Seasonal changes in the expression of the androgen receptor in the testes of the domestic goose (Anser anser f. domestica)

General and Comparative Endocrinology 179 (2012) 63–70

Contents lists available at SciVerse ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Seasonal changes in the expression of the androgen receptor in the testes of the domestic goose (Anser anser f. domestica) A. Leska ⇑, J. Kiezun, B. Kaminska, L. Dusza Department of Animal Physiology, University of Warmia and Mazury in Olsztyn, Oczapowskiego 1A, 10-719 Olsztyn, Poland

a r t i c l e

i n f o

Article history: Received 24 April 2012 Revised 23 July 2012 Accepted 26 July 2012 Available online 3 August 2012 Keywords: Androgen receptor Testosterone Testis Breeding season Male domestic goose

a b s t r a c t It is generally acknowledged that seasonal fluctuations in the morphology and function of bird testes are primarily regulated by seasonal changes in circulating concentrations of testosterone (T) which mediates its action via the androgen receptor (AR). However, it has not yet been elucidated whether gonadal sensitivity to androgens also varies across the bird reproductive cycle. In order to answer the above question, this study makes the first ever attempt to account for the gonadal expression of the AR gene and protein in relation to circulating and testicular T concentrations in the gonads of male birds during the reproductive cycle. The experimental model used in this study was the domestic goose, Anser anser f. domestica, a species with three distinct phases of the annual reproductive cycle: the breeding season in March, the non-breeding season in July and the sexual reactivation phase in November. The plasma and testicular T concentrations were highest in the breeding season, followed by a dramatic decline in the non-breeding season with a successive rise in the sexual reactivation phase. Interestingly, we observed the divergent effect of season on AR mRNA and protein expression. Whereas the AR gene expression showed a nearly inverse relationship with T levels, the seasonal variations in AR protein levels primarily reflected the differences in T concentrations. The results of our study also indicated that regardless of the examined phase of the season, an abundance of AR protein was found only in the nuclei of Leydig and Sertoli cells and myoid cells. The above supports the observation that somatic cells are the targets for androgen action in bird testes. Summarizing, this study revealed that seasonal variations in sensitivity to androgens in the gonads of male birds are reflected in variations in the availability of their cognate receptors. Furthermore, a different pattern of seasonal expression of the AR gene and protein suggests that the AR system is subject to complex regulation that includes both steroid-dependent and steroid-independent factors. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Seasonal reproduction in birds is regulated mainly by photoperiod. Increasing day length triggers the hypothalamo-pituitary– gonadal axis, leading to gonadal maturation and the onset of breeding season. The loss of hypothalamic sensitivity to light causes cessation of the seasonal signal transduction cascade which leads to gonadal regression coincident with the non-breeding season. Hypothalamic sensitivity to light is recovered under prolonged exposure to short days and in the majority of birds, it eventually occurs as day length increases [6,22,37]. Despite a short photoperiod, in some male birds, including the domestic goose, the genetically encoded restoration of reproductive axis activity is efficient enough to evoke

Abbreviations: T, testosterone; AR, androgen receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RIA, radioimmunoassay. ⇑ Corresponding author. Present address: Department of Zoology, University of Warmia and Mazury in Olsztyn, Oczapowskiego 5, 10-719 Olsztyn, Poland. Fax: +48 89 523 36 01. E-mail address: [email protected] (A. Leska). 0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2012.07.026

a moderate autumnal rise in testosterone (T) concentrations which promotes gradual development of gonads and manifestations of sexual activity [15,16,33,37]. Testosterone, the key male gonadal androgen, plays a highly significant role in the hormonal game, aiding in the transition between the phase of reproductive activity to gonadal regression and gonadal recrudescence [12]. Seasonal variations in circulating T levels are correlated with the reproductive status of male birds [12,40]. Testosterone sustains testes function, promotes the development of secondary sex characteristics, enhances displays of male bird reproductive behavior such as the territoriality and aggression, courtship rituals, and contributes to mating success [12,45]. The male sexual function is also determined by local concentrations of gonadal T. High levels of intratesticular T are needed to initiate and support spermatogenesis and to inhibit germ cell apoptosis. Testosterone delivers a broad range of physiological effects by binding to the intracellular androgen receptor (AR) which act as a hormone-inducible transcription factor modulating the expression of target genes [3,27]. The androgenic response is thus limited by the availability of ARs which is determined by numerous factors, including seasonal regulation.

