. PI was then added to the medium to a final concentration of 5 μg/ml for 20 min at 4 °C. The medium was removed and cells were visualized by confocal laser microscopy. Next, the percentage of apoptotic cells was analyzed by means of a FACSCalibur flow cytometer (Becton Dickinson, USA) using the Annexin V PE Apoptosis Detection Kit (eBiosciences, USA) following the manufacturer's instructions. At 12 h post-treatment, 293T cells were stained with Annexin V-PE and 7-AAD, and Annexin V positive cells were considered as apoptotic cells.

2.6. Recombinant expression and purification of OaPDCD10 2.10. Cell proliferation assays (MTT) The complete ORF of OaPDCD10 with Nde I and Xho I site was amplified by PCR with specific primers (Table 1). The PCR product was ligated into a T/A cloning vector pMD18-T Simple (TaKaRa, Japan), and transformed into Escherichia coli DH5α. The recombinant plasmid (pMD18T-OaPDCD10) was confirmed by nucleotide sequencing, then digested with Nde I and Xho I (TaKaRa, Japan) and inserted into an expression vector pET-30a(+). The recombinant plasmid (pET-30a-OaPDCD10) with 6 × His-tag at the C-terminus was transformed into E. coli BL21(DE3). Positive transformants were grown to an A600 of 0.6–0.8, and then they were induced with a final concentration of 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 4 h at 28 °C. Subsequently, bacteria were harvested via centrifugation at 12,000 g for 5 min, and re-suspended in the binding buffer (20 mM NaH2PO4, 500 mM NaCl and 30 mM imidazole, pH 7.4). The re-suspended bacteria were ultrasonicated for 10 min in an ice bath, and bacterial debris was removed by centrifugation at 10,000 g for 20 min at 4 °C. The supernate was harvested to purify the recombinant OaPDCD10 (rOaPDCD10) protein using HisTrap FF affinity columns pre-charged with Ni2+ ions (GE, USA) according to the manufacturer's instructions. 12% SDS-PAGE were used to analyze the purified efficiency of recombinant proteins.

The activity of cell proliferation was assessed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) assay. Firstly, 293T cells (1 × 104) were seeded in 96-well plates overnight. At 12 h, 24 h, 36 h, 48 h, 60 h and 72 h post-treatment, MTT was added to each well to a final concentration of 0.5 mg/ml for 4 h. Subsequently, 293T cells were lysed in dimethyl sulfoxide (DMSO). The amount of MTT formazan was quantified by testing the absorbance at 570 nm using a microplate reader. Cell viability is positively correlated with the absorbance at 570 nm. All measurements were performed in triplicate. Every experiment was repeated at least three times. 2.11. Statistical analysis All data were analyzed using SPSS software version 13.0 (SPSS, Chicago, USA), and the results were presented as mean ± SD. Student's t test was used to calculate p values. Multiple comparisons between groups were conducted by two-way ANOVA. Statistical significance was displayed as p b 0.05 (*) or p b 0.01 (**). 3. Results

2.7. Western blot analysis 3.1. Sequence characterization of OaPDCD10 cDNA The buffy coat of sheep was lysed in ice-cold radioimmunoprecipitation assay (RIPA) buffer (Beyotime, China), and incubated for 5 min at 4 °C. Sheep tissues were homogenized in the ice-cold RIPA buffer at 4 °C. Cells or tissues debris were removed by centrifugation at 12,000 g for 5 min at 4 °C. Supernates were stored at − 80 °C until use. Protein concentrations were determined by BCA protein assay (SangonBiotech (Shanghai) Co., Ltd., China). Equal amounts (80 μg) of protein samples were separated by 12% SDS-PAGE, and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA). Following transfer, membranes were incubated separately with anti-PDCD10 (Santa Cruz, USA) and anti-β-actin (Cell Signaling Technology, USA) antibodies overnight at 4 °C. Subsequently, the membranes were incubated with the secondary antibody labeled with horseradish peroxidase (Boster,

