- Email: [email protected]
Molecular Cloning and Characterization of WNT3A and WNT14 Clustered in Human Chromosome 1q42 Region
Biochemical and Biophysical Research Communications 284, 1168 –1175 (2001) doi:10.1006/bbrc.2001.5105, available online at http://www.idealibrary.com on
Molecular Cloning and Characterization of WNT3A and WNT14 Clustered in Human Chromosome 1q42 Region Tetsuroh Saitoh,* Momoki Hirai,† and Masaru Katoh* ,1 *Genetics and Cell Biology Section, Genetics Division, National Cancer Center Research Institute, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan; and †Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Tokyo 113-0033, Japan
Received May 16, 2001
Human WNT3A and WNT14 cDNAs were cloned and characterized. WNT3A and WNT14 encoded WNT family protein of 352 and 365 amino acids, respectively. The 3.0-kb WNT3A mRNA was moderately expressed in placenta, and the 4.4-kb WNT14 mRNA was moderately expressed in skeletal muscle and heart. Although WNT3A mRNA was not detected in 35 human cancer cell lines, WNT14 mRNA was expressed in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III. WNT3A and WNT14 genes, clustered in the head to head manner with an interval of about 58.0 kb, were mapped to human chromosome 1q42 region by fluorescence in situ hybridization. WNT3 and WNT15, clustered in human chromosome 17q21 region, are related genes of WNT3A and WNT14, respectively. WNT3AWNT14 gene cluster and WNT3-WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A-WNT6 gene cluster and WNT10B-WNT1 gene cluster. Integration sites of mouse mammary tumor virus (MMTV) are located in the mouse chromosomal regions corresponding to these human WNT gene clusters. These results strongly suggest that unidentified nucleotide motif responsible for susceptibility to recombination might exist within the intergenic regions of these WNT gene clusters. © 2001 Academic Press Key Words: WNT; Frizzled; -catenin; gastric cancer; gene cluster.
WNTs are soluble-type glycoproteins, which play key roles in carcinogenesis as well as in embryogenesis (1). Through WNT receptors encoded by Frizzled genes (2– 8), WNT signal is transduced to -catenin-TCF Nucleotide sequence data for WNT14 and WNT3A will appear in the DDBJ/EMBL/GenBank databases under the Accession Nos. AB060283 and AB060284, respectively. 1 To whom correspondence and reprint requests should be addressed. Fax: ⫹81-3-3541-2685. E-mail: [email protected].
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
pathway (9), Jun-N-terminal kinase (JNK) pathway (10), or Ca 2⫹-releasing pathway (11). Genetic or epigenetic alterations of WNT–-catenin–TCF signaling molecules, including WNT16, APC, AXIN1, -catenin, and TCF-4, are implicated in human carcinogenesis. These genetic or epigenetic alterations lead to transcriptional activation of WNT target genes, such as c-MYC, WISP1, WISP2, or CyclinD1 (17–19). Mouse Wnt3 is isolated as an oncogene, which is transcriptionally up-regulated by proviral insertion of mouse mammary tumor virus (MMTV). Mouse Wnt3 and Wnt3a, showing 84.7% amino-acid identity, induce morphological transformation of mouse mammarygland epithelial cell line C57MG (20, 21). As human WNT3A is predicted to be a potent cancer-associated gene, we searched for the human WNT3A gene fragments on human genome draft sequence. Here we have isolated WNT3A and WNT14 cDNAs by cDNA-PCR and by 5⬘-RACE. WNT3A and WNT14 were preferentially expressed in placenta and skeletal muscle, respectively. WNT14 and WNT3A genes, consisting of 4 exons, were clustered in the head to head manner with an interval of about 58.0 kb, and were mapped to human chromosome 1q42 region by fluorescence in situ hybridization (FISH). WNT3 and WNT15, clustered in human chromosome 17q21 region (22), are related genes of WNT3A and WNT14, respectively. WNT3AWNT14 gene cluster and WNT3-WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A-WNT6 gene cluster and WNT10B-WNT1 gene cluster. MATERIALS AND METHODS Blast search. Human genome draft sequences homologous to mouse Wnt3a were searched for with the Tblastn program (http:// www.ncbi.nlm.nih.gov), in which deduced amino-acid sequence of mouse Wnt3a was compared with human genome draft sequences translated in 6 flames. Human WNT3A or WNT14 cDNAs isolated in this study were
1168
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1
Oligonucleotide Primers Primer
Orientation
Nucleotide sequence
Nucleotide position
PW3A-01 PW3A-02 PW3A-03 PW3A-04 PW14-01 PW14-02 PW14-03 PW14-04 PW14-06 PW14-08 BACT2 BACT3
Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Anti-sense Anti-sense Anti-sense Sense
CGGCGATGGCCCCACTCGGATAC CTACTTGCAGGTGTGCACGTC TCAGCTGCCAGGAGTGCACG CGCCCTCAGGGAGCAGCCTAC TTTGAGCGCTGGAACTGCACG CTCAGCCCTTGCAGGTGTAG TGGAGTGCAGGCAGTGCACG AAAAGCCTCTCAGTCCTTGCAG ACGAACTTGCTGCTGTACTTAAG CCTCCAGCGTGCAGTTCCAG GCGGATGTCCACGTCACACT CCACTGGCATCGTGATGGAC
1–23 of WNT3A 1064–1044 of WNT3A 1015–1034 of WNT3A 1555–1535 of WNT3A 306–326 of WNT14 1100–1091 of WNT14 1057–1076 of WNT14 1631–1610 of WNT14 547–525 of WNT14 333–314 of WNT14 943–924 of -actin 516–535 of -actin