64

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70

Most studies investigating seasonal fluctuations in AR expression in birds have observed this dependency in songbird species. In the majority of examined species, the AR gene or protein content changes throughout the season in different regions of the brain, including the vocal control system and structures involved in creation of sexual behavior [2,5,10,11,39]. Generally, the highest AR abundance was correlated with peaking T level during the breeding season, but an inverse correlation with T or lack of correlation between AR and its ligand also has been observed [5,10,29]. The results of published studies indicate that AR regulation is determined by the physiological status of the bird, and that it is species- and tissue-specific. Interestingly, there is a general lack of information about AR regulation in the gonads of male birds. The AR mRNA [29] and protein expression [8,13,30,36] has been demonstrated in avian testes. Androgen receptor mRNA gonadal levels fluctuated across the reproductive cycle of songbirds, and AR protein levels changed throughout the lifespan of domesticated birds [13,29]. It remains unknown whether the sensitivity to androgens varies seasonally in the gonads of male birds and if so, what are the possible mechanisms of AR gonadal regulation by its cognate ligand. The objective of this study was to describe the seasonal expression of the AR gene and protein in the testes of seasonally breeding bird. Furthermore, our aim was also to determine whether the localization of the AR protein in various testis compartments changes throughout the season. The results of AR expression will be analyzed in view of the levels of gonadal and circulating T to provide new insights into the seasonal regulation of target cell responsiveness to androgen in bird testes. The study was performed on the domestic goose, a species characterized by three distinct phases of the annual reproductive cycle where the peak of the breeding season is observed in March, the non-breeding season starts in July and the sexual reactivation phase begins in November [33]. 2. Materials and methods 2.1. Experimental animals and tissue collection The research was performed on one-year-old male domestic White KoludaÒ geese (Anser anser f. domestica). The birds were kept under standard feeding and lighting conditions on a breeding farm, under exposure to 10L:14D cycles during the reproductive period and to natural day length (53° 960 N, 20° 410 E) outside the breeding season. Blood and testis samples were collected during the three characteristic periods of the reproductive cycle in geese: at the peak of the breeding season (March), during the non-breeding season (July) and in the sexual reactivation phase (November). Tissue samples were collected in view of the requirements of every analytical method deployed in the study. Birds were immobilized and blood sampling for a steroid hormone assay was performed by trained staff from the brachial vein using heparinized tubes. Next, animals were killed by cervical dislocation and exsanguinated. Testis samples for a steroid hormone assay, total RNA isolation and the Western blot were frozen directly after harvesting in liquid nitrogen and kept at 80 °C for further processing. Testes for immunohistochemical and histological analyses were obtained from birds anesthetized with sodium thiopental (10 mg/100 g BW) and perfused intracardially with 4% paraformaldehyde in 0.1 M PBS. All experiments were conducted in accordance with the principles of Animal Ethics Committee at the University of Warmia and Mazury in Olsztyn, Poland. 2.2. Steroid hormone assay Testosterone concentrations in plasma and testis homogenate (n = 10 in each period) were determined by RIA. The anti-T

antibody was characterized elsewhere [41]. RIA procedure for T estimation in gander plasma was previously validated [31]. The method for T measurement in gander tissue was based on Kaminska et al. [18]. Briefly, steroids from plasma and homogenate containing 100 mg of testicular tissue were extracted using ethyl ether. After phase separation at 20 °C, the lipophilic phase was evaporated, dry extract was reconstituted in 100 ll of RIA buffer, and the samples were subjected to the RIA procedure. All analyses were performed in triplicates. The intra-assay coefficient of variation was 3.62%, and assay sensitivity was determined at 1 pg per tube. The raw hormone concentrations data were log transformed and then statistically analyzed. The results were expressed in terms of pg of T per mL of plasma, ng of T per whole testis weight as well as ng of T per 100 mg of testicular tissue. 2.3. Testis histology The testes (n = 6 in each period) were dissected, weighed, postfixed in 4% paraformaldehyde for 24 h, dehydrated in an increasing ethanol series, embedded in paraffin and cut into 7 lm thick sections. The sections were deparaffinized in xylene, rehydrated in ethanol, washed in PBS and processed for standard hematoxylineosin staining. The histological images of testicular tissue (18 images per specimen) were captured at 125 magnification under the BX51 light microscope connected to a DP72 digital camera (Olympus, Japan). The archived images were analyzed morphometrically with the use of cell D Soft Imaging System (Olympus). The internal diameter of seminiferous tubules, the thickness of the germinative epithelium (without tunica propria) as well as the area of seminiferous tubule and interstitial tissue were measured in every image. The relative area (%) of the interstitial tissue defined as the ratio of area occupied by the interstitium to the total area (interstitial and tubular area) within the archived view field under 125 magnification was calculated for every individual. Data of relative area expressed as a percentage were arcsin transformed before the statistical analysis. 2.4. Total RNA isolation and cDNA synthesis Total RNA from testes (n = 6 in each period) was extracted using the Absolutely RNA Miniprep Kit (Stratagene, USA) with a DNase treatment step included. The concentration and purity of RNA were determined spectrophotometrically (NanoDrop ND-1000, NanoDrop Technologies Inc., USA), and RNA integrity was confirmed electrophoretically. First strand cDNA was synthetised with 1 lg of total RNA using the Omniscript RT Kit (Qiagen, USA) in a total volume of 20 ll with 0.1 lM oligo(dT)15 primer (Roche, Germany), 0.1 lM random nanomer (dNT)9 (GenPandora, Poland), 10 U RNase OUT™ recombinant ribonuclease inhibitor (Invitrogen, USA), 4 U reverse transcriptase and RNase/DNase free water. The reverse transcription reaction was carried out at 37 °C for one hour and was terminated by incubation at 93 °C for five minutes (GeneAmp PCR System 2400, Perkin Elmer, USA). 2.5. Quantitative real-time PCR Since the goose AR sequence has been still unknown, specific real-time PCR primers for AR were based on the chicken (Gallus gallus domesticus) sequence. Primer sequences were designed with the use of Primer Express software (Applied Biosystems, USA) to correspond to the highly conserved region of avian AR and to flank two exons of the AR gene. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA levels did not vary across experimental groups (data not shown) and were used to normalize data of AR expression. The primers for the reference house-keeping gene GAPDH, were selected based on Li et al. [23]. Detailed information on

65

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70 Table 1 Oligonucleotide primers used for real-time PCR. Gene

Primer

GeneBank accession no.