The full-length cDNA of OaPDCD10 was the first reported in this study (GenBank accession number KC425616). It was 1343 bp in length containing a 5′-untranslated region (UTR) of 273 bp, an ORF of 639 bp, and a 3′-UTR of 431 bp with a poly A tail. The ORF encoded a putative protein of 212 amino acid residues with a theoretical isoelectric point of 8.20 and a deduced molecular weight of 24.71 kDa. OaPDCD10 was predicted to contain a conserved domain from Asn10 to His162, but its function was unknown until now. Five phosphorylated sites were predicted to locate in Ser39, Ser79, Ser171, Ser173 and Ser175 (Fig. 1A). In addition, OaPDCD10 was predicted that it had no transmembrane domains and signal peptide, which indicated that OaPDCD10 might not be a secreted or membrane protein.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

4

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Fig. 1. Sequence analyses of OaPDCD10. (A) The full-length cDNA nucleotide and deduced amino acid sequences of OaPDCD10. GenBank accession number for this cDNA sequence was KC425616. Double asterisks (**) indicated the stop codon (TGA). The predicted conserved domain (CD) was boxed. Residue numbers with predicted secondary structure (α1–α7) were colored per domain as in panel. The predicted phosphorylated sites (S) were bold and italic. Primers for 3′-, 5′-RACE were shown as underlined arrows. (B) The predicted threedimensional structure of OaPDCD10. Each of α-helices was shown in different color.

The tertiary structure of OaPDCD10 was predicted to be an adaptor protein composed of seven α-helices (Fig. 1B). Multiple alignments showed that the putative OaPDCD10 protein displayed high homology with other identified PDCD10 proteins from various species, and the highest percentage of identity was 100% with Mus musculus (GenBank

accession number NP_062719) (Fig. 2). The result revealed that PDCD10 was so highly conserved among various species, that it possibly had a profound influence on cellular processes. A phylogenetic tree was constructed based on multiple alignments using the neighbor-joining (NJ) method. The result showed that

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

5

Fig. 2. Multiple alignments of OaPDCD10 with identified PDCD10 from various species. The OaPDCD10 protein was indicated with red underline. (*) indicates identical; (:), highly conserved; (.), semi-conserved.

OaPDCD10 was positioned into a branch of the mammal sub-cluster and most closely resembled PDCD10 from M. musculus, which was in agreement with the result of multiple alignments (Fig. 3). 3.2. Tissue distribution of OaPDCD10 mRNA To investigate the expression level of OaPDCD10 mRNA in healthy sheep tissues, RT-qPCR was carried out, and β-actin was used as an endogenous control. The expression of OaPDCD10 mRNA in buffy coat was used as a calibrator compared with other tissues. The result showed that OaPDCD10 mRNAs were ubiquitously expressed in all tested tissues including heart, liver, spleen, lung, kidney, rumen, small intestine, skeletal muscle and buffy coat. The highest expression was observed in the heart, followed by rumen, kidney, liver, spleen and skeletal muscle. The lowest expression was in the lung, buffy coat and small intestine with no significant differences among them (Fig. 4). 3.3. Differential expression of OaPDCD10 mRNA Differential expression of OaPDCD10 between infected and vaccinated sheep was also investigated by RT-qPCR. The result indicated that, compared to the control, OaPDCD10 mRNAs from infected

sheep or vaccinated sheep were both significantly up-regulated (p b 0.05) in a time-dependent manner during 60 days postinoculation. Moreover, OaPDCD10 mRNAs from vaccinated sheep were higher than ones from infected sheep. OaPDCD10 mRNAs between infected and vaccinated sheep were significantly different (p b 0.05) after 30 days post-inoculation (Fig. 5). Therefore, differential expression of OaPDCD10 can discern infected sheep from vaccinated sheep after 30 days post-inoculation.

3.4. Expression and purification of the rOaPDCD10 protein Since monoclonal antibodies (McAb) against sheep PDCD10 are not available, and the epitope sequences of human-PDCD10 recognized by McAb are 100% identity with OaPDCD10 protein, we used the McAb against human-PDCD10 to detect the OaPDCD10 protein. The result showed that bands of the same size at ~28 kDa were detected in 293T cells and the buffy coat of sheep, which confirmed that McAb against human-PDCD10 can detect sheep-PDCD10 (Fig. 6A). Next, the expression and purification of rOaPDCD10 protein were assessed by 12% SDS-PAGE. The result revealed that the rOaPDCD10 protein was expressed in both the supernate and inclusion bodies of E. coli BL21 (DE3) cells, and purified rOaPDCD10 protein from the supernate was