compared with human genome draft sequences by using the Blastn program to determine the structure of the WNT3A and WNT14 genes as described previously (23). Poly(A) ⫹ RNAs. Poly(A)⫹ RNAs of human fetal brain, lung, liver, and kidney (Clontech Laboratories) were purchased. Poly(A)⫹ RNAs were extracted from esophageal cancer cell lines TE1, TE2, TE3, TE4, TE5, TE6, TE7, TE8, TE10, TE11, TE12, TE13, gastric cancer cell lines OKAJIMA, TMK1, MKN7, MKN28, MKN45, MKN74, KATO-III, brain tumor cell lines DBTRG-05MG, T98G, U-373MG, SW1088, SW1783, A-172, Hs 683, and a teratocarcinoma cell line NT2 with the FastTrack 2.0 Kit (Invitrogen) as described previously (24). One-step cDNA-PCR. Forty nanograms of poly(A)⫹ RNAs were used as templates for cDNA-PCR with One-step RT-PCR kit (Qiagen) as described previously (25). Cycle profile of cDNA-PCR was as follows: reverse-transcription reaction at 50°C for 30 min, activation of HotStarTaq DNA polymerase at 95°C for 15 min, and 32 or 35 cycles of amplification (94°C for 0.5 min, 60°C for 0.5 min, 72°C for 2 min). cDNA-PCR products were purified with the QIAEX Kit (Qiagen), and were ligated into TA cloning vector pCR2.1 (Invitrogen) for subsequent nucleotide sequence analyses with ABI310 Sequencer (PE Applied Biosystems). Nucleotide sequences of PCR primers are listed in Table 1. 5⬘-RACE. Nested 5⬘-RACE with LA Taq DNA polymerase and 2⫻ GC buffer (Takara) was performed in GeneAmp PCR system 9600 (PE Applied Biosystems) by using a mixture of Marathon-Ready adapter-ligated cDNAs of human fetal lung and kidney (Clontech Laboratories) as a template. First-round PCR (20 cycles) was performed with WNT14 specific primer PW14-06 and adapter primer AP1, and second-round PCR (25 cycles) was performed with WNT14 specific primer PW14-08 and adapter primer AP2. Nested PCR products were ligated into pCR2.1 vector for sequence analyses. Nucleotide sequences of PCR primers are listed in Table 1. Northern blot analysis. Two g of poly(A) ⫹ RNAs, separated by 1.0% agarose gels containing 17.9% formaldehyde in 1⫻ Mops buffer, were transferred onto nitrocellulose filters, and were fixed as described previously (26). After prehybridization for 1 h at 68°C in QuikHyb solution (Stratagene), Northern blot filters mentioned above or MTN Northern blot filters (Clontech Laboratories) were hybridized with a [␣- 32P]dCTP-labeled probe for 1 h at 68°C in QuikHyb solution. After washing, filters were exposed to the Imaging Plate (Fuji) for image analyses with the Storm system (Molecular Dynamics). W3A2 probe corresponds to nucleotide position 1015– 1555 of WNT3A cDNA, and W142 probe corresponds to nucleotide position 1057–1631 of WNT14 cDNA. FISH. Human metaphase chromosomes with replication R-bands were prepared on a slide glass, and were hybridized to a
biotin-14-dATP-labeled probe. After washing, the slide glass was incubated with anti-biotin rabbit IgG antibody (Enzo). After further washing and propidium-iodide counter-staining, hybridization signals were detected with fluorescein-labeled goat anti-rabbit IgG antibody (Enzo) (27).
RESULTS Isolation of WNT3A cDNAs Human WNT3A gene fragments on human genome draft sequences AL136379.4 and AL360269.3 were identified with the Tblastn program by using mouse Wnt3a amino-acid sequence as a query sequence. PCR primers were designed based on the nucleotide sequence of putative exons of the WNT3A gene (Table 1). W3A1 cDNA was isolated by cDNA-PCR with PW3A-01 and PW3A-02 primers, and W3A2 cDNA with PW3A-03 and PW3A-04 primers. Nucleotide sequence of WNT3A cDNA was determined by combining the nucleotide sequences of W3A1 (nucleotide position 1–1064) and W3A2 (nucleotide position 1015–1555) (Fig. 1A). Isolation of WNT14 cDNAs Human WNT14 gene fragments, corresponding to chicken wnt14 (22), were identified on the same human genome draft sequence that contained the WNT3A gene. Although two additional WNT14 exons were identified on the human genome draft sequence AL360269.3 with the Tblastn program by using chicken wnt14 amino-acid sequence as a query sequence, putative exon 1 of the WNT14 gene was not identified. WNT14 cDNA containing putative exon 1 was isolated from a mixture of Marathon-Ready cDNAs by using the following nested RACE; first round RACE with PW14-06 and AP1 primers, and second round RACE with PW14-08 and AP2 primers (Fig. 2A). W141 was isolated by cDNA-PCR with PW14-01 and PW14-02 primers, and W142 with PW14-03 and
1169
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Structure of WNT3A cDNA and WNT3A polypeptide. (A) Schematic presentation of WNT3A cDNAs. ORF is depicted as an open box and UTRs as bold bars. W3A1 cDNA corresponds to nucleotide position 1–1064 of WNT3A, and W3A2 cDNA corresponds to nucleotide position 1015–1555 of WNT3A. (B) Amino-acid comparison between WNT3A and WNT3. Amino acids are numbered on the right. Amino acids conserved between WNT3A and WNT3 (asterisk) are shown below the alignment. Exon junctions in WNT3A (arrow head) and an N-linked glycosylation site (sharp) are shown above the alignment. WNT3A and WNT3 show 84.9% total amino-acid identity.