Product size (bp)

AR GAPDH

forward AGGAGTTTGGGTGGCTTCAGA reverse GCTGGTAAAACCGCCTAGAGC forward GGTGGTGCTAAGCGTGTTA reverse CCCTCCACAATGCCAA

NM_001040090 X01578

201 179

Abbreviations: AR, androgen receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

the primers used in the study is listed in Table 1. The standard curves with serial dilutions of the cDNA pooled from all experimental conditions were run for both AR and GAPDH genes. The real-time PCR reaction was optimized for cDNA and every gene primers concentration to achieve optimal reaction efficiency which finally reached values of E = 93% and E = 96% for AR and GAPDH, respectively. The linear correlation (R2) between the mean Ct and log cDNA dilution was >0.99 in each case. Real-time PCR reaction consisted of: 1 ll of each cDNA diluted 1:10, 0.5 lM AR or GAPDH primers, 12.5 ll Power Sybr Green PCR Master Mix (Applied Biosystems, USA) and RNase free water to a total volume of 25 ll. All samples were run in duplicates in the 7300 PCR System (Applied Biosystems, USA). The PCR reaction conditions were as follows: initial denaturation and enzyme activation at 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min. Non-template control and negative control without the reverse transcriptase were included in each run. Reaction specificity was verified by the melting-curve analysis, electrophoresis and sequencing which indicated high homology (over 90%) between the sequence of the PCR-amplified DNA and the Gallus gallus sequence to which primers were designed. The relative AR mRNA expression level was calculated by the comparative cycle threshold (Ct) method [24], normalized by GAPDH expression level and expressed as arbitrary units. 2.6. Immunohistochemistry and Western blot Testis sections (see 2.3.) were microwaved for 20 min in 0.01 M citrate buffer, pH = 6, to retrieve the antigens. Tissue sections were cooled to room temperature, washed in PBS, treated with 3% hydrogen peroxidase in methanol, and the non-specific binding of avidin and biotin was blocked (Vector Laboratories, USA). The sections were treated with 10% normal porcine serum (10 min, RT) and incubated with a rabbit polyclonal anti-rat antibody against AR (overnight, 4 °C, diluted 1:400 in PBS; Ab-2; RB-1358, Thermo Scientific, USA) which specificity for avian tissue was previously determined [30]. After that, tissue sections were throughly rinsed in PBS and incubated with a swine anti-rabbit biotynylated secondary antibody (2 h, RT, diluted 1:300 in PBS; DAKO, USA). Then, tissue sections were treated with avidin biotin peroxidase conjugate (50 min, RT, diluted 1:100 in PBS; Vectastain ABC kit, Vector Laboratories, USA). 3.30 -diaminobenzidine (DAB, DAKO, Denmark) solution was used for immunodetection, the reaction was monitored under a microscope, and it was stopped by immersion in deionized water as soon as brown color staining was visualized. Finally, the sections were dehydrated in ethanol, cleared in xylene and mounted. The specificity of immunohistochemical staining was checked by omitting the primary antibody or by replacing it with the same dilution of rabbit serum and by preabsorbing the primary antibody with an excess of synthetic antigen (AR blocking peptide, PP-1358, Thermo Scientific, USA). The specificity of the primary antibody, which was applied to gander tissue for the first time, was tested by Western blot. Total protein from the testicular lysate (10 lg) was electrophoretically separated (8% SDS–PAGE) and transferred to a nitrocellulose membrane by semi-dry electroblotting (Hoefer SemiPhor apparatus, Pharmacia Biotech., USA). After washing, the non-specific binding

was blocked in 5% skimmed milk powder (5 h, 4 °C). Blot incubation with a primary Ab-2 antibody and a biotynylated secondary antibody was performed under conditions identical to immunohistochemistry (as described above). Finally, the signal was developed by blot incubation with avidin biotin peroxidase conjugate, followed by the DAB method (as described above). The size of the immunolabelled protein band was determined by comparison with a protein molecular weight marker. 2.6.1. Image processing Androgen receptor immunostaining was performed in triplicates for every specimen, and images of six different areas precisely defined on the coverslip were recorded, producing a total of 18 images per specimen. The images were subjected to semiquantitative analysis. Preliminary analyses of a representative sample of images revealed that the parameter defining staining intensity did not differ between the examined stages, therefore, the assessed parameter was the immunoreactive area. The immunoreactive area (%) was calculated as the ratio of the area occupied by the AR immunopositive cells of seminiferous tubules to the total area occupied by seminiferous tubules within the archived viewfield under 500 magnification. The same procedure was applied to determine the immunoreactive area in interstitial tissue. The level of AR immunoreactivity was measured by computer-assisted image analysis software cell D Soft Imaging System (Olympus, Japan). Quantitative analysis was performed using an automatic threshold function to select a range of grey values that were optically identified as positive staining. Percentage data were arcsin transformed before statistical analysis. 2.7. Statistical analyses The effect of season on T concentrations, morphometric parameters and AR mRNA expression levels in the gander testes was analyzed by one-way ANOVA followed by a post hoc Least Significant Difference (LSD) test. The influence of season and testicular compartment (interstitial tissue and seminiferous tubule) on AR protein expression was estimated by two-way ANOVA and a post hoc LSD test. Seasonal fluctuations in the level of AR protein expression in each testicular compartment were additionally compared by the t-test. All statistical analyses were performed using the Statistica program (StatSoft Inc., USA). The results were expressed as means of groups ± SEM. Differences were considered statistically different at the level of p < 0.05.