Fig. 3. Phylogenetic analysis of OaPDCD10 compared with other known PDCD10. The phylogenetic tree was constructed using neighbor-joining (NJ) method based on the amino acid sequences of PDCD10 available in the GenBank database by means of MAGA5.1 software. The numbers on the nodes indicated percentage frequencies in 1000 bootstrap replications. The scale bar represented 0.005 substitutions per site.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

6

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Fig. 4. Tissue distribution of OaPDCD10 mRNA. The relative expression levels of OaPDCD10 mRNA were calculated using 2−ΔΔCt method with β-actin as the endogenous control. All treatments were performed in triplicate, and data were given as the mean ± SD (n = 3, *p b 0.05, **p b 0.01 vs. buffy coat). Error bars showed the SD.

single band (Fig. 6B). The expression of rOaPDCD10 protein was confirmed by immunoblotting (Fig. 6C).

3.5. The rOaPDCD10 protein induced 293T cell apoptosis Because PDCD10 is a highly conserved protein across various species (Fig. 2), and homologous PDCD10 has been shown to induce apoptosis via caspase 3 pathway (Chen et al., 2009; Zhang et al., 2012), we first determine apoptotic activity of the rOaPDCD10 protein. As expected, a significantly larger proportion of apoptotic cells with bright staining or fragmented nuclei were observed in 293T cells treated with purified rOaPDCD10 proteins (Fig. 7A). To further confirm apoptotic activity, we performed Annexin V/7-AAD assay and analyzed by flow cytometry. The result showed that the percentage of apoptotic cells treated with purified rOaPDCD10 proteins was 89.07% at 12 h post-treatment and larger than untreated cells (77.89%) (Fig. 7B).

3.6. The rOaPDCD10 protein promoted cell proliferation We next asked whether the rOaPDCD10 protein regulated cell proliferation, because its binding partner-GCKIII kinases had been shown to regulate the event (Ma et al., 2007). Thus, we evaluated the effect of purified rOaPDCD10 (50 μg/ml) on 293T cells proliferation using MTT assay. The result showed that, compared to controls, 293T cells treated with purified rOaPDCD10 protein demonstrated increased cell vitality, suggesting that the rOaPDCD10 protein promotes cell proliferation and growth (Fig. 8). Similar results were also observed in THP-1 cells (data not shown), confirming that this was not a cell-specific effect.

4. Discussion The complete cDNA of OaPDCD10 was the first reported and characterized in this study. Our results predicted that OaPDCD10 contained a

Fig. 5. The differential expression of OaPDCD10 mRNA between buffy coat of sheep challenged with B. melitensis and ones vaccinated with B. suis S2. Relative expression was calculated using 2−ΔΔCt method with β-actin as the endogenous control. All treatments were performed in triplicate, and data were presented as mean ± SD (n = 9, *p b 0.05, **p b 0.01 vs. the control). Error bars showed the SD.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Fig. 6. Expression and purification of the rOaPDCD10 protein. (A) Identification of the cross-reactivity of McAb against human-PDCD10. Immunoblotting was performed in 293T cells and buffy coat of sheep. (B) 12% SDS-PAGE analysis of expression and purification of the rOaPDCD10 protein. Lane 1, whole cell lysates of recombinant E. coli BL21 (DE3) before induction; lane 2, the supernate of DE3 cell lysates after induction with 0.1 mM IPTG for 4 h at 28 °C; lane 3, the inclusion body of DE3 cell lysates after induction with 0.1 mM IPTG for 4 h at 28 °C; lane 4, the purified rOaPDCD10 protein using the HisTrap FF affinity column. The position corresponding to the rOaPDCD10 protein was indicated by an arrow. (C) Western blotting analysis of expression and purification of the rOaPDCD10 protein. The lanes were the same as described for SDS-PAGE in panel B.