PW14-04 primers (Fig. 2A). Nucleotide sequence of WNT14 cDNA was determined by combining nucleotide sequences of W141 (nucleotide position 306 –1110), W142 (nucleotide position 1057–1631), and W143 cDNAs (nucleotide position 1–333). Amino Acid Sequence of WNT3A and WNT14 WNT3A and WNT14 encoded polypeptide of 352 and 365 amino acid residues, respectively. WNT14 partial clone previously reported by another group (22) corresponds to codon 221–343 of WNT14 complete sequence determined in this study (Fig. 2B). Consensus aminoacid residues conserved among members of the WNT family and an N-linked glycosylation site were identified in both WNT3A (Fig. 1B) and WNT14 (Fig. 2B). Among human WNTs, WNT3A was most homologous to WNT3 (84.9% total amino-acid identity), while WNT14 was most homologous to WNT15 partial clone (63.6% partial amino-acid identity).
Expression Profile of WNT3A and WNT14 in Normal Human Tissues Expression of WNT3A and WNT14 mRNAs were investigated by Northern blot analyses with each specific probe, W3A2 and W142. The W3A2 probe detected the 3.0-kb WNT3A mRNA, and the W142 probe detected the 4.4-kb WNT14 mRNA (Figs. 3A and 3B). WNT3A mRNA was moderately expressed in placenta, and weakly expressed in adult lung, spleen, and prostate. WNT14 mRNA was moderately expressed in adult skeletal muscle and heart, and weakly expressed in placenta, adult lung, pancreas, spleen, ovary, fetal brain and lung (Figs. 3A and 3B). Expression Profile of WNT3A and WNT14 in Human Cancer Cell Lines WNT3A and WNT14 mRNAs were not detected by Northern blot analysis in 12 esophageal cancer, 7 brain tumor and 1 teratocarcinoma cell lines, and other 8
1170
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Structure of WNT14 cDNA and WNT14 polypeptide. (A) Schematic presentation of WNT14 cDNAs. ORF is depicted as an open box, and UTRs as bold bars. W141 cDNA corresponds to nucleotide position 306 –1110 of WNT14, W142 cDNA to nucleotide position 1057–1631, and W143 cDNA nucleotide position 1–333. (B) Amino-acid comparison between WNT14 and WNT15 partial clone. Amino acids are numbered on the right. Amino acids conserved between WNT14 and WNT15 (asterisk) are shown below the alignment. Exon junctions in WNT14 (arrow head), an N-linked glycosylation site (sharp), and position of previously reported WNT14 partial clone (overbar) are shown above the alignment. WNT14 and WNT15 partial clone show 63.6% partial amino-acid identity.
human cancer cell lines HL-60, HeLa S3, K-562, MOLT-4, Raji, SW480, A549, and G-361 (data not shown). Although WNT3A cDNA was not detected in gastric cancer cell lines, WNT14 cDNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III by cDNA-PCR (Fig. 3C). Structure of WNT3A–WNT14 Gene Cluster Exon–intron structures of the WNT3A and WNT14 genes were determined by the Blastn program, in which nucleotide sequences of the WNT3A and WNT14 cDNAs determined in this study were compared with human genome draft sequences. Exons 1– 4 of the WNT3A gene were located on human genome draft sequence AL136379.16 without gap. Exon 1
corresponded to nucleotide position 61664 – 61569, exon 2 to nucleotide position 46101– 45860, exon 3 to nucleotide position 18112–17847, and exon 4 to nucleotide position 9782– 8812. These results indicated that the WNT3A gene was about 53.0-kb in size (Fig. 4). Exons 1 of the WNT14 gene was located on human genome draft sequence AC004916.2, and exons 2– 4 of the WNT14 gene were located on human genome draft sequence AL360269.8 without gap. Two human genome draft sequences AC004916.2 and AL360269.8 were overlapped in intron 1 of the WNT14 gene. The WNT14 gene was estimated to be about 27.0-kb in size (Fig. 4). Exon 1 of the WNT14 gene and exons 1–3 of the WNT3A gene were located on human genome draft sequence AC004916.2 without gap. Exon 1 of the
1171
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Expression of WNT3A and WNT14. (A) Adult tissues. (B) Fetal tissues. W3A2 probe detected the 3.0-kb WNT3A mRNA, and W142 probe detected the 4.4-kb WNT14 mRNA. WNT3A mRNA was moderately expressed in placenta, while WNT14 mRNA was moderately expressed in adult skeletal muscle and heart, and weakly expressed in placenta. (C) Gastric cancer cell lines. WNT3A cDNA (541 bp) were detected by cDNA-PCR with PW3A-03 and PW3A-04 primers, WNT14 cDNA (575 bp) by cDNA-PCR with PW14-03 and PW14-04 primers, and -actin cDNA (428 bp) by cDNA-PCR with BACT-03 and BACT-02 primers. -actin cDNA was almost equally detected. Although WNT3A cDNA was not detected in gastric cancer cell lines, WNT14 cDNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III.
