Molecular cloning and characterization of CD3ε in Chinese domestic goose (Anser cygnoides)

Gene 564 (2015) 160–167

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Molecular cloning and characterization of CD3ε in Chinese domestic goose (Anser cygnoides) Xuelian Zhang, Shuangshi Wei, Jianwei Shao, Shudong Zhang, Mingchun Gao, Wenlong Zhang, Bo Ma ⁎, Junwei Wang ⁎ Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, PR China

a r t i c l e

i n f o

Article history: Received 24 November 2014 Received in revised form 11 March 2015 Accepted 14 March 2015 Available online 18 March 2015 Keywords: Goose CD3ε Molecular cloning Expression Characterization

a b s t r a c t CD3 is one of the most important cell surface markers of T lymphocytes which play an important role in signal transmission of antigen recognition. In this study, goose CD3ε gene was cloned by touchdown PCR with the template of goose thymus cDNA. The complete open reading frame of goose CD3ε encoded 178 amino acid residues with a 21 signal peptide. Sequence alignments showed that goose CD3ε had an amino acid sequence similarity to duck (80.3%) and chicken (66.3%). The extracellular domain of goose CD3ε was efficiently expressed as fusion protein in Escherichia coli, purified by a Ni-NTA agarose column, and the purified recombinant protein was used to produce anti-GoCD3εex polyclonal antibodies. The characteristics of PAb were identified by Western blot, cellular ELISA, IFA, FCM, and LSCM analysis. These results may be useful for a better understanding of goose CD3ε and have a foundation for the study of T cell mediated immune mechanism in waterfowl. © 2015 Elsevier B.V. All rights reserved.

1. Introduction CD3 is one of the most important cell surface markers of T lymphocytes (Bertram et al., 1996). In mammals, T-cells can be activated when antigenic peptides, presented on the surface of MHC molecules as peptide MHC (pMHC) complexes, are recognized by the T-cell antigen receptor (TCR) in a CD3–TCR complex on T-cell membranes, from where the signal is transmitted to the inside of the cell (Ashwell and Klusner, 1990; Klausner et al., 1990). The TCR is non-covalently bound to the CD3 complex, which is involved in TCR surface expression and T-cell activation. CD3 is also essential for the expression of TCR genes (Dave et al., 1997). The CD3 complex is a unique group of proteins composed of gamma, delta, epsilon, and zeta membrane-associated polypeptides in T cells. In antigen recognition processing, CD3 plays a role of signal transduction. Abbreviations: cDNA, complementary DNA; GoCD3ε, goose CD3ε gene; GoCD3εex, the extracellular domain of goose CD3ε; GoPBLs, goose peripheral blood lymphocytes; PAb, polyclonal antibody; MAb, monoclonal antibody; MHC, major histocompatibility complex; PBLs, peripheralblood lymphocytes; TCR,T-cellreceptor; IPTG,isopropylβ-D-1-thiogalactopyranoside;ELISA,enzyme linkedimmunosorbentassay; IFA,indirectimmunofluorescence assay; FCM, flow cytometric; LSCM, laser scanning confocal fluorescence microscope; PI, propidium iodide; DAPI, 4′,6-diamidino-2-phenylindole; HRP, horseradish peroxidase; FITC, fluorescein isothiocyanate; BRS, basic amino acid rich sequence; PRS motif, prolinerich region sequence; ER retention sequence, endoplasmic reticulum retention sequence; ITAMs, immunoreceptor tyrosine-based activation motifs; PBMC, peripheral blood mononuclear cells. ⁎ Corresponding authors at: College of Veterinary Medicine, Northeast Agricultural University, No. 59 Mu-cai Street, Harbin 150030, PR China. E-mail addresses: [email protected] (B. Ma), [email protected] (J. Wang).

http://dx.doi.org/10.1016/j.gene.2015.03.034 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Antigen–MHC complexes combined with TCR/CD3 complexes can generate intracellular signals that can instantaneously up-regulate the transcription of many genes in unstimulated T cells; as a result, the corresponding protein that splits T cells and exhibits effector functions is transiently expressed (Huppa and Ploegh, 1997). The cell surface expression of TCR occurs in association with CD3 γε and δε heterodimers and ζζ homodimer (Call and Wucherpfennig, 2004; Kuhns et al., 2006). CD3 γ and δ may affect transfer and expression of the TCR/CD3 complex; the ε chain primarily mediates antigen or superantigen activation signal. The CD3ε of TCR is an invariant molecule with an important role in signal transduction via the TCR/CD3 complex. Thus far, CD3ε has been cloned and identified in several mammals, such as human, mouse, koala, dog, cat, bovine, and sheep (Gold et al., 1986; Clevers et al., 1988; Wilkinson et al., 1995; Nash et al., 1991; Nishimura et al., 1998; Hagens et al., 1996; Hein and Tunnacliffe, 1993). The mammalian CD3ε chain is structurally related and composed of an extracellular immunoglobulin-like domain, a transmembrane region, and a cytoplasmic tail, which contains a single immunoreceptor tyrosine-based activation motif (ITAM) that interacts with intracellular tyrosine kinases (Nishimura et al., 1998). Compared with mammalian CD3ε studies, related studies on birds have been rarely conducted at the molecular level. Non-mammalian CD3ε homologs have been identified in chicken, duck, and fish (Gobel and Fluri, 1997; Dzialo and Cooper, 1997; Kothlow et al., 2005; Park et al., 2001; Overgard et al., 2009; Maisey et al., 2011). The CD3ε open reading frames (ORFs) of chicken and duck are 525 and 546 bp, respectively. Comparison of chicken and mammalian CDε proteins revealed low homology in the extracellular domain with clusters of similarities