conserved domain from Asn10 to His162. However, several studies determined that homologous PDCD10 contains two distinct domains: an N-terminal dimerization domain and a C-terminal focal adhesion targeting (FAT)-homology domain (Ding et al., 2010; Li et al., 2010). The two domains consist of seven α-helices (α1–α7). The N-terminal dimerization domain is comprised of three α-helices (α1–α3) and shaped like a hook. The C-terminal FAT-homology domain is comprised of four αhelices (α4–α7) and fold in an anti-parallel manner into a compact bundle (Ding et al., 2010). PDCD10 N-terminal domain is able to interact with GCKIII C-terminal dimerization domain to form a stable heterodimer because of a similar dimerization domain (Zhang et al., 2013), which is consistent with PDCD10 forming a complex with GCKIII to localize Golgi apparatus to promote Golgi assembly and cell orientation (Fidalgo et al., 2010). PDCD10 C-terminal FAT-homology domain has high structural similarity to FAT domains of focal adhesion kinases (FAK) and Pyk2 (Ding et al., 2010; Li et al., 2010, 2011), and contains an exquisitely conserved surface, hydrophobic patch 1 (HP1), for which many of the surface lysine and hydrophobic residues are invariant (Li et al., 2010). The FAT domain of PDCD10 is able to interact with paxillin leucine-aspartate repeat (LD) motifs using the highly conserved HP1 in a manner similar to FAK and Pyk2, and it also directly interacts with CCM2 PTB domain

7

(Li et al., 2011). In addition, since OaPDCD10 lacks any known catalytic domains, it is predicted to be an adaptor protein (Ding et al., 2010). Tissue expression profile of OaPDCD10 mRNA in healthy tissues was assessed in this study. We observed OaPDCD10 mRNA at a different level expressed in all sheep tissues tested, and its highest expression was found in the heart (Fig. 4). The broad expression profile of PDCD10 in almost all tissues had been reported in humans (Bergametti et al., 2005; Chen et al., 2007). Moreover, human PDCD10 mRNA is also expressed in the heart at the highest levels, suggesting that the heart might be the main effector site for PDCD10. Moreover, much evidence revealed that mutations of PDCD10 were tightly linked to cardiovascular disorder and brain diseases such as CCMs (Stahl et al., 2008; Voss et al., 2009; Yoruk et al., 2012). The characterization of rOaPDCD10 was investigated after it was successfully expressed and purified. The rOaPDCD10 protein was demonstrated to induce cell apoptosis (Fig. 7) and promote cell proliferation (Fig. 8). Similarly, pro-survival or apoptotic functions have been identified for PDCD10 (Chen et al., 2009; Ma et al., 2007). However, the mechanism of how PDCD10 performs differential or even opposite cellular functions remains largely unknown. Some oncogenes, such as warts (wts), salvador (sav), hippo (hpo) and yorkie (yki), regulate cell growth, proliferation, and apoptosis in Drosophila. These genes are highly conserved evolutionarily. Mutations in them or overexpression of their phenocopies is able to promote cell proliferation, and increase defective apoptosis characterized by elevated levels of cell cycle regulator cyclin E (cyc E) and apoptosis inhibitor diap1 (Harvey et al., 2003). Here, suppression of apoptosis might allow the over-proliferating cells to overcome proliferation-induced apoptosis, thus ultimately resulting in tissue overgrowth (Huang et al., 2005). Like these oncogenes, a constitutive expression of PDCD10 enhances malignant T cells proliferation and protects them from apoptosis, which is associated with protein phosphatase-2A, a regulator of mitogenesis and apoptosis (Lauenborg et al., 2010). Overexpression of PDCD10 could protect endothelial cells from staurosporine-induced cell death because of elevated phosphorylation of Akt, a potent inhibitor of apoptosis (Schleider et al., 2011). Thus, we reasonably suspect that rOaPDCD10 could promote 293T cell growth and suppress natural death due to defective apoptosis. The exact mechanism of action needs to be further studied. In this study, we investigated differential expression levels of OaPDCD10 between the infected sheep and the vaccinated ones. As shown in Fig. 5, OaPDCD10 mRNAs from the infected or vaccinated sheep were both significantly up-regulated (p b 0.05) in a timedependent manner during 60 days post-inoculation. Moreover, OaPDCD10 mRNAs from the vaccinated sheep were higher than the ones from the infected sheep. These data indicated that both rough S2 and smooth Bm were able to cause host cell apoptosis, but the effect of rough S2 was much greater. Similarly, in the cases of B. melitensis (Fernandez-Prada et al., 2003), Mycobacterium tuberculosis (Keane et al., 1997), vaccinia (Ramsey-Ewing and Moss, 1998) and herpes simplex virus 1 (HSV-1) (Galvan and Roizman, 1998), their attenuated and virulent strains are able to trigger host cell apoptosis. Furthermore, attenuated strains cause more apoptosis than virulent strains. The evidence showed that rough Brucella, whose outer membrane lipoproteins-lipid A may be more accessible to host cell receptors, may thus more efficiently trigger apoptosis (Fernandez-Prada et al., 2003). It is likely that rough Brucella could be eliminated in association with apoptosis of host cells. Apoptosis of infected cells may be beneficial to avoid the onset of infection. Moreover, apoptosis has been related to the removal of M. tuberculosis (Molloy et al., 1994), whereas macrophages from mice resistant to mycobacterial infection are more susceptible to apoptosis (Rojas et al., 1997). However, some studies showed that Brucella could protect infected macrophages from apoptosis to assist its dissemination, but it seems to be the case for smooth Brucella (Galdiero et al., 2000; Gross et al., 2000; Tolomeo et al., 2003). Smooth lipopolysaccharide in Brucella may be involved in inhibiting apoptosis of infected cells (Gross et al., 2000), since resistance to apoptosis of infected cells has been