WNT14 gene and WNT3A gene corresponded to nucleotide position 107075–107180 and nucleotide position 49004 – 48929 of AC004916.2, respectively. This result indicated that WNT3A and WNT14 genes were clustered in the head to head manner with an interval of about 58.0-kb (Fig. 4). Chromosomal Localization of the WNT3A–WNT14 Gene Cluster To determine the human chromosomal localization of the WNT3A–WNT14 gene cluster, W3A1 and W141 probes labeled with a biotin-14-dATP were hybridized to human metaphase chromosomes with replication
R-bands, separately. Both W3A1 and W141 probes hybridized to human chromosome 1q42 region (Fig. 5). DISCUSSION WNT3A and WNT14, encoding WNT family protein, have been cloned and characterized in this study (Figs. 1 and 2). WNT3A and WNT14 genes, consisting of 4 exons, were clustered in the head to head manner with an interval of about 58.0-kb (Fig. 3). Both WNT3A and WNT14 genes were mapped to human chromosome 1q42 region by FISH (Fig. 5). Based on these results, it was concluded that WNT3A and WNT14 genes were clustered in human chromosome 1q42 region.
1172
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Schematic presentation of the WNT3A–WNT14 gene cluster. Genome structure and human genome draft sequences are shown by bold bars, and gaps within human genome draft sequences were shown by gray bars. Exons are indicated by closed boxes above the genome structure. The WNT3A, consisting of 4 exons, was about 53.0-kb in size. The WNT14, consisting of 4 exons, was about 27.0-kb in size. The WNT3A and WNT14 genes were clustered in the head to head manner with an interval of about 58.0-kb.
Human WNT3A was moderately expressed in placenta, and weakly expressed in adult lung, spleen, and prostate (Fig. 3A). Mouse Wnt3A is expressed in adult lung and fetal neural tube (20). These results indicate
FIG. 5. Chromosomal localization of the WNT3A and WNT14 genes. (A) WNT3A gene. (B) WNT14 gene. Human metaphase chromosomes with replication R-bands were prepared and hybridized with a biotin-14-dATP-labeled W3A1 or W141 probe. After washing, signals were amplified using rabbit anti-biotin antibody (Enzo) and fluorescein-labeled goat anti-rabbit IgG (Enzo). Both WNT3A and WNT14 genes were mapped to human chromosome 1q42 region.
that expression profiles of human WNT3A and mouse Wnt3a are not consistent with each other. Although chicken wnt14 cDNA and human WNT14 partial cDNA are isolated by another group (22), expression profiles were not reported yet. Human WNT14 was moderately expressed in skeletal muscle and heart, and weakly expressed in placenta, adult lung, pancreas, spleen, ovary, fetal brain and fetal lung (Fig. 3A, B). WNT14 might play key roles in skeletal muscle and heart. Among 35 human cancer cell lines examined in this study, WNT3A mRNA was not detected. WNT14 mRNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45, and KATO-III (Fig. 3C). We are next going to investigate expression profile of WNT14 in primary gastric cancer. WNT3A was most homologous to WNT3 (Fig. 1), while WNT14 was most homologous to WNT15 (Fig. 2). WNT3 and WNT15 genes were also clustered in human chromosome 17q21 region (22). WNT3A–WNT14 gene cluster and WNT3–WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A–WNT6 gene cluster and WNT10B– WNT1 gene cluster. To search for the existence of additional WNT gene clusters on human genome, chromosomal localization of human WNT genes are listed in Table 2. Although
1173
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES
TABLE 2
Chromosomal Localization of Human WNT Genes WNT gene
Chromosomal localization
Reference
WNT3A and WNT14 WNT3 and WNT15
Clustered in 1q42 Clustered in 17q21
This study 22
WNT10A and WNT6 WNT10B and WNT1
Clustered in 2q35 Clustered in 12q13
28 28
WNT2 WNT16 WNT2B
7q31 7q31 1p13
29 12 30
WNT4 WNT5A WNT5B WNT7A WNT7B WNT8A WNT8B WNT11
Not determined 3p14–p21 Not determined 3p25 22q13 Not determined Not determined 11q13.5
32 33 34
35
WNT2 and WNT16 genes are mapped to human chromosome 7q31 region together (12, 29), WNT2 and WNT16 genes were not located on the same human genome draft sequence. WNT2 and WNT16 genes might be co-localized in the human chromosome 7q31 region by chance. Alternatively, WNT2 and WNT16 genes might be clustered in human chromosome 7q31 region with a relatively larger interval. As the WNT2B/WNT13 gene on human chromosome 1p13 (29, 30) is homologous to the WNT2 gene, a novel WNT16related gene might be located near the WNT2B/ WNT13 locus. Such a novel WNT gene was not identified on the human genome draft sequence by Tblastn or Blastn program; however, we are now still searching for the novel WNT gene near the WNT2B locus. In this study, we have cloned and characterized WNT3A and WNT14, which are clustered in the human chromosome 1q42 region. WNT3A–WNT14 gene cluster and WNT3–WNT15 gene cluster as well as WNT10A–WNT6 gene cluster and WNT10B–WNT1 gene cluster might be generated due to duplication of ancestral gene cluster, respectively. Integration sites of MMTV are located in the mouse chromosomal regions corresponding to these human WNT gene clusters. These results strongly suggest that unidentified nucleotide motif responsible for susceptibility to recombination might exist within the intergenic regions of these WNT gene clusters. ACKNOWLEDGMENTS This study was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and by a Grant-in-Aid from the Foundation for Promotion of Cancer Research.