X. Zhang et al. / Gene 564 (2015) 160–167

located around the N-terminal cysteine residue and proximal to the transmembrane domain, which is the CXXC motif (Park et al., 2001). The high conservation of the cytoplasmic domain comprised motifs essential for signal transduction. Before sequence information of nonmammalian CD3 proteins has become available, an anti-human CD3ε polyclonal antiserum has been used to identify CD3ε in various mammalian, avian, and fish species (Bertram et al., 1996; Keresztes et al., 1996; Wilkinson et al., 1995; Cook et al., 2001). Goose and duck are close relatives; despite this close relationship between these organisms, the immune system of duck has been studied to a greater extent than that of goose; no reports regarding CD3ε homologs in goose have been presented. In terms of physiological characteristics of avian species, goose is characterized with the same hematopoietic tissue as duck. Based on previous studies on duck, generalizations regarding the immune system of goose can be drawn. This study is the first to describe the molecular cloning of Anser cygnoides CD3ε cDNA from the Zi goose in Heilongjiang province. Furthermore, the bioinformatics analysis of goose CD3ε was performed, extracellular domain peptide was expressed, and specific anti-GoCD3εex polyclonal antibody(PAb) was generated, then characterized by ELISA, Western blot, IFA, flow cytometry, and laser scanning confocal fluorescence microscopic assays. This study provided insights into the preparation of the polyclonal antibody of goose CD3ε, which could be used as an effective reagent to detect T lymphocyte subsets of goose. Moreover, this study helped elucidate T cell mediated immune mechanism in waterfowl. 2. Materials and methods

161

a final volume of 10 μL. This reaction mixture was incubated at 42 °C for 1.5 h. 2.1.2. cDNA PCR amplification reaction Two microliters of cDNA from the previous reaction was amplified with 1 μL of PrimeSTAR™ HS DNA Polymerase (TaKaRa Bio, Otsu, Japan) in the presence of 20 μL of 5 × PrimeSTAR Buffer, 2 μL of dNTP Mix (2.5 mM), 1 μL each of the 5′ PCR primer and the 3′ PCR primer (Table 1) and deionized water to a final volume of 100 μL. The reaction contents were then mixed well. The PCR was completed using a Mastercycler ep Gradient thermocycler (Eppendorf, Hamburg, Germany) with the following program: 95 °C for 3 min followed by 30 cycles of 98 °C for 30 s, 65 °C for 30 s, and 72 °C for 6 min. The dsDNA product was stored at −20 °C until use. 2.2. Cloning of GoCD3ε A pair of primers (CD3ε-S and CD3ε-A) of the goose CD3ε gene was designed on the basis of the sequence of duck CD3ε (GenBank ID: AF378704). The dsDNA of goose thymus tissue was used as a template. The gene of the goose CD3ε (GoCD3ε) was amplified by Touchdown PCR. The following PCR conditions were used: 94 °C for 5 min, 30 cycles at 94 °C for 1 min, annealing at a variable temperature (65 °C to 50 °C) for 30 s, and extension at 72 °C for 1 min. In the first cycle, annealing temperature was set at 65 °C. In each of the 29 subsequent cycles, annealing temperature was decreased by 0.5 °C, followed by 10 cycles at 94 °C for 1 min, 50 °C for 30 s, and 72 °C for 1 min. The PCR product was inserted into pEASY-Blunt vector. DNA sequencing was performed using the dideoxy chain termination method.

2.1. Total RNA extraction and cDNA synthesis Total RNA was isolated from 50 mg of goose thymus tissue using the E.Z.N.A.® HP Total RNA Isolation Kit (OMEGA Bio-Tek, Doraville, Georgia, USA). The concentration and purity were determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Hudson, NH, USA), and the cDNA was synthesized from the total RNA isolated from goose thymus tissue using SMART (Switching Mechanism at 5′ End of RNA Transcript) Reverse Transcriptase (Clontech, Palo Alto, CA, USA).

2.1.1. First-strand cDNA synthesis One microliter of the First-dT20 primer (Table 1) was added to 3.5 μL (59 ng/μL) of total RNA. The tube was then mixed, spun briefly and then placed at 72 °C for 3 min, followed by incubation at 42 °C for 2 min. The cDNA synthesis was performed with a prepared mix of 1 μL of SMARTScribe Reverse Transcriptase (Clontech, Palo Alto, CA, USA) in the presence of 2 μL of 5 × First-Strand Buffer, 0.25 μL of DTT (100 mM), 1 μL of dNTP Mix (10 mM), 0.25 μL of RNase Inhibitor (TaKaRa Bio, Otsu, Japan), 3G primer (Table 1) and deionized water to

2.3. Characteristic analysis of GoCD3ε sequence The cDNA sequence of goose CD3ε was analyzed using the Editseq and Megalign programs of the Lasergene 11 package (DNAStar, Inc., USA). Similarity was analyzed using the Basic Local Alignment Search Tool (BLAST) (National Center for Biotechnology Information) (http:// www.ncbi.nlm.nih.gov/) to confirm whether the correct gene was cloned. The putative amino acid sequence of CD3ε was compared with its counterparts from other animals by using ClustalX 2.0 (Larkin et al., 2007). Multiple alignments and phylogenetic tree were constructed using MEGA 5.0 and based on the Neighbor-joining method with a boot strap of 1000 repetitions (Tamura et al., 2011). ESPript was used to format multiple sequence alignments in a single postscript file (Gouet et al., 1999). Potential ORF was determined in the cDNA of goose CD3ε by using an ORF finder algorithm (http://www.ncbi.nlm. nih.gov/gorf/). Signal peptide sequence was predicted by SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/), the transmembrane domain was predicted by TMHMM Server v.2.0 (http://www.cbs.dtu.dk/