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

8

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Fig. 7. The rOaPDCD10 protein induced 293T cell apoptosis. 293T Cells (1 × 105) were cultured in 12-well plates overnight, and then treated with 50 μg/ml rOaPDCD10 or left untreated (control). 12 h later two assays, hoechst33342/PI and Annexin V/7-AAD, were respectively performed and analyzed by laser scanning confocal microscope (LSCM) and flow cytometer to determine apoptosis. (A) The LSCM analysis of hoechst33342/PI assay. Nuclei of live cells were stained for hoechst33342 (blue) and dead cells for PI (red). Apoptotic cells were visualized by bright blue because of chromatin condensation. Magnification, ×600. (B) Flow cytometric analysis of Annexin V/7-AAD assay. Apoptotic cells were stained for annexin V-PE (yellow) and dead cells for 7-AAD (red). Apoptotic cells were determined by the percentage of Annexin V positive cells. Data shown were representative of two replications with similar results. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

observed in patients with acute and chronic brucellosis (Tolomeo et al., 2003). Additionally, smooth Brucella could induce infected macrophages to express anti-apoptotic gene, such as A1 (de Bagues et al., 2005). In this way, apoptosis of infected cells was delayed by smooth Brucella, allowing them intracellular survival and replication of numbers, sufficient to weaken the host's immune response and cause disease. Thus, OaPDCD10 mRNAs from infected sheep were lower than vaccinated sheep, possibly because of anti-apoptotic effect of smooth Brucella.

At present, the clinical diagnosis of brucellosis relies mainly on serological testing, which is based on the reactivity of antibodies against the smooth lipopolysaccharide of Brucella spp. (Franco et al., 2007). The antibodies tend to persist in infected and vaccinated animals, so routine serological diagnosis results in false-positive results (Nielsen et al., 2004). Thus, it is necessary to establish an effective diagnosis method to discern infected animals from vaccinated animals. Our results showed that OaPDCD10 mRNAs from vaccinated sheep were always higher than infected sheep during 60 days post-inoculation. Therefore,

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Fig. 8. The rOaPDCD10 protein promoted cell proliferation. 293T Cells (1 × 104) were seeded in 96-well plates overnight, and then treated with 50 μg/ml rOaPDCD10 or left untreated (control) at the indicated time. All treatments were performed in triplicate, and data were presented as mean ± SD (n = 3, *p b 0.05, **p b 0.01 vs. the control). Error bars showed the SD. Data shown were representative of two replications with similar results.