1. Pfeifer, M., and Polakis, P. (2000) Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus. Science 287, 1606 –1609. 2. Tokuhara, M., Hirai, M., Atomi, Y., Terada, M., and Katoh, M. (1998) Molecular cloning of human Frizzled-6. Biochem. Biophys. Res. Commun. 243, 622– 627, doi:10.1006/bbrc.1998.8143. 3. Sagara, N., Toda, G., Hirai, M., Terada, M., and Katoh, M. (1998) Molecular cloning differential expression, and chromosomal localization of human Frizzled-1, Frizzled-2, and Frizzled-7. Biochem. Biophys. Res. Commun. 252, 117–122, doi:10.1006/ bbrc.1998.9607. 4. Koike, J., Takagi, A., Miwa, T., Hirai, M., Terada, M., and Katoh, M. (1999) Molecular cloning of Frizzled-10, a novel member of the Frizzled gene family. Biochem. Biophys. Res. Commun. 262, 39 – 43, doi:10.1006/bbrc.1999.1161. 5. Kirikoshi, H., Sagara, N., Koike, J., Tanaka, K., Sekihara, H., Hirai, M., and Katoh, M. (1999) Molecular cloning and characterization of human Frizzled-4 on chromosome 11q14 – q21. Biochem. Biophys. Res. Commun. 264, 955–961, doi:10.1006/ bbrc.1999.1612. 6. Kirikoshi, H., Koike, J., Sagara, N., Saitoh, T., Tokuhara, M., Tanaka, K., Sekihara, H., Hirai, M., and Katoh, M. (2000) Molecular cloning and genomic structure of human Frizzled-3 at chromosome 8p21. Biochem. Biophys. Res. Commun. 271, 8 –14, doi:10.1006/bbrc.2000.2578. 7. Saitoh, T., Hirai, M., and Katoh, M. (2001) Molecular cloning and characterization of human Frizzled-8 gene on chromosome 10p11.2. Int. J. Oncol. 18, 991–996. 8. Saitoh, T., Hirai, M., and Katoh, M. (2001) Molecular cloning and characterization of human Frizzled-5 gene on chromosome 2q33.3– q34 region. Int. J. Oncol. 19, in press. 9. Molenaar, M., van de Wetering, M., Oosterwegel, M., PetersonMaduro, J., Godsave, S., Korinek, V., Roose, J., Destree, O., and Clevers, H. (1996) XTcf-3 transcription factor mediates -catenin-induced axis formation in Xenopus embryos. Cell 86, 391–399. 10. Boutros, M., Paricio, N., Strutt, D. I., and Mlodzik, M. (1998) Dishevelled activates JNK and discriminates between JNK pathway in planar polarity and wingless signaling. Cell 94, 109 –118. 11. Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R., and Moon, R. T. (2000) The Wnt/Ca 2⫹ pathway: A new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16, 279 –283. 12. McWhirter, J. R., Neuteboom, S. T., Wancewicz, E. V., Monia, B. P., Downing, J. R., and Murre, C. (1999) Oncogenic homeodomain transcription factor E2A-Pbx1 activates a novel WNT gene in pre-B acute lymphoblastoid leukemia. Proc. Natl. Acad. Sci. USA 96, 11464 –11469. 13. Kinzler, K. W., Nilbert, M. C., Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., Finniear, R., Markham, A., Groffen, J., Boguski, M. S., Altschul, S. F., Horii, A., Ando, H., Miyoshi, Y., Miki, Y., Nishisho, I., and Nakamura, Y. (1991) Identification of FAP locus genes from chromosome 5q21. Science 253, 661– 665. 14. Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T., Yamaoka, Y., and Nakamura, Y. (2000) AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virusmediated transfer of AXIN1. Nat. Genet. 24, 245–250. 15. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997) Activation of
1174
Vol. 284, No. 5, 2001
16.
17.
18.
19. 20.
21.
22.
23.
24.