Table 1 Oligonucleotide primers used to amplify cDNAs for GoCD3ε and GoCD3εex. Gene name

Primer name

Primer sequence (5′ → 3′)

Ann T (°C)

cDNA

First-dT20 3G primer 5′ PCR primer 3′ PCR primer CD3ε-S CD3ε-A CD3εex-S-P CD3εex-A-P CD3εex-S-E CD3εex-A-E

TCTAGAGTCGACCTGCACATTTTTTTTTTTTTTTTTTTTGC GAGCTCGAATTCACTTAGTATAGCGCGCGGG TCTAGAGTCGACCTGCACAT CTCGAATTCACTTAGTATAGCG AGAAGGAGGAACACGAGGAT TAGCAAGCTGGGCAGAAG CGCGGATCCATGCAGGAGGTTAC TGATGAAG CCGCTCGAGTTACAAGGTATCCAGCTCCCTACAG CGCGGATCCACCATGGGCCAGGAGGTTACTGATGAAG CCGCTCGAGTTACAAGGTATCCAGCTCCCTACAG

65

ds cDNA Goose CD3ε Goose CD3εex-P Goose CD3εex-E

52.5 54.9 65.0 65.0

ACCATGG indicates Kozak sequence; GGC indicates biased codons for both the human and mouse; GGATCC indicates the restriction enzyme cutting site of BamH I; and CTCGAG indicates the restriction enzyme cutting site of Xho I.

162

X. Zhang et al. / Gene 564 (2015) 160–167

services/TMHMM/), and glycosylation sites were analyzed by NetOGlyc 3.1 (http://www.cbs.dtu.dk/services/NetOGlyc-3.1/). 2.4. Construction of the vector containing GoCD3εex A pair of primers (CD3εex-S-P and CD3εex-A-P, Table 1) was designed to amplify the extracellular domain gene of goose CD3ε (GoCD3εex, 249 bp). The following PCR conditions were used: 98 °C for 5 min, 30 cycles of 94 °C for 30 s, 65 °C for 1 min, 72 °C for 1 min 30 s, and 72 °C for 5 min. The PCR product was purified and digested with BamH I and Xho I and then cloned into the expression vector pET-28a (Novagen) predigested with the same enzymes. The construct was designated as pET-28a–GoCD3εex. The other pair of expression primers (CD3εex-S-E and CD3εex-A-E, Table 1) was used to amplify the extracellular domain gene of goose CD3ε; this gene was subsequently cloned into the eukaryotic expression vector pcDNA3.1(+) (Novagen). The PCR program and the cloning method were similar to those above. The construct was designated as pcDNA3.1– GoCD3εex. 2.5. Expression and purification of recombinant protein The expression of pET-28a–GoCD3εex was conducted in a flask as described (Wei et al., 2014). The recombinant protein GoCD3εex (rGoCD3εex) was induced at 37 °C for 4 h by adding isopropyl β-D1-thiogalactopyranoside (IPTG, Sigma) to a final concentration of 1 mM, and then analyzed by 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to determine the expression form. Escherichia coli cultures were collected and centrifuged to obtain a bacterial cell pellet to purify His-tagged GoCD3εex by using a QIA expressionist System according to the manufacturer's protocol. The purified protein was dialyzed for 2 days against PBS solution, concentrated, and stored at −70 °C for further use. The final protein concentration was determined using a BCA protein assay kit (Beyotime, Jiangsu, China). 2.6. Production and purification of anti-GoCD3εex polyclonal antibody PAb was obtained by immunizing 200 μg of purified rGoCD3εex emulsified with Freund's complete adjuvant (v/v = 1:1) into a New Zealand rabbit. PAb was collected after four injections were administered, and each injection was performed at an interval of 10 days. Rabbit immunoglobulin fraction IgG was purified using 50% and 33% saturated (NH4)2SO4 precipitation and protein G resin (GenScript) according to the manufacturer's protocol.

with 200 μL of RIPA lysis buffer (Beyotime, Jiangsu, China). PBL lysates and recombinant protein were then electrophoresed using 5% (v/v) stacking gel and 15% (v/v) resolving gel; the electrophoresed products were subsequently transferred to nitrocellulose membranes. These membranes were blocked with 5% skim milk in PBST at 37 °C for 2 h, incubated with 1:500 (v/v) purified PAb diluted in PBST at 37 °C for 1 h, washed thrice with PBST at an interval of 10 min, and incubated with 1:2000 (v/v) HRP-conjugated goat anti-rabbit IgG (H + L) (ZSGB-BIO, Beijing, China) at 37 °C for 1 h. Finally, the membrane was visualized with ECL solution (Beyotime, Jiangsu, China). 2.8. Indirect immunofluorescence determines the immunoreactivity of antiGoCD3εex polyclonal antibody Chicken embryo fibroblasts were cultured in 12-well plates and cultured for 18 h to 24 h at 37 °C and 5% CO2 until the cells covered 60% to 80% of the plates. Lipofectamine was used to transfect the eukaryotic expression plasmid pcDNA3.1–GoCD3εex and plasmid pcDNA3.1 (+) into CEF according to the protocols for a Lipofectamine® LTX DNA transfection reagent. Afterward, the transfected cells were cultured at 37 °C and 5% CO2 for 48 h, fixed in 4% paraformaldehyde at 4 °C for 30 min, and incubated with 1:100 (v/v) purified PAb diluted at 37 °C for 1 h. The cells were further incubated with FITC-conjugated goat anti-rabbit IgG (H + L) (ZSGB-BIO, Beijing, China) at a 1:100 dilution in PBS at 37 °C for 1 h, co-stained with 5 μg/mL of propidium iodide (PI, Sigma), and examined under a fluorescence microscope. 2.9. Flow cytometry and laser scanning confocal fluorescence microscope detect goose CD3+ T lymphocytes Goose peripheral blood lymphocytes were isolated, and reacted with the purified PAb at 4 °C for 1 h. Rabbit anti-human CD3 (T cells) polyclonal antibody (ZSGB-BIO, Beijing, China) was used as a control. The cells were washed with PBS containing 1% FBS and then incubated with 1:200 (v/v) FITC-conjugated goat anti-rabbit IgG (H + L) (ZSGB-BIO, Beijing, China) at 4 °C for 1 h. The cells were washed again thrice, subsequently suspended in PBS containing 1% FBS, and subjected to flow cytometry analysis (FACS Aria). Afterward, the cells were stained with 5 mg/mL of 4′,6diamidino-2-phenylindole (DAPI, Sigma) at a 1:1000 dilution in PBS for 20 min. The serum obtained from the unimmunized New Zealand rabbit was used as negative control; the same procedure was repeated. The cells were observed under a laser scanning confocal fluorescence microscope. 3. Results