OaPDCD10 could be considered as a potential diagnostic biomarker to discern infected animals from vaccinated animals in brucellosis. Further studies need to be done to determine whether OaPDCD10 is able to be a diagnostic biomarker of brucellosis. 5. Conclusions The full-length cDNA of OaPDCD10 from the buffy coat of sheep was the first reported and characterized in this study. OaPDCD10 mRNAs were ubiquitously expressed in all tested tissues, and the highest expression was observed in the heart. OaPDCD10 mRNAs from Bm-infected or S2-vaccinated sheep were significantly up-regulated (p b 0.05) during 60 days post-inoculation compared to the control. Moreover, OaPDCD10 mRNAs from the vaccinated sheep were higher than ones from the infected sheep. The rOaPDCD10 protein was successfully expressed and purified, and the purified rOaPDCD10 was able to induce cell apoptosis and promote cell proliferation. As our studies shown, OaPDCD10 could be considered as a potential diagnostic biomarker to discern infected sheep from vaccinated sheep in brucellosis. Acknowledgments This work was supported by the Natural Science Foundation of China (Grant No. 30901070) and the Science & Technology Development Project of Jilin Province, China (Grant No. 20150204078NY). References Bergametti, F., Denier, C., Labauge, P., Arnoult, M., Boetto, S., Clanet, M., Coubes, P., Echenne, B., Ibrahim, R., Irthum, B., et al., 2005. Mutations within the programmed cell death 10 gene cause cerebral cavernous malformations. Am. J. Hum. Genet. 76, 42–51. Busch, C.R., Heath, D.D., Hubberstey, A., 2004. Sensitive genetic biomarkers for determining apoptosis in the brown bullhead (Ameiurus nebulosus). Gene 329, 1–10. Ceccarelli, D.F., Laister, R.C., Mulligan, V.K., Kean, M.J., Goudreault, M., Scott, I.C., Derry, W.B., Chakrabartty, A., Gingras, A.-C., Sicheri, F., 2011. CCM3/PDCD10 heterodimerizes with germinal center kinase III (GCKIII) proteins using a mechanism analogous to CCM3 homodimerization. J. Biol. Chem. 286, 25056–25064. Chen, P.-Y., Chang, W.-S.W., Chou, R.-H., Lai, Y.-K., Lin, S.-C., Chi, C.-Y., Wu, C.-W., 2007. Two non-homologous brain diseases-related genes, SERPINII and PDCD10, are tightly