3. Results 3.1. The effect of season on steroid hormone concentrations The influence of season on plasma and testicular T concentrations was statistically demonstrated (p < 0.05). Plasma and gonadal T concentrations showed a similar pattern of seasonal variation with the highest values in the breeding season, a dramatic decline in the non-breeding season, followed by a significant increase in the sexual reactivation phase (p < 0.05; Fig. 1). Plasma T levels (mean ± SEM) reached 648.2 ± 84.5 pg/mL in the breeding season,

66

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70

1000

TESTOSTERONE (pg/mL)

800

B a

600

400 c

TESTOSTERONE (ng/whole testis weight)

A

500

a

400

300

200 c

100

200 b

b

0

0

breeding

non-breeding

sexual reactivation

breeding

non-breeding

sexual reactivation

Fig. 1. Testosterone concentrations (mean ± SEM) in plasma (pg/ml, A) and in testis homogenate (ng/whole testis weight, B) of ganders at three different stages of the reproductive cycle (n = 10 in each period). Bars with different superscripts are significantly different (p < 0.05).

53.6 ± 7.7 pg/mL in the non-breeding season and 160.3 ± 43.2 pg/ mL in the sexual reactivation phase (Fig. 1A). The local concentrations of gonadal T were several orders of magnitude higher than plasma T levels, and beginning with the breeding season followed by successive stages of the reproductive cycle, T concentrations were determined at 372.4 ± 97.8 ng/whole testis weight, 1.09 ± 0.2 ng/whole testis weight and 78.6 ± 33.6 ng/whole testis weight (Fig. 1B). Testosterone profile per fixed tissue weight depicted different seasonal variations with the highest values in sexual reactivation phase (29,6 ± 7,1 ng/100 mg testis), the lowest in non-breeding phase (0,4 ± 0,1 ng/100 mg testis) and intermediate in the breeding season (6,5 ± 1,1 ng/100 mg testis).

3.2. The effect of season on testis histology and morphometry Seasonal changes were observed in the histology and morphometry of the testes in every stage of the reproductive cycle. Testes sampled during the breeding season were formed by numerous convoluted seminiferous tubules with multilayered epithelium composed of germ and Sertoli cells surrounded by scarce interstitial tissue of Leydig, myoid and fibroblast cells as well as blood vessels (Fig. 2A, A1). Fully active gonads were characterized by maximum weight and the highest values of morphometric parameters, including the area and diameter of the seminiferous tubule and the thickness of seminiferous epithelium (Table 2).

Fig. 2. Histological representative sections of gander testes at three different stages of the reproductive cycle: breeding (A, seminiferous tubule, A1, interstitial tissue), nonbreeding (B, seminiferous tubule with surrounding interstitial tissue) and the sexual reactivation phase (C, seminiferous tubule with surrounding interstitial tissue). Abbreviations: bv, blood vessel; f, fibroblast cell; gc, multinucleated giant cell; L, Leydig cell; m, myoid cell; s, spermatozoa; sg, spermatogonium; so, oval spermatid; sr, round spermatid; sp, spermatocytes; St, Sertoli cell.

67

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70 Table 2 Morphometric parameters (mean ± SEM) of gander testes at three different stages of the reproductive cycle (n = 6 in each season). Morphometric parameters

Breeding

Non-breeding a

Testis weight (g) Area of seminiferous tubule (mm2) Thickness of germinative epithelium (mm) Diameter of seminiferous tubule (mm) Relative area of interstitial tissue

Sexual reactivation

b

12.3 ± 1.51 0.109 ± 0.006a 0.102 ± 0.008a 0.366 ± 0.011a 0.17a

1.67 ± 0.83b 0.023 ± 0.012a 0.05 ± 0.009a 0.148 ± 0.035a 1.68b

0.48 ± 0.16 0.014 ± 0.001a 0.04 ± 0.003a 0.127 ± 0.005a 1.8b

Means with different superscripts are significantly different (p < 0.05).

8

RELATIVE AR mRNA EXPRESSION (arbitrary units)

b

6

b

4

2 a

0

breeding

non-breeding

sexual reactivation

Fig. 3. The relative androgen receptor (AR) mRNA expression (mean ± SEM) determined by quantitative real-time PCR in gander testes at three different stages of the reproductive cycle (n = 6 in each period). The level of AR expression was normalized by the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Bars with different superscripts are significantly different (p < 0.05).

(A)

The relative area of the interstitial tissue reached minimal values during the breeding season. Testes sampled during the nonbreeding season and in the sexual reactivation phase revealed involution of germinal epithelium into a simple layer of spermatogonia and Sertoli cells interconnected by degenerative germ cells forming multinucleated giant cells. (Fig. 2B and C). The thin tubular lumen was often occluded by groups of degenerating germ cells. Histological observations were reflected in the results of morphometric analysis (Table 2). A reduction in the volume of seminiferous tubules was reflected in an increase in the ratio of interstitial to tubular area at the quiescent phase and the reactivation phase (Table 2).