2.7. Titer and reactivity of anti-GoCD3εex polyclonal antibody

3.1. Molecular cloning and sequence analysis of the GoCD3ε cDNA

Antibody titer was determined by cellular ELISA. Microtiter plates were coated (100 μL/well) with 1 × 105 of peripheral blood lymphocytes of Zi goose per well at 37 °C overnight; afterward, these plates were washed thrice with PBST (PBS, 0.5% Tween20, pH 7.4) at an interval of 10 min and blocked (300 μL/well) with 5% skim milk in PBST at 37 °C for 2 h. The plates were subsequently incubated in different dilutions of PAb at 37 °C for 2 h, washed thrice with PBST at an interval of 10 min, and incubated with 1:5000 (v/v) HRP-conjugated goat anti-rabbit IgG (H + L) (ZSGB-BIO, Beijing, China) at 37 °C for 1 h. Peroxidase activity was developed by tetramethylbenzidine substrate (100 μL/well) for 10 min to 15 min at room temperature and terminated by 2 M H2SO4 (50 μL/well). Absorbance was read at 450 nm by using an ELx808 absorbance microplate reader. Western blot assay was performed to determine the specificity of PAb. PBLs (peripheral blood lymphocytes) were obtained from a healthy Zi goose and placed in a lymphocyte separation medium (Solarbio, Beijing, China). PBL (1 × 106 cell/tube) lysates were prepared

A 625 bp DNA fragment was obtained by PCR amplification of SMART dsDNA with the designed primers; a BLAST search revealed that the sequence of this DNA fragment was similar to the published sequence of CD3ε genes. The complete GoCD3ε ORF (GenBank accession No. JX556219) consists of 537 nucleotides, which encode a 178amino acid polypeptide with a signal peptide (21 amino acids), an extracellular domain (83 amino acids), a transmembrane domain (23 amino acids), and a cytoplasmic domain (51 amino acids). The amino acid sequence of goose CD3ε was then compared with other CD3ε sequences of different species. Goose CD3ε shared 80.3%, 66.3%, 39.3%, and 41.0% similarities to Muscovy duck CD3ε (GenBank Accession No. AAW63063.1), chicken CD3ε (GenBank Accession No. CAB62063.1), human CD3ε (GenBank Accession No. EAW67363.1), and mouse CD3ε (GenBank Accession No. ABS89007.2), respectively. One N-glycosylation site is observed. The predicted molecular weight of the goose CD3ε peptide is 17.3 kDa, and the extracellular domain peptide is 9.1 kDa. The entire extracellular domain of goose

X. Zhang et al. / Gene 564 (2015) 160–167

CD3ε was shorter than that of other species. The most prominent differences among species were observed in the extracellular domain. However, cytoplasmic and transmembrane regions were relatively conserved among CD3ε molecules. Four cysteine residues, a basic amino acid-rich sequence (BRS), a proline-rich region sequence (PRS), a CXXCXE motif, the immunoreceptor tyrosine-based activation motifs (ITAMs), and an endoplasmic reticulum (ER) retention sequence were conserved in goose CD3ε; these factors are considered as important characteristics of CD3ε (Fig. 1A and C). To clarify the evolutionary relationship between goose CD3ε and other avian and mammal CD3ε molecules, we constructed a phylogenetic tree with the amino acid sequence of CD3ε (Fig. 1B). The results showed that these amino acid sequences were clustered into three

163

groups as avian, fish, and mammalian. The goose CD3ε was closely related to avian CD3ε, especially duck CD3ε.

3.2. Expression and purification of rGoCD3εex The extracellular domain gene of goose CD3ε (GoCD3εex) was expressed in E. coli and purified by affinity chromatography under denaturation conditions. Protein expression and purity were analyzed by SDS-PAGE. E. coli-expressed His-tagged rGoCD3εex was expressed in the inclusion body form, and the molecular weight was approximately 14 kDa, which is consistent with the predicted molecular weight of the sequence (Fig. 2).