9

linked by an asymmetric bidirectional promoter in an evolutionarily conserved manner. BMC Mol. Biol. 8, 1–14. Chen, L., Tanriover, G., Yano, H., Friedlander, R., Louvi, A., Gunel, M., 2009. Apoptotic functions of PDCD10/CCM3, the gene mutated in cerebral cavernous malformation 3. Stroke 40, 1474–1481. de Bagues, M.P.J., Dudal, S., Dornand, J., Gross, A., 2005. Cellular bioterrorism: how Brucella corrupts macrophage physiology to promote invasion and proliferation. Clin. Immunol. 114, 227–238. Dibble, C.F., Horst, J.A., Malone, M.H., Park, K., Temple, B., Cheeseman, H., Barbaro, J.R., Johnson, G.L., Bencharit, S., 2010. Defining the functional domain of programmed cell death 10 through its interactions with phosphatidylinositol-3,4,5-trisphosphate. PLoS One 5, 1–12. Ding, J.J., Wang, X.Y., Li, D.F., Hu, Y.L., Zhang, Y., Wang, D.C., 2010. Crystal structure of human programmed cell death 10 complexed with inositol-(1,3,4,5)tetrakisphosphate: a novel adaptor protein involved in human cerebral cavernous malformation. Biochem. Biophys. Res. Commun. 399, 587–592. Faurobert, E., Albiges-Rizo, C., 2010. Recent insights into cerebral cavernous malformations: a complex jigsaw puzzle under construction. FEBS J. 277, 1084–1096. Fernandez-Prada, C.M., Zelazowska, E.B., Nikolich, M., Hadfield, T.L., Roop, R.M., Robertson, G.L., Hoover, D.L., 2003. Interactions between Brucella melitensis and human phagocytes: bacterial surface O-polysaccharide inhibits phagocytosis, bacterial killing, and subsequent host cell apoptosis. Infect. Immun. 71, 2110–2119. Fidalgo, M., Fraile, M., Pires, A., Force, T., Pombo, C., Zalvide, J., 2010. CCM3/PDCD10 stabilizes GCKIII proteins to promote Golgi assembly and cell orientation. J. Cell Sci. 123, 1274–1284. Franco, M.P., Mulder, M., Gilman, R.H., Smits, H.L., 2007. Human brucellosis. Lancet Infect. Dis. 7, 775–786. Galdiero, E., Romano Carratelli, C., Vitiello, M., Nuzzo, I., Del Vecchio, E., Bentivoglio, C., Perillo, G., Galdiero, F., 2000. HSP and apoptosis in leukocytes from infected or vaccinated animals by Brucella abortus. New Microbiol. 23, 271-271. Galvan, V., Roizman, B., 1998. Herpes simplex virus 1 induces and blocks apoptosis at multiple steps during infection and protects cells from exogenous inducers in a cell-typedependent manner. Proc. Natl. Acad. Sci. U. S. A. 95, 3931–3936. Gross, A., Terraza, A., Ouahrani-Bettache, S., Liautard, J.P., Dornand, J., 2000. In vitro Brucella suis infection prevents the programmed cell death of human monocytic cells. Infect. Immun. 68, 342–351. Harvey, K.F., Pfleger, C.M., Hariharan, I.K., 2003. The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis. Cell 114, 457–467. He, Y., Zhang, H., Yu, L., Gunel, M., Boggon, T.J., Chen, H., Min, W., 2010. Stabilization of VEGFR2 signaling by cerebral cavernous malformation 3 is critical for vascular development. Sci. Signal. 3, 1–14. Hilder, T.L., Malone, M.H., Bencharit, S., Colicelli, J., Haystead, T.A., Johnson, G.L., Wu, C.C., 2007. Proteomic identification of the cerebral cavernous malformation signaling complex. J. Proteome Res. 6, 4343–4355. Huang, J.B., Wu, S., Barrera, J., Matthews, K., Pan, D.J., 2005. The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila homolog of YAP. Cell 122, 421–434. Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., et al., 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. Keane, J., Balcewicz-Sablinska, M.K., Remold, H.G., Chupp, G.L., Meek, B.B., Fenton, M.J., Kornfeld, H., 1997. Infection by Mycobacterium tuberculosis promotes human alveolar macrophage apoptosis. Infect. Immun. 65, 298–304. Lauenborg, B., Kopp, K., Krejsgaard, T., Eriksen, K.W., Geisler, C., Dabelsteen, S., Gniadecki, R., Zhang, Q., Wasik, M.A., Woetmann, A., et al., 2010. Programmed cell death-10 enhances proliferation and protects malignant T cells from apoptosis. APMIS 118, 719–728. Li, X., Zhang, R., Zhang, H., He, Y., Ji, W., Min, W., Boggon, T.J., 2010. Crystal structure of CCM3, a cerebral cavernous malformation protein critical for vascular integrity. J. Biol. Chem. 285, 24099–24107. Li, X., Ji, W., Zhang, R., Folta-Stogniew, E., Min, W., Boggon, T.J., 2011. Molecular recognition of leucine-aspartate repeat (LD) motifs by the focal adhesion targeting homology domain of cerebral cavernous malformation 3 (CCM3). J. Biol. Chem. 286, 26138–26147. Liquori, C.L., Berg, M.J., Siegel, A.M., Huang, E., Zawistowski, J.S., Stoffer, T., Verlaan, D., Balogun, F., Hughes, L., Leedom, T.P., et al., 2003. Mutations in a gene encoding a novel protein containing a phosphotyrosine-binding domain cause type 2 cerebral cavernous malformations. Am. J. Hum. Genet. 73, 1459–1464. Ma, X., Zhao, H., Shan, J., Long, F., Chen, Y., Chen, Y., Zhang, Y., Han, X., Ma, D., 2007. PDCD10 interacts with Ste20-related kinase MST4 to promote cell growth and transformation via modulation of the ERK pathway. Mol. Biol. Cell 18, 1965–1978. Molloy, A., Laochumroonvorapong, P., Kaplan, G., 1994. Apoptosis, but not necrosis, of infected monocytes is coupled with killing of intracellular bacillus Calmette-Guerin. J. Exp. Med. 180, 1499–1509. Nielsen, K., Smith, P., Widdison, J., Gall, D., Kelly, L., Kelly, W., Nicoletti, P., 2004. Serological relationship between cattle exposed to Brucella abortus, Yersinia enterocolitica O: 9 and Escherichia coli O157: H7. Vet. Microbiol. 100, 25–30. Ramsey-Ewing, A., Moss, B., 1998. Apoptosis induced by a postbinding step of vaccinia virus entry into Chinese hamster ovary cells. Virology 242, 138–149. Riant, F., Bergametti, F., Ayrignac, X., Boulday, G., Tournier-Lasserve, E., 2010. Recent insights into cerebral cavernous malformations: the molecular genetics of CCM. FEBS J. 277, 1070–1075. Rojas, M., Barrera, L.F., Puzo, G., Garcia, L.F., 1997. Differential induction of apoptosis by virulent Mycobacterium tuberculosis in resistant and susceptible murine macrophages: role of nitric oxide and mycobacterial products. J. Immunol. 159, 1352–1361. Schleider, E., Stahl, S., Wuestehube, J., Walter, U., Fischer, A., Felbor, U., 2011. Evidence for anti-angiogenic and pro-survival functions of the cerebral cavernous malformation protein 3. Neurogenetics 12, 83–86.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040