(A1)

3.3. The effect of season on AR mRNA expression Androgen receptor mRNA expression in gander testes were significantly influenced by season (p < 0.05). The relative AR mRNA expression was approximately threefold lower in the breeding

(B) bv

(C)

m

(a)

(b)

(c)

(d) M

T

100kDa

Fig. 4. The androgen receptor (AR) immunolocalization in representative sections of gander testes at three different stages of the reproductive cycle: breeding (A and A1), non-breeding (B) and the sexual reactivation phase (C). AR was localized in Sertoli cells (arrows) within the seminiferous tubules and in the Leydig cells (arrowheads) within the interstitial tissue throughout the season. Negative controls of immunostaining represent: breeding (a), non-breeding (b) and the sexual reactivation phase (c). The specificity of primary antibody used for AR immunolocalization was confirmed by Western blot in gander testes (d, M: molecular marker, T: testis). The antibody to AR detected a protein band with the expected molecular weight of approximately 100 kDa (arrowhead). Abbreviations: bv, blood vessel; m, myoid cell.

68

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70

6

(B)

4

2

a c b

0

AR IMMUNOREACTIVE AREA (%)

AR IMMUNOREACTIVE AREA (%)

(A)

6 a

a

4

2 b

0

breeding

non-breeding

sexual reactivation

breeding

non-breeding

sexual reactivation

Fig. 5. The androgen receptor (AR) expression (mean ± SEM) determined by quantitative immunohistochemistry in seminiferous tubules (A) and interstitial tissue (B) of gander testes at three different stages of the reproductive cycle (n = 6 in each season). Bars with different superscripts are significantly different (p < 0.05).

season than in the non-breeding season and the sexual reactivation phase (p < 0.05; Fig. 3). 3.4. The effect of season on AR protein expression 3.4.1. Androgen receptor localization in the testis Androgen receptor protein expression in the testis was confined to the nuclei of somatic cells regardless of the season. The AR immunoreactivity was observed in Sertoli and Leydig cells (Fig. 4A–C). A positive reaction was also reported in selected vascular walls and myoid cells (Fig. 4A1 and C, respectively). The specificity of the antibody against gander AR was confirmed by Western blotting. The AR primary antibody recognized a single protein band with molecular weight of approximately 100 kDa, and the above findings are consistent with the data previously described for avian species [30] (Fig. 4d). Negative controls showed no immunostaining (Fig. 4a–c). 3.4.2. Immunoreactive content of AR The effect of season on AR protein expression was observed in both compartments of gander testes (p < 0.05). The AR protein levels showed similar patterns of seasonal expression in the seminiferous tubule and interstitial tissue. The high AR protein expression level was noted in the breeding season with a decline in the nonbreeding season, followed by a significant increase in the sexual reactivation phase (Fig. 5A and B). The levels of AR immunoreactivity in the interstitium were higher than in seminiferous tubule in each examined period (p < 0.05, data not presented). 4. Discussion and conclusions To our knowledge, present study is the first report which revealed evidence for variations in plasma and testicular T concentrations accompanied by changes in AR gene and protein expression in the gonads of male birds during the reproductive cycle. The observed seasonal T profile confirmed the birds’ reproductive status, and it fully justifies the choice of stages of the annual reproductive cycle examined in this study. The reported pattern of seasonal changes in T levels between breeding and non-breeding phases is typical for geese [15,31,33,38] as well as for the majority of temperate-zone bird species [12,40]. The considerable autumnal steroidogenic activity of the gonad entails a significant rise in plasma T concentration what proves that White KoludaÒ geese undergo a sexual reactivation phase similarly to the phenomenon described in Hungarian domestic geese [15,16,33] and other Anseriformes species [14]. The second seasonal T peak, observed as early

as in the mid-autumn, points to an endocrine basis and heightened sexual and social responsiveness in preparation for the following spring reproductive period [33]. Histological and morphometric analyses revealed that gander testes undergo marked structural seasonal changes as it has been described in Bilgoraj goose (Anser anser) and Canadian goose (Branta canadensis) [28,31,32] and other bird species [1,20,25,42]. Interestingly, structural changes in testicular tissue in the sexual reactivation phase remain weakly researched, especially in geese. In Hungarian domestic geese a moderate autumnal increase in gonadal development was described, but the above findings were not backed by morphometric and statistical analyses [33]. Similarly, the autumnal recovery of germinative epithelium was also noted in galliform species [1,20]. The absence of a clear seasonal influence on the morphometric parameters of gander testes in the sexual reactivation phase in our study, despite the resumption of endocrine function in the testes, could be attributed to high interspecies variability in the results of morphometric analysis. This could be partially explained by genetic differences between individuals in response to an intensive breeding regime what could be the basis for a lack of synchronicity in entering the gonadal recrudescence phase. This study demonstrated for the first time the expression of the AR gene and protein in the testes during the reproductive cycle of a bird species. The AR was shown to possess a nuclear localization in testicular cells in each examined period, and the cellular distribution of AR was found to be restricted to somatic cells of the gonad, namely Sertoli and Leydig cells, as well as myoid cells. The somatic testicular localization of AR protein is in agreement with the results of studies investigating other bird species, including the chicken, the mallard (Anas platyrhynchos) and the canary (Serinus canaria) [8,13,29,30,36]. In the light of existing evidence that somatic cells are the target for androgen action in bird testes, the androgenic regulation of spermatogenesis seems to be exerted by indirect androgen influence on Sertoli cells and via an autocrine feedback mechanism acting on Leydig cells. The results of our study point to a dynamic and seasonal nature of AR gene expression in gander testes. Testicular AR mRNA levels increased during the transition from the breeding to the nonbreeding phase, and it remained at similar level in the sexual reactivation phase. The seasonal variations in AR gene expression in bird testes have been previously explored only by a single paper reported opposite results [29]. Interestingly, analyses of central AR expression in birds indicated higher AR mRNA level in the breeding than in non-breeding season [5,9,11,44], differentiated AR mRNA level depending on specific brain areas [5] or lack of any seasonal fluctuations in AR gene expression [10]. In view of the above, it seems that the complex regulatory mechanisms,