Fig. 1. The nucleotide and deduced amino acid sequences, phylogenetic tree and alignment for goose CD3ε. (A) The nucleotide and deduced amino acid sequences of goose CD3ε gene. The stop codon TGA is indicated with an asterisk (*). (B) Phylogenetic tree shows the relationship between the amino acid sequence of goose CD3ε and other CD3ε molecules. It was constructed by MEGA 5.0 using the amino acid sequence of CD3ε of the goose, human (GenBank Accession no.: EAW67363.1), gorillas (BAJ16132.1), gibbon (BAJ16135.1), monkey (BAJ16152.1), Mouse (ABS89007.2), rabbit (BAA86993.1), pig (ACF04803.1), cattle (ELR55398.1), chicken (CAB62063.1), rock pigeon (EMC78340.1), Muscovy duck (AAW63063.1), mallard (ACL52169. 1), flounder (BAC87847.1), fugu (BAD93375.1), and salmon (ABO10202.1). The numbers at each node indicated the percentage of bootstrapping after 1000 replications. (C) Comparison of the predicted amino acid sequences of the CD3ε among species. Alignment of the amino acid sequences of the CD3ε domains of goose (JX556219), duck (AAW63063.1), chicken (CAB62063.1), human (EAW67363.1), and mouse (ABS89007.2). Alignment was performed using the ClustalX program and DNAStar software. The red shadow words indicated positions which have a single, fully conserved amino acid residue while the white blank covered words indicated the conservation between groups of strongly similar properties. The highly conserved cysteine residues within the extracellular domain are indicated by closed triangles (▲) and a single negatively charged aspartic acid residue is indicated by opened triangle (△). The potential glycosylation site is in red box (□). The conserved CXXCXE motifs, basic amino acid rich sequence (BRS), proline-rich region (PRS), ITAMs and ER retention sequence (ER) are arrow regions (←→). Two tyrosine residues within the ITAM are marked with pentagrams (★).

164

X. Zhang et al. / Gene 564 (2015) 160–167

the negative control (Fig. 4). These results indicated that PAb could specifically recognize the polypeptide of goose CD3ε expressed in CEF.

3.5. Flow cytometry (FCM) and laser scanning confocal fluorescence microscope analysis

Fig. 2. SDS-PAGE analysis of rGoCD3εex expressed and purified. Lane M: Unprestained Protein Molecular Weight Marker; Lane 1: pET-28a (+) induced by IPTG; Lane 2: rGoCD3εex before induction; Lane 3: rGoCD3εex after induction; Lanes 4 and 5: The supernatant and the inclusion body of rGoCD3εex after induction; Lane 6: Purified rGoCD3εex.

The results of flow cytometry analysis of goose peripheral blood lymphocytes showed that PBLs stained with rabbit anti-human CD3 (T cells) polyclonal antibody and PAb exhibited positive cell migration compared with PBLs stained with the negative control (Fig. 5). The percentages of PBLs stained with rabbit anti-human CD3 polyclonal antibody and PAb were 29.3% and 55.3%, respectively. Studies on a number of mature and healthy animals have revealed normal CD3 reactivity between 54% and 73% of lymphoid PBMC (peripheral blood mononuclear cells) (Wilkinson et al., 1995). The results of laser scanning confocal fluorescence microscopy showed the presence of fluorescence signal on the cell membrane (Fig. 6). Therefore, PAb could be potentially used to detect the percentage and the shape of CD3+ T lymphocytes.

3.3. Characterizations of anti-GoCD3εex polyclonal antibodies The purified rGoCD3εex was used to obtain anti-GoCD3εex polyclonal antibodies in rabbits. PAb was purified by saturated ammonium sulfate and protein G resin. SDS-PAGE analysis revealed two bands in the IgG fractions, particularly a heavy chain (50 kDa) and a light chain (25 kDa) (data not shown). Immunoreactivity and specificity of PAb were determined by Western blot and cellular ELISA, respectively. PAb exhibited excellent immunoreactivity with rGoCD3εex and peripheral blood lymphocytes. Two bands were revealed by Western blot (Fig. 3A). One band was found at 14 kDa, which is consistent with the predicted molecular weight of rGoCD3εex; the other band was detected at approximately 20 kDa, which can be attributed to the glycosylation of putative N-glycosylation sites at amino acid residue 78 in the mature peptide. The PAb at 1:102,400 dilutions could detect 1 × 105 of goose peripheral blood lymphocytes (Fig. 3B).

3.4. Indirect immunofluorescence analysis of anti-GoCD3εex polyclonal antibodies The CEF cells transfected with the eukaryotic expression plasmid pcDNA3.1–GoCD3εex were used to detect PAb by indirect immunofluorescence; the CEF cells were transfected with plasmid pcDNA3.1 (+) and used as negative control. CEF cells transfected with pcDNA3.1– GoCD3εex showed green fluorescence signal at 48 h after transfection was performed; conversely, fluorescence signal was not detected in

4. Discussion CD3 expression in mammals occurs early in lymphoid development and in mature T-cells. In addition to the CD3ζ chain (Weiss and Littman, 1994), the ε chain has been characterized as an autonomous signal transduction unit of a TCR. Current studies on the CD3 of anseriform birds focus on chicken and duck; however, no related reports in goose have been presented. For instance, chicken CD3ε was cloned, which is the first non-mammalian CD3ε (Gobel and Fluri, 1997). In our study, molecular cloning, sequencing, and structural and phylogenetic analyses of goose CD3ε were performed. The cloned goose CD3ε provided a material basis of the function of goose CD3 molecules; these results could also be used in studies related to waterfowl immune cell function. The amino acid sequence of goose CD3ε was more homologous to other vertebrate CD3ε in the cytoplasmic and transmembrane domains than in the extracellular domain. The cytoplasmic domains of CD3 chains contain immunoreceptor tyrosine-based activation motifs consisting of a pair of YxxI/L motifs separated by six to eight amino acid residues (Love and Hayes, 2010). After receptor engagement is completed, TCR-ITAM tyrosines are phosphorylated; as a result, the src homology 2 (SH2) domain containing kinases is recruited and activated (Wange and Samelson, 1996). The function of TCR-ITAMs has been analyzed, and results revealed that individual motifs bind at different affinities to the same effector but selectively to other potential effector molecules (Isakov et al., 1995).