25.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
-catenin—Tcf signaling in colon cancer by mutations in -catenin or APC. Science 275, 1787–1790. Duval, A., Gayet, J., Zhou, X. P., Iacopetta, B., Thomas, G., and Hamelin, R. (1999) Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res. 59, 4213– 4215. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Identification of c-MYC as a target of the APC pathway. Science 281, 1509 –1512. Pennica, D., Swanson, T. A., Welsh, J. W., Roy, M. A., Lawrence, D. A., Lee, J., Brush, J., Taneyhill, L. A., Deuel, B., Lew, M., Watanabe, C., Cohen, R. L., Melhem, M. F., Finley, G. G., Quirke, P., Goddard, A. D., Hillan, K. J., Gurney, A. L., Botstein, D., and Levine, A. J. (1998) WISP genes are members of the connective tissue growth factor family that are up-regulated in Wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc. Natl. Acad. Sci. USA 95, 14717–14722. Tetsu, O., and McCormick, F. (1999) -catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422– 426. Roelink, H., and Nusse, R. (1991) Expression of two members of the Wnt family during mouse development—restricted temporal and spatial patterns in the developing neural tube. Genes Dev. 5, 381–388. Wong, G. T., Gavin, B. J., and McMahon, A. P. (1994) Differential transformation of mammary epithelial cells by Wnt genes. Mol. Cell. Biol. 14, 6278 – 6286. Bergstein, I., Eisenberg, L. M., Bhalerao, J., Jenkins, N. A., Copeland, N. G., Osborne, M. P., Bowcock, A. M., and Brown, A. M. (1997) Isolation of two novel WNT genes, WNT14 and WNT15, one of which (WNT15) is closely linked to WNT3 on human chromosome 17q21. Genomics 46, 450 – 458. Katoh, M. (2001) Molecular cloning and characterization of MFRP, a novel gene encoding a membrane-type Frizzled-related protein. Biochem. Biophys. Res. Commun. 282, 116 –123, doi: 10.1006/bbrc.2001.4551. Koike, J., Sagara, N., Kirikoshi, H., Takagi, A., Miwa, T., Hirai, M., and Katoh, M. (2000) Molecular cloning and genomic structure of the TRCP2 gene on chromosome 5q35.1. Biochem. Biophys. Res. Commun. 269, 103–109, doi:10.1006/bbrc.2000.2241. Saitoh, T., and Katoh, M. (2001) Expression profiles of TRCP1 and TRCP2, and mutation analysis of TRCP2 in gastric cancer. Int. J. Oncol. 18, 959 –964.
26. Sagara, N., and Katoh, M. (2000) Mitomycin C resistance induced by TCF-3 overexpression in gastric cancer cell line MKN28 is associated with DT-diaphorase down-regulation. Cancer Res. 60, 5959 –5962. 27. Hirai, M., Suto, Y., and Kanoh, M. (1994) A method for simultaneous detection of fluorescent G-bands and in situ hybridization signals. Cytogenet. Cell Genet. 66, 149 –151. 28. Kirikoshi, H., Sekihara, H., and Katoh, M. (2001) WNT10A and WNT6, clustered in human chromosome 2q35 region with head to tail manner, are strongly co-expressed in SW480 cells. Biochem. Biophys. Res. Commun. In press. 29. Scherer, S. W., Rommens, J. M., Soder, S., Wong, E., Plavsic, N., Tompkins, B. J., Beattie, A., Kim, J., and Tsui, L. C. (1993) Refined localization and yeast artificial chromosome (YAC) contig—Mapping of genes and DNA segments in the 7q21– q32 region. Hum. Mol. Genet. 2, 751–760. 30. Katoh, M., Hirai, M., Sugimura, T., and Terada, M. (1996) Cloning, expression and chromosomal localization of WNT13, a novel member of the WNT gene family. Oncogene 13, 873– 876. 31. Katoh, M., Kirikoshi, H., Saitoh, T., Sagara, N., and Koike, J. (2000) Alternative splicing of the WNT-2B/WNT-13 gene. Biochem. Biophys. Res. Commun. 275, 209 –216, doi:10.1006/ bbrc.2000.3252. 32. Clark, C. C., Cohen, I., Eichstetter, I., Cannizzaro, L. A., McPherson, J. D., Wasmuth, J. J., and Iozzo, R. V. (1993) Molecular cloning of the human proto-oncogene Wnt-5A and mapping of the gene (WNT5A) to chromosome 3p14 –p21. Genomics 18, 249 –260. 33. Bui, T. D., Lako, M., Lejeune, S., Curtis, A. R., Strachan, T., Lindsay, S., and Harris, A. L. (1997) Isolation of a full-length human WNT7A gene implicated in limb development and cell transformation, and mapping to chromosome 3p25. Gene 189, 25–29. 34. van Bokhoven, H., Kissing, J., Schepens, M., van Beersum, S., Simons, A., Riegman, P., McMahon, J. A., McMahon, A. P., and Brunner, H. G. (1997) Assignment of WNT7B to human chromosome band 22q13 by in situ hybridization. Cytogenet. Cell Genet. 77, 288 –289. 35. Lako, M., Strachan, T., Bullen, P., Wilson, D. I., Robson, S. C., and Lindsay, S. (1998) Isolation, characterisation and embryonic expression of WNT11, a gene which maps to 11q13.5 and has possible roles in the development of skeleton, kidney and lung. Gene 219, 101–110.