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70

including species- and tissue-dependent manner, are responsible for controlling AR gene expression. It should also be noted that mRNA levels are determined by the balance between gene transcription and mRNA degradation which is often evolutionarily encoded in an opposite pattern [7]. It cannot be ruled out that the observed in our study low rate of active transcription may be compensated by high mRNA stability in the breeding season, and an inverse relationship could be characteristic of the non-breeding season. Furthermore, the AR gene could be subjected to translational control, therefore, high values of AR mRNA copies could be partially included in translationally inactive messenger RNAs [47]. Our study demonstrated also the seasonal pattern of AR protein expression which reached high levels in the breeding and sexual reactivation phases with an intermittent decline in the non-breeding phase. The relation between season and AR protein expression in bird testes still remains explored. Our findings corroborate the results of previous studies focused on central AR seasonal protein expression in songbirds [9,10,21,39]. Moreover, there is growing evidence that photoperiod induces changes in AR protein levels in various organisms and tissues, including the testes of bank vole [4,43] and brushtail possum (Trichosurus vulpecula) [26], the brain of Syrian hamster (Mesocricetus auratus) and electric fish (Brachyhypopomus gauderio) [34,35]. The up-regulation of AR in the breeding season suggests tissue sensitization to hormonal action, whereas the down-regulation of AR in the non-breeding season points to the limitation of undesirable androgenic influence during that phase of the cycle [5]. On the other hand, the rise in AR protein expression level in the sexual reactivation phase seems to be an adaptation to intensify androgen action during autumnal gonadal recrudescence. The higher levels of AR protein expression observed in the interstitium than in seminiferous tubules regardless of season constitute further evidence that androgens play a predominant role in the differentiation and functioning of interstitial cells [43]. Changes in the AR expression levels during the reproductive cycle raise questions about the mechanism that underlies those fluctuations. It is generally acknowledged that androgens autoregulate their receptors affecting the stability, transcription and translation rates of AR mRNA as well as the translocation and stabilization of ARs [17,29]. In our study, relative AR gene expression formed an almost inverse relationship with the concentrations of circulating and gonadal T, but in contrast, seasonal variations in AR protein levels primarily reflected the fluctuations in T concentrations. The up- and down-regulation of AR by its cognate ligand may result from an adjustment of the number of receptors expressed according to the activating signal [17,34,39,44,46]. Interestingly, androgens can regulate their own receptors independently, both at transcriptional and translational levels [19]. The above might suggest the presence of a separate mechanism for controlling the seasonal expression of the AR gene and protein. The observed inverse pattern of AR gene and protein expression suggests that non-transcriptional regulatory mechanisms may be implicated in the seasonal control of AR level in gander testes. Therefore, seasonal regulation of AR content could be reflected by posttranscriptional and/or posttranslational modification of transcripts or protein [10]. The above mechanism could be a partial explanation of an absence of correlation between AR mRNA and the protein levels in breeding and non-breeding periods. Additionally, the existence of negative feedback by which i.e. high protein concentrations may suppress mRNA expression and elevated gene expression levels may inhibit posttranscriptional processes can not be excluded. However, the simultaneous rise in AR mRNA and protein expression levels in the sexual reactivation phase could also suggest that posttranscriptional regulation of AR varies on a seasonal basis [10]. The domestic goose proved to be an excellent model for examining season-dependent endocrine and molecular changes. The