Fig. 3. Reactivity of anti-GoCD3εex polyclonal antibodies. A Western blot of rGoCD3εex with PAb. Lane M: EasySee Western Marker; Lane 1: GoPBL lysates incubated with PAb; Lane 2: Purified rGoCD3εex incubated with PAb. B. The titer of PAb. The negative serum is obtained from the unimmunized New Zealand rabbit. Values in figure are means of three replicates. Standard errors are labeled.

X. Zhang et al. / Gene 564 (2015) 160–167

165

Fig. 4. Anti-GoCD3εex polyclonal antibodies react with the polypeptide of goose CD3ε expressed in the eukaryotic cells (×200). A. Shows chicken embryo fibroblasts which were transfected with the pcDNA3.1 (+) vector alone. B. Indicates the recombinant plasmid pcDNA3.1–GoCD3εex expressed in chicken embryo fibroblasts 48 h after transfection. Cells were fixed and incubated with PAb and stained with FITC-conjugated goat anti-rabbit IgG (H + L) and PI, and observed under a fluorescent microscope. After staining with PI, the nuclei were stained red.

A basic amino acid-rich sequence (BRS), a proline-rich region sequence (PRS) motif and an endoplasmic reticulum (ER) retention sequence conserved in goose CD3ε, have been considered as important characteristics of CD3ε. These motifs are essential for intracellular signaling by CD3ε or regulation of assembly and surface expression of the TCR/CD3 complex (Mallabiabarrena et al., 1992). A basic amino acid-rich sequence (BRS) in the juxtamembrane region of the CD3ε cytoplasmic tail can mediate interaction with selected phosphoinositides present at different locations in cells, including the inner layer of the plasma membrane (Xu et al., 2008; Deford-Watts et al., 2009). The CD3 characteristic proline-rich region RPPP preceding the first YXXL/I repeat of the ITAM is also conserved. However, the process by which information is transferred from TCR–pMHC complexes to the CD3 signaling subunits remains controversial. One model postulates that antigen recognition by TCRs probably unmasks a PRS present in the CD3ε cytosolic segment; thus, T-cell activation is stimulated (Schamel et al., 2006). Another updated model of the regulation of PRS accessibility in thymocytes unifies previous observations regarding the constitutive versus inducible nature of PRS accessibility to Nck (de la Cruz et al., 2011; Borroto et al., 2014). The cytoplasmic domain is highly conserved; this finding explains the ability of anti-human CD3 polyclonal antiserum and MAb to crossreact with the CD3ε molecule in ducks (Bertram et al., 1996; Jones

et al., 1993). Anti-human CD3ε polyclonal antiserum can recognize a phylogenetically conserved part of the CD3ε cytoplasmic tail that detects T cells of many avian and mammalian species in formalin-fixed, paraffin-embedded tissue sections (Bertram et al., 1996; Keresztes et al., 1996). Even before sequence information was available for nonmammalian CD3 proteins, anti-human CD3ε polyclonal antiserum has been used to identify CD3ε in various mammalian, avian, and fish species (Wilkinson et al., 1995; Cook et al., 2001). The most prominent differences among the species were observed in the extracellular domain. CD3 proteins contain a short extracellular stalk connecting their Ig-like domains to their transmembrane domains. Studies have been performed in vitro to understand the effect of mutation of these cysteine residues on the TCR complex assembly. Some studies have suggested that the CXXCXE motif is involved in the dimerization of CD3ε to CD3γ or to CD3σ (Thomassen et al., 2006; Borroto et al., 1998). Similar to the CD3ε sequences in other species, the goose CD3ε contains four cysteines in the extracellular domain and a single negatively charged asparagine residue in the transmembrane domain. These residues are possibly implicated in the stabilization of the TCR– CD3 complex (Mason et al., 1989). The results of the phylogenetic analyses of CD3ε indicated that goose CD3ε was conserved in the evolution of waterfowl. These results further indicated that the amino acid sequence of goose CD3ε displays

Fig. 5. Flow cytometric analysis of anti-GoCD3ε polyclonal antibody. The percentage of GoPBLs stained with PAb is 55.3%. Negative control, GoPBLs incubated with the serum obtained from the unimmunized New Zealand rabbit. GoPBLs incubated with rabbit anti-human CD3 (T cells) polyclonal antibody as a control.

166

X. Zhang et al. / Gene 564 (2015) 160–167

Fig. 6. Laser scanning confocal microscope analysis of PAb against goose CD3ε. GoPBLs were fixed and incubated with PAb and co-stained with FITC-conjugated goat anti-rabbit IgG (H + L) and DAPI. GoPBLs observed under a laser scanning confocal microscope. Negative control, GoPBLs incubated with the serum obtained from the unimmunized New Zealand rabbit. After staining with DAPI, the nuclei were stained blue.