1175
Molecular Cloning and Characterization of WNT3A and WNT14 Clustered in Human Chromosome 1q42 Region Tetsuroh Saitoh,* Momoki Hirai,† and Masaru Katoh* ,1 *Genetics and Cell Biology Section, Genetics Division, National Cancer Center Research Institute, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan; and †Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Tokyo 113-0033, Japan
Received May 16, 2001
Human WNT3A and WNT14 cDNAs were cloned and characterized. WNT3A and WNT14 encoded WNT family protein of 352 and 365 amino acids, respectively. The 3.0-kb WNT3A mRNA was moderately expressed in placenta, and the 4.4-kb WNT14 mRNA was moderately expressed in skeletal muscle and heart. Although WNT3A mRNA was not detected in 35 human cancer cell lines, WNT14 mRNA was expressed in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III. WNT3A and WNT14 genes, clustered in the head to head manner with an interval of about 58.0 kb, were mapped to human chromosome 1q42 region by fluorescence in situ hybridization. WNT3 and WNT15, clustered in human chromosome 17q21 region, are related genes of WNT3A and WNT14, respectively. WNT3AWNT14 gene cluster and WNT3-WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A-WNT6 gene cluster and WNT10B-WNT1 gene cluster. Integration sites of mouse mammary tumor virus (MMTV) are located in the mouse chromosomal regions corresponding to these human WNT gene clusters. These results strongly suggest that unidentified nucleotide motif responsible for susceptibility to recombination might exist within the intergenic regions of these WNT gene clusters. © 2001 Academic Press Key Words: WNT; Frizzled; -catenin; gastric cancer; gene cluster.
WNTs are soluble-type glycoproteins, which play key roles in carcinogenesis as well as in embryogenesis (1). Through WNT receptors encoded by Frizzled genes (2– 8), WNT signal is transduced to -catenin-TCF Nucleotide sequence data for WNT14 and WNT3A will appear in the DDBJ/EMBL/GenBank databases under the Accession Nos. AB060283 and AB060284, respectively. 1 To whom correspondence and reprint requests should be addressed. Fax: ⫹81-3-3541-2685. E-mail: [email protected].
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
pathway (9), Jun-N-terminal kinase (JNK) pathway (10), or Ca 2⫹-releasing pathway (11). Genetic or epigenetic alterations of WNT–-catenin–TCF signaling molecules, including WNT16, APC, AXIN1, -catenin, and TCF-4, are implicated in human carcinogenesis. These genetic or epigenetic alterations lead to transcriptional activation of WNT target genes, such as c-MYC, WISP1, WISP2, or CyclinD1 (17–19). Mouse Wnt3 is isolated as an oncogene, which is transcriptionally up-regulated by proviral insertion of mouse mammary tumor virus (MMTV). Mouse Wnt3 and Wnt3a, showing 84.7% amino-acid identity, induce morphological transformation of mouse mammarygland epithelial cell line C57MG (20, 21). As human WNT3A is predicted to be a potent cancer-associated gene, we searched for the human WNT3A gene fragments on human genome draft sequence. Here we have isolated WNT3A and WNT14 cDNAs by cDNA-PCR and by 5⬘-RACE. WNT3A and WNT14 were preferentially expressed in placenta and skeletal muscle, respectively. WNT14 and WNT3A genes, consisting of 4 exons, were clustered in the head to head manner with an interval of about 58.0 kb, and were mapped to human chromosome 1q42 region by fluorescence in situ hybridization (FISH). WNT3 and WNT15, clustered in human chromosome 17q21 region (22), are related genes of WNT3A and WNT14, respectively. WNT3AWNT14 gene cluster and WNT3-WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A-WNT6 gene cluster and WNT10B-WNT1 gene cluster. MATERIALS AND METHODS Blast search. Human genome draft sequences homologous to mouse Wnt3a were searched for with the Tblastn program (http:// www.ncbi.nlm.nih.gov), in which deduced amino-acid sequence of mouse Wnt3a was compared with human genome draft sequences translated in 6 flames. Human WNT3A or WNT14 cDNAs isolated in this study were
1168
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1
Oligonucleotide Primers Primer
Orientation
Nucleotide sequence
Nucleotide position
PW3A-01 PW3A-02 PW3A-03 PW3A-04 PW14-01 PW14-02 PW14-03 PW14-04 PW14-06 PW14-08 BACT2 BACT3
Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Anti-sense Anti-sense Anti-sense Sense
CGGCGATGGCCCCACTCGGATAC CTACTTGCAGGTGTGCACGTC TCAGCTGCCAGGAGTGCACG CGCCCTCAGGGAGCAGCCTAC TTTGAGCGCTGGAACTGCACG CTCAGCCCTTGCAGGTGTAG TGGAGTGCAGGCAGTGCACG AAAAGCCTCTCAGTCCTTGCAG ACGAACTTGCTGCTGTACTTAAG CCTCCAGCGTGCAGTTCCAG GCGGATGTCCACGTCACACT CCACTGGCATCGTGATGGAC
1–23 of WNT3A 1064–1044 of WNT3A 1015–1034 of WNT3A 1555–1535 of WNT3A 306–326 of WNT14 1100–1091 of WNT14 1057–1076 of WNT14 1631–1610 of WNT14 547–525 of WNT14 333–314 of WNT14 943–924 of -actin 516–535 of -actin