69

observed seasonal variations in testicular AR expression may be one of the mechanism that underlies the androgenic effect. Nevertheless, further studies investigating the crosstalk between androgens and their receptors at higher levels of the reproductive axis are needed to further our understanding of complex phenomenon such as the seasonality in bird reproduction. Acknowledgments Authors wish to thank our colleague, Dr Marek Opalka for excellent technical assistance. This study was supported by The Ministry of Science and Higher Education in Poland (No. N N311 098034, UWM No. 522.0206.0805) and the European Social Fund for A.L. References [1] S.M. Artoni, A.M. Orsi, T.L. Lamano-Carvalho, R.A. Lopes, The annual testicular cycle of the domestic quail (Coturnix coturnix japonica), Anat. Histol. Embryol. 26 (1997) 337–339. [2] M.D. Belle, R.W. Lea, Androgen receptor immunolocalization in brains of courting and brooding male and female ring doves (Streptopelia risoria), Gen. Comp. Endocrinol. 124 (2001) 173–187. [3] N.C. Bennett, R.A. Gardiner, J.D. Hooper, D.W. Johnson, G.C. Gobe, Molecular cell biology of androgen receptor signaling, Int. J. Biochem. Cell Biol. 42 (2010) 813–827. [4] B. Bilin´ska, B. Schmalz-Fraczek, M. Kotula, S. Carreau, Photoperiod-dependent capability of androgen aromatization and the role of oestrogens in the bank vole testis visualized by means of immunohistochemistry, Mol. Cell. Endocrinol. 178 (2001) 189–198. [5] V. Canoine, L. Fusani, B. Schlinger, M. Hau, Low sex steroids, high steroid receptors: increasing the sensitivity of the nonreproductive brain, Dev. Neurobiol. 67 (2007) 57–67. [6] A. Dawson, V.M. King, G.E. Bentley, G.F. Ball, Photoperiodic control of seasonality in birds, J. Biol. Rhythms 16 (2001) 365–380. [7] M. Dori-Bachash, E. Shema, I. Tirosh, Coupled evolution of transcription and mRNA degradation, PLoS Biol. 9 (2011) 1–13. [8] R.A. Dornas, A.G. Oliveira, M.O. Dias, G.A. Mahecha, C.A. Oliveira, Comparative expression of androgen receptor in the testis and epididymal region of roosters (Gallus domesticus) and drakes (Anas platyrhynchos), Gen. Comp. Endocrinol. 155 (2008) 773–779. [9] G.S. Fraley, R.A. Steiner, K.L. Lent, E.A. Brenowitz, Seasonal changes in androgen receptor mRNA in the brain of the white-crowned sparrow, Gen. Comp. Endocrinol. 166 (2010) 66–71. [10] L. Fusani, T. Van’t Hof, J.B. Hutchison, M. Gahr, Seasonal expression of androgen receptors, estrogen receptors, and aromatase in the canary brain in relation to circulating androgens and estrogens, J. Neurobiol. 43 (2000) 254–268. [11] M. Gahr, R. Metzdorf, Distribution and dynamics in the expression of androgen and estrogen receptors in vocal control systems of songbirds, Brain Res. Bull. 44 (1997) 509–517. [12] L.Z. Garamszegi, M. Eens, S. Hurtrez-Boussès, A.P. Møller, Testosterone, testes size and mating success in birds: a comparative study, Horm. Behav. 47 (2005) 389–409. [13] M.G. González-Morán, C. Guerra-Araiza, M.G. Campos, I. Camacho-Arroyo, Histological and sex steroid hormone receptor changes in testes of immature, mature and aged chickens, Domest. Anim. Endocrinol. 35 (2008) 371–379. [14] E. Haase, P.J. Sharp, E. Paulke, Seasonal changes in the concentration of plasma gonadotropins and prolactin in wild mallard drakes, J. Exp. Zool. 234 (1985) 301–305. [15] K. Hirschenhauser, E. Möstl, K. Kotrschal, Seasonal patterns of sex steroids determined from feces in different social categories of Greylag geese (Anser anser), Gen. Comp. Endocrinol. 114 (1999) 67–79. [16] K. Hirschenhauser, E. Möstl, P. Péczely, B. Wallner, J. Dittami, K. Kotrschal, Seasonal relationship in plasma and fecal testosterone in response to GnRH in domestic ganders, Gen. Comp. Endocrinol. 118 (2000) 262–272. [17] D.G. Joakim Larsson, T.S. Sperry, P. Thomas, Regulation of androgen receptors in Atlantic croacker brains by testosterone and estradiol, Gen. Comp. Endocrinol. 128 (2002) 224–230. [18] B. Kaminska, M. Opalka, R. Ciereszko, L. Dusza, The involvement of prolactin in the regulation of adrenal cortex function in pigs, Domest. Anim. Endocrinol. 19 (2000) 147–157. [19] M.C. Kaushik, M.M. Misro, N. Sehgal, D. Nandan, Effect of chronic oestrogen administration on androgen receptor expression in reproductive organs and pituitary of adult male rat, Andrologia 42 (2010) 193–205. [20] I.S. Kim, H.H. Yang, Seasonal changes of testicular weight, sperm production, serum testosterone, and in vitro testosterone release in Korean ring-necked pheasant (Phasianus colchicus karpowi), J. Vet. Med. Sci. 63 (2001) 15–16. [21] R.W. Lea, J.A. Clark, K. Tsutsui, Changes in central steroid receptor expression, steroid synhtesis, and dopaminergic activity related to the reproductive cycle of the ring dove, Microsc. Res. Tech. 55 (2011) 12–26. [22] A. Leska, L. Dusza, Seasonal changes in the hypothalamo-pituitary-gonadal axis in birds, Reprod. Biol. 7 (2007) 99–126.