10

Y.-J. Yang et al. / Gene xxx (2014) xxx–xxx

Stahl, S., Gaetzner, S., Voss, K., Brackertz, B., Schleider, E., Sueruecue, O., Kunze, E., Netzer, C., Korenke, C., Finckh, U., et al., 2008. Novel CCM1, CCM2, and CCM3 mutations in patients with cerebral cavernous malformations: in-frame deletion in CCM2 prevents formation of a CCM1/CCM2/CCM3 protein complex. Hum. Mutat. 29, 709–717. Tolomeo, M., Di Carlo, P., Abbadessa, V., Titone, L., Miceli, S., Barbusca, E., Cannizzo, G., Mancuso, S., Arista, S., Scarlata, F., 2003. Monocyte and lymphocyte apoptosis resistance in acute and chronic brucellosis and its possible implications in clinical management. Clin. Infect. Dis. 36, 1533–1538. Voss, K., Stahl, S., Schleider, E., Ullrich, S., Nickel, J., Mueller, T.D., Felbor, U., 2007. CCM3 interacts with CCM2 indicating common pathogenesis for cerebral cavernous malformations. Neurogenetics 8, 249–256. Voss, K., Stahl, S., Hogan, B.M., Reinders, J., Schleider, E., Schulte-Merker, S., Felbor, U., 2009. Functional analyses of human and zebrafish 18-amino acid in-frame deletion pave the way for domain mapping of the cerebral cavernous malformation 3 protein. Hum. Mutat. 30, 1003–1011. Wang, Y.G., Liu, H.T., Zhang, Y.M., Ma, D.L., 1999. cDNA cloning and expression of an apoptosis-related gene, human TFAR15 gene. Sci. China Ser. C Life Sci. 42, 323–329.

Yin, H., Shi, Z., Jiao, S., Chen, C., Wang, W., Greene, M.I., Zhou, Z., 2012. Germinal center kinases in immune regulation. Cell. Mol. Immunol. 9, 439–445. Yoruk, B., Gillers, B.S., Chi, N.C., Scott, I.C., 2012. Ccm3 functions in a manner distinct from Ccm1 and Ccm2 in a zebrafish model of CCM vascular disease. Dev. Biol. 362, 121–131. Zhang, H.Y., Ma, X., Deng, X., Chen, Y.Y., Mo, X.N., Zhang, Y.M., Zhao, H.S., Ma, D.L., 2012. PDCD10 interacts with STK25 to accelerate cell apoptosis under oxidative stress. Front. Biosci. 17, 2295–2305. Zhang, M., Dong, L., Shi, Z., Jiao, S., Zhang, Z., Zhang, W., Liu, G., Chen, C., Feng, M., Hao, Q., et al., 2013. Structural mechanism of CCM3 heterodimerization with GCKIII kinases. Structure 21, 680–688. Zheng, X., Xu, C., Di Lorenzo, A., Kleaveland, B., Zou, Z., Seiler, C., Chen, M., Cheng, L., Xiao, J., He, J., et al., 2010. CCM3 signaling through sterile 20-like kinases plays an essential role during zebrafish cardiovascular development and cerebral cavernous malformations. J. Clin. Investig. 120, 2795–2804.

Please cite this article as: Yang, Y.-J., et al., Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries), Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.040