compared with human genome draft sequences by using the Blastn program to determine the structure of the WNT3A and WNT14 genes as described previously (23). Poly(A) ⫹ RNAs. Poly(A)⫹ RNAs of human fetal brain, lung, liver, and kidney (Clontech Laboratories) were purchased. Poly(A)⫹ RNAs were extracted from esophageal cancer cell lines TE1, TE2, TE3, TE4, TE5, TE6, TE7, TE8, TE10, TE11, TE12, TE13, gastric cancer cell lines OKAJIMA, TMK1, MKN7, MKN28, MKN45, MKN74, KATO-III, brain tumor cell lines DBTRG-05MG, T98G, U-373MG, SW1088, SW1783, A-172, Hs 683, and a teratocarcinoma cell line NT2 with the FastTrack 2.0 Kit (Invitrogen) as described previously (24). One-step cDNA-PCR. Forty nanograms of poly(A)⫹ RNAs were used as templates for cDNA-PCR with One-step RT-PCR kit (Qiagen) as described previously (25). Cycle profile of cDNA-PCR was as follows: reverse-transcription reaction at 50°C for 30 min, activation of HotStarTaq DNA polymerase at 95°C for 15 min, and 32 or 35 cycles of amplification (94°C for 0.5 min, 60°C for 0.5 min, 72°C for 2 min). cDNA-PCR products were purified with the QIAEX Kit (Qiagen), and were ligated into TA cloning vector pCR2.1 (Invitrogen) for subsequent nucleotide sequence analyses with ABI310 Sequencer (PE Applied Biosystems). Nucleotide sequences of PCR primers are listed in Table 1. 5⬘-RACE. Nested 5⬘-RACE with LA Taq DNA polymerase and 2⫻ GC buffer (Takara) was performed in GeneAmp PCR system 9600 (PE Applied Biosystems) by using a mixture of Marathon-Ready adapter-ligated cDNAs of human fetal lung and kidney (Clontech Laboratories) as a template. First-round PCR (20 cycles) was performed with WNT14 specific primer PW14-06 and adapter primer AP1, and second-round PCR (25 cycles) was performed with WNT14 specific primer PW14-08 and adapter primer AP2. Nested PCR products were ligated into pCR2.1 vector for sequence analyses. Nucleotide sequences of PCR primers are listed in Table 1. Northern blot analysis. Two g of poly(A) ⫹ RNAs, separated by 1.0% agarose gels containing 17.9% formaldehyde in 1⫻ Mops buffer, were transferred onto nitrocellulose filters, and were fixed as described previously (26). After prehybridization for 1 h at 68°C in QuikHyb solution (Stratagene), Northern blot filters mentioned above or MTN Northern blot filters (Clontech Laboratories) were hybridized with a [␣- 32P]dCTP-labeled probe for 1 h at 68°C in QuikHyb solution. After washing, filters were exposed to the Imaging Plate (Fuji) for image analyses with the Storm system (Molecular Dynamics). W3A2 probe corresponds to nucleotide position 1015– 1555 of WNT3A cDNA, and W142 probe corresponds to nucleotide position 1057–1631 of WNT14 cDNA. FISH. Human metaphase chromosomes with replication R-bands were prepared on a slide glass, and were hybridized to a
biotin-14-dATP-labeled probe. After washing, the slide glass was incubated with anti-biotin rabbit IgG antibody (Enzo). After further washing and propidium-iodide counter-staining, hybridization signals were detected with fluorescein-labeled goat anti-rabbit IgG antibody (Enzo) (27).
RESULTS Isolation of WNT3A cDNAs Human WNT3A gene fragments on human genome draft sequences AL136379.4 and AL360269.3 were identified with the Tblastn program by using mouse Wnt3a amino-acid sequence as a query sequence. PCR primers were designed based on the nucleotide sequence of putative exons of the WNT3A gene (Table 1). W3A1 cDNA was isolated by cDNA-PCR with PW3A-01 and PW3A-02 primers, and W3A2 cDNA with PW3A-03 and PW3A-04 primers. Nucleotide sequence of WNT3A cDNA was determined by combining the nucleotide sequences of W3A1 (nucleotide position 1–1064) and W3A2 (nucleotide position 1015–1555) (Fig. 1A). Isolation of WNT14 cDNAs Human WNT14 gene fragments, corresponding to chicken wnt14 (22), were identified on the same human genome draft sequence that contained the WNT3A gene. Although two additional WNT14 exons were identified on the human genome draft sequence AL360269.3 with the Tblastn program by using chicken wnt14 amino-acid sequence as a query sequence, putative exon 1 of the WNT14 gene was not identified. WNT14 cDNA containing putative exon 1 was isolated from a mixture of Marathon-Ready cDNAs by using the following nested RACE; first round RACE with PW14-06 and AP1 primers, and second round RACE with PW14-08 and AP2 primers (Fig. 2A). W141 was isolated by cDNA-PCR with PW14-01 and PW14-02 primers, and W142 with PW14-03 and
1169
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Structure of WNT3A cDNA and WNT3A polypeptide. (A) Schematic presentation of WNT3A cDNAs. ORF is depicted as an open box and UTRs as bold bars. W3A1 cDNA corresponds to nucleotide position 1–1064 of WNT3A, and W3A2 cDNA corresponds to nucleotide position 1015–1555 of WNT3A. (B) Amino-