70

A. Leska et al. / General and Comparative Endocrinology 179 (2012) 63–70

[23] Y.P. Li, D.D. Bang, K.J. Handberg, P.H. Jorgensen, M.F. Zhang, Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus, Vet. Microbiol. 110 (2005) 155–165. [24] K.J. Livak, T.D. Schmittgen, Analysis of a relative gene expression data using real-time quantitative PCR and the 2-(Delta Delta C(T)) Method, Methods 25 (2001) 402–408. [25] I.A. Malecki, G.B. Martin, P.J. O’Malley, G.T. Meyer, R.T. Talbot, P.J. Sharp, Endocrine and testicular changes in a short-day seasonally breeding bird, the emu (Dromaius novaehollandiae), in southwestern Australia, Anim. Reprod. Sci. 53 (1998) 143–155. [26] H. Martyn, K. Pugazhenthi, M. Gould, J.W. Fink, B. McLeod, H.D. Nicholson, Seasonal changes in morphology and steroid receptor expression in the prostate of the brushtail possum (Trichosurus vulpecula): an animal model for the study of prostate growth?, Reprod Fertil. Dev. 23 (2011) 702–713. [27] T. Matsumoto, H. Shiina, H. Kawano, T. Sato, S. Kato, Androgen receptor functions in male and female physiology, J. Steroid Biochem. Mol. Biol. 109 (2008) 236–241. [28] J.G. Mori, J.C. George, Seasonal histological changes in the gonads, thyroid and adrenal of the Canada goose (Branta canadensis interior), Acta Anat. 101 (1978) 304–324. [29] K.L. Nastiuk, D.F. Clayton, Seasonal and tissue-specific regulation of canary androgen receptor messenger ribonucleic acid, Endocrinology 134 (1994) 640–649. [30] A.G. Oliveira, L.F. Telles, R.A. Hess, G.A. Mahecha, C.A. Oliveira, Effects of the herbicide roundup on the epididymal region of drakes Anas platyrhynchos, Reprod. Toxicol. 23 (2007) 182–191. [31] M. Opalka, J. Kugla-Owczarska, B. Kamin´ska, H. Puchajda-Skowron´ska, W. Hryniewiecka, L. Dusza, Effects of dietary meals containing different levels of phytoestrogens on reproductive function in Bilgoraj ganders, Acta Vet. Hung. 56 (2008) 379–391. [32] M. Opalka, B. Kaminska, M.K. Piskula, H. Puchajda-Skowronska, L. Dusza, Effects of phytoestrogens on testosterone secretion by Leydig cells from Bilgoraj ganders (Anser anser), Br. Poult. Sci. 47 (2006) 237–245. [33] P. Péczely, M.E. el Halawani, C.S. Hargitai, M. Mézes, V. Forgó, S.Z. Jánosi, The photorefractoriness in the domestic goose: effect of gonads and thyroid on the development of postbreeding prolactinemia, Acta Biol. Hung. 44 (1993) 329– 352. [34] P. Pouso, L. Quintana, C. Bolatto, A.C. Silva, Brain androgen receptor expression correlates with seasonal changes in the behavior of a weakly electric fish, Brachyhypopomus gauderio, Horm. Behav. 58 (2010) 729–736.

[35] G.S. Prins, A. Bartke, R.W. Steger, Influence of photoinhibition, photostimulation and prolactin on pituitary and hypothalamic nuclear androgen receptors in the male hamster, Neuroendocrinology 52 (1990) 511–516. [36] B.A. Shanbhag, P.J. Sharp, Immunocytochemical localization of androgen receptor in the comb, uropygial gland, testis, and epididymis in the domestic chicken, Gen. Comp. Endocrinol. 101 (1996) 76–82. [37] P.J. Sharp, Strategies in avian breeding cycle, Anim. Reprod. Sci. 42 (1996) 505– 513. [38] Z.D. Shi, Y.M. Huang, Z. Liu, Y. Liu, X.W. Li, J.A. Proudman, R.C. Yu, Seasonal and photoperiodic regulation of secretion of hormones associated with reproduction in Mangag goose ganders, Domest. Anim. Endocrinol. 32 (2007) 190–200. [39] K.K. Soma, V.N. Hartman, J.C. Wingfield, E.A. Brenowitz, Seasonal changes in androgen receptor immunoreactivity in the song nucleus HVc of a wild bird, J. Comp. Neurol. 409 (1999) 224–236. [40] K.K. Soma, Testosterone and aggression: berthold, birds and beyond, J. Neuroendocrinol. 18 (2006) 543–551. [41] B. Szafran´ska, A. Ziecik, S. Okrasa, Primary antisera against selected steroids or proteins and secondary antisera against c-globulins–an available tool for studies of reproductive processes, Reprod. Biol. 2 (2002) 187–204. [42] H.J. Tae, B.G. Jang, D.C. Ahn, E.Y. Choi, H.S. Kang, N.S. Kim, J.H. Lee, S.Y. Park, H.H. Yang, I.S. Kim, Morphometric studies on the testis of Korean ring-necked pheasant (Phasianus colchicus karpowi) during the breeding and non-breeding seasons, Vet. Res. Commun. 29 (2005) 629–643. [43] K.M. Tähkä, Y.H. Zhuang, S. Tähkä, P. Tuohimaa, Photoperiod-induced changes in androgen receptor expression in testes and accessory sex glands of the bank vole, Clethrionomys glareolus, Biol. Reprod. 56 (1997) 898–908. [44] D.W. Wacker, J.C. Wingfield, J.E. Davis, S.L. Meddle, Seasonal changes in aromatase and androgen receptor, but not estrogen receptor mRNA expression in the brain of the free-living male song sparrow, Melospiza melodia morphna, J. Comp. Neurol. 518 (2010) 3819–3835. [45] J.C. Wingfield, J. Jacobs, N. Hillgarth, Ecological constraints and the evolution of hormone-behavior interrelationships, Ann. N. Y. Acad. Sci. 807 (1997) 22–41. [46] S.K. Yadav, C. Haldar, S.S. Singh, Variation in melatonin receptors (Mel(1a) and Mel(1b)) and androgen receptor (AR) expression in the spleen of a seasonally breeding bird, Perdicula asiatica, J. Reprod. Immunol. 92 (2011) 54–61. [47] Q. Zong, M. Schummer, L. Hood, D.R. Morris, Messenger RNA translation state: the second dimension of high-throughput expression screening, Proc. Nat. Acad. Sci. U.S.A. 96 (1999) 10632–10636.