structural features similar to those of other species, and these findings may provide new insights into the goose CD3ε molecule. CD3 is an important transmembrane glycoprotein on T lymphocytes; with this glycoprotein, CD3ε chain can be detected to identify T lymphocytes (Mason et al., 1989). CD3 is an important transmembrane glycoprotein on T lymphocytes; CD3ε plays a critical role in TCR signaling. In this study, goose CD3ε extracellular protein was expressed in E. coli. Rabbit anti-GoCD3εex polyclonal antibodies were prepared using purified recombinant protein as an antigen and then identified by Western blot and cellular ELISA. Furthermore, PAb was highly specific to the goose CD3ε molecule. Flow cytometry results indicated that the anti-CD3 stains a separate population of lymphocytes from the negative control. The numbers of GoPBLs stained with PAb also corresponded well with the number of T-cells in other species, as indicated by Ab to cell surface CD3 Ags (Lalor et al., 1986; Gebhard and Carter, 1992; Wilkinson et al., 1992). To apply FACS in sorting or determining the percentage of CD3+ T-cells, we should further optimize reaction conditions. The results of flow cytometry and laser scanning confocal fluorescence microscopy indicated that PAb can be potentially used to detect the percentage and the shape of CD3+ T lymphocytes, but additional experiments should be performed to confirm this phenomenon. Antibodies against CD3 are highly specific T-cell markers (Keresztes et al., 1996; Wilkinson et al., 1995). To establish a method that can detect goose T lymphocytes and provide material foundation, we should develop a monoclonal antibody for the next step. Moreover, basic studies on the use of anti-GoCD3εex monoclonal antibody goose cellular immunity may help clarify the occurrence and the development of methodology and important materials in disease studies. In summary, the PAb developed in this study provided new insights into goose CD3ε and facilitated the establishment of a material foundation to elucidate T-cell-mediated immune mechanism of waterfowl. Further studies should be performed to investigate T-cell-mediated immune responses of goose during viral infection.

Author disclosure statement The authors have no financial interests to disclose. Acknowledgments This study was supported financially by the Research Fund for the Doctoral Program of Higher Education of China (20102325110004) and by the grants from the Education Department of Heilongjiang Province of China (12541042). References Ashwell, J.D., Klusner, R.D., 1990. Genetic and mutational analysis of the T-cell antigen receptor. Annu. Rev. Immunol. 8, 139–167. Bertram, E.M., Wilkinson, R.G., Lee, B.A., Jilbert, A.R., Kotlarski, I., 1996. Identification of duck T lymphocytes using an anti-human T cell (CD3) antiserum. Vet. Immunol. Immunopathol. 51, 353–363. Borroto, A., Mallabiabarrena, A., Albar, J.P., Martinez-A, C., Alarcon, B., 1998. Characterization of the region involved in CD3 pairwise interactions within the T cell receptor complex. J. Biol. Chem. 273, 12807–12816. Borroto, A., Arellano, I., Blanco, R., Fuentes, M., Orfao, A., Dopfer, E.P., Prouza, M., Suchanek, M., Schamel, W.W., Alarcon, B., 2014. Relevance of Nck–CD3 epsilon interaction for T cell activation in vivo. J. Immunol. 192, 2042–2053. Call, M.E., Wucherpfennig, K.W., 2004. Molecular mechanisms for the assembly of the T cell receptor–CD3 complex. Mol. Immunol. 40, 1295–1305. Clevers, H., Dunlap, S., Saito, H., Georgopoulos, K., Wileman, T., Terhorst, C., 1988. Characterization and expression of the murine CD3-epsilon gene. Proc. Natl. Acad. Sci. U. S. A. 85, 8623–8627. Cook, M.T., Morrison, R.N., Wilkinson, R., Nowak, B.F., Hayball, P.J., Hayball, J.D., 2001. A screen of mammalian antibodies on snapper (Pagrus auratus, Sparidae) peripheral blood leukocytes reveals cross reactivity of an anti-human CD3 antibody with a population of mIg(−) cells. Dev. Comp. Immunol. 25, 553–559. Dave, V.P., Cao, Z., Browne, C., Alarcon, B., Fernandez-Miguel, G., Lafaille, J., de la Hera, A., Tonegawa, S., Kappes, D.J., 1997. CD3 delta deficiency arrests development of the alpha beta but not the gamma delta T cell lineage. EMBO J. 16, 1360–1370. de la Cruz, J., Kruger, T., Parks, C.A., Silge, R.L., van Oers, N.S., Luescher, I.F., Schrum, A.G., Gil, D., 2011. Basal and antigen-induced exposure of the proline-rich sequence in CD3epsilon. J. Immunol. 186, 2282–2290.

X. Zhang et al. / Gene 564 (2015) 160–167 Deford-Watts, L.M., Tassin, T.C., Becker, A.M., Medeiros, J.J., Albanesi, J.P., Love, P.E., Wulfing, C., van Oers, N.S., 2009. The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J. Immunol. 183, 1055–1064. Dzialo, R.C., Cooper, M.D., 1997. An amphibian CD3 homologue of the mammalian CD3 gamma and delta genes. Eur. J. Immunol. 27, 1640–1647. Gebhard, D.H., Carter, P.B., 1992. Identification of canine T-lymphocyte subsets with monoclonal antibodies. Vet. Immunol. Immunopathol. 33, 187–199. Gobel, T.W., Fluri, M., 1997. Identification and analysis of the chicken CD3epsilon gene. Eur. J. Immunol. 27, 194–198. Gold, D.P., Puck, J.M., Pettey, C.L., Cho, M., Coligan, J., Woody, J.N., Terhorst, C., 1986. Isolation of cDNA clones encoding the 20K non-glycosylated polypeptide chain of the human T-cell receptor/T3 complex. Nature 321, 431–434. Gouet, P., Courcelle, E., Stuart, D.I., Metoz, F., 1999. ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics 15, 305–308. Hagens, G., Galley, Y., Glaser, I., Davis, W.C., Baldwin, C.L., Clevers, H., Dobbelaere, D.A., 1996. Cloning, sequencing and expression of the bovine CD3 epsilon and TCR-zeta chains, two invariant components of the T-cell receptor complex. Gene 169, 165–171. Hein, W.R., Tunnacliffe, A., 1993. Invariant components of the sheep T-cell antigen receptor: cloning of the CD3 epsilon and Tcr zeta chains. Immunogenetics 37, 279–284. Huppa, J.B., Ploegh, H.L., 1997. In vitro translation and assembly of a complete T cell receptor–CD3 complex. J. Exp. Med. 186, 393–403. Isakov, N., Wange, R.L., Burgess, W.H., Watts, J.D., Aebersold, R., Samelson, L.E., 1995. ZAP70 binding specificity to T cell receptor tyrosine-based activation motifs: the tandem SH2 domains of ZAP-70 bind distinct tyrosine-based activation motifs with varying affinity. J. Exp. Med. 181, 375–380. Jones, M., Cordell, J.L., Beyers, A.D., Tse, A.G., Mason, D.Y., 1993. Detection of T and B cells in many animal species using cross-reactive anti-peptide antibodies. J. Immunol. 150, 5429–5435. Keresztes, G., Glavits, R., Krenacs, L., Kurucz, E., Ando, I., 1996. An anti-CD3 epsilon serum detects T lymphocytes in paraffin-embedded pathological tissues in many animal species. Immunol. Lett. 50, 167–172. Klausner, R.D., Lippincott-Schwartz, J., Bonifacino, J.S., 1990. The T cell antigen receptor: insights into organelle biology. Annu. Rev. Cell Biol. 6, 403–431. Kothlow, S., Mannes, N.K., Schaerer, B., Rebeski, D.E., Kaspers, B., Schultz, U., 2005. Characterization of duck leucocytes by monoclonal antibodies. Dev. Comp. Immunol. 29, 733–748. Kuhns, M.S., Davis, M.M., Garcia, K.C., 2006. Deconstructing the form and function of the TCR/CD3 complex. Immunity 24, 133–139. Lalor, P.A., Morrison, W.I., Goddeeris, B.M., Jack, R.M., Black, S.J., 1986. Monoclonal antibodies identify phenotypically and functionally distinct cell types in the bovine lymphoid system. Vet. Immunol. Immunopathol. 13, 121–140. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. Love, P.E., Hayes, S.M., 2010. ITAM-mediated signaling by the T-cell antigen receptor. Cold Spring Harb. Perspect. Biol. 2, a2485.

167

Maisey, K., Toro-Ascuy, D., Montero, R., Reyes-Lopez, F.E., Imarai, M., 2011. Identification of CD3epsilon, CD4, CD8beta splice variants of Atlantic salmon. Fish Shellfish Immunol. 31, 815–822. Mallabiabarrena, A., Fresno, M., Alarcon, B., 1992. An endoplasmic reticulum retention signal in the CD3 epsilon chain of the T-cell receptor. Nature 357, 593–596. Mason, D.Y., Cordell, J., Brown, M., Pallesen, G., Ralfkiaer, E., Rothbard, J., Crumpton, M., Gatter, K.C., 1989. Detection of T cells in paraffin wax embedded tissue using antibodies against a peptide sequence from the CD3 antigen. J. Clin. Pathol. 42, 1194–1200. Nash, R.A., Scherf, U., Storb, R., 1991. Molecular cloning of the CD3 epsilon subunit of the T-cell receptor/CD3 complex in dog. Immunogenetics 33, 396–398. Nishimura, Y., Miyazawa, T., Ikeda, Y., Izumiya, Y., Nakamura, K., Cai, J.S., Sato, E., Kohmoto, M., Mikami, T., 1998. Molecular cloning and expression of feline CD3epsilon. Vet. Immunol. Immunopathol. 65, 43–50. Overgard, A.C., Hordvik, I., Nerland, A.H., Eikeland, G., Patel, S., 2009. Cloning and expression analysis of Atlantic halibut (Hippoglossus hippoglossus) CD3 genes. Fish Shellfish Immunol. 27, 707–713. Park, C.I., Hirono, I., Enomoto, J., Nam, B.H., Aoki, T., 2001. Cloning of Japanese flounder Paralichthys olivaceus CD3 cDNA and gene, and analysis of its expression. Immunogenetics 53, 130–135. Schamel, W.W., Risueno, R.M., Minguet, S., Ortiz, A.R., Alarcon, B., 2006. A conformationand avidity-based proofreading mechanism for the TCR–CD3 complex. Trends Immunol. 27, 176–182. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Thomassen, E.A., Dekking, E.H., Thompson, A., Franken, K.L., Sanal, O., Abrahams, J.P., van Tol, M.J., Koning, F., 2006. The impact of single amino acid substitutions in CD3gamma on the CD3epsilon gamma interaction and T-cell receptor–CD3 complex formation. Hum. Immunol. 67, 579–588. Wange, R.L., Samelson, L.E., 1996. Complex complexes: signaling at the TCR. Immunity 5, 197–205. Wei, S., Liu, X., Gao, M., Zhang, W., Zhu, Y., Ma, B., Wang, J., 2014. Cloning and characterization of goose interleukin-17A cDNA. Res. Vet. Sci. 96, 118–123. Weiss, A., Littman, D.R., 1994. Signal transduction by lymphocyte antigen receptors. Cell 76, 263–274. Wilkinson, J.M., Galea-Lauri, J., Sellars, R.A., Boniface, C., 1992. Identification and tissue distribution of rabbit leucocyte antigens recognized by monoclonal antibodies. Immunology 76, 625–630. Wilkinson, R., Barton, M., Kotlarski, I., 1995. Identification of koala T lymphocytes using an anti-human CD3 antibody. Dev. Comp. Immunol. 19, 537–545. Xu, C., Gagnon, E., Call, M.E., Schnell, J.R., Schwieters, C.D., Carman, C.V., Chou, J.J., Wucherpfennig, K.W., 2008. Regulation of T cell receptor activation by dynamic membrane binding of the CD3epsilon cytoplasmic tyrosine-based motif. Cell 135, 702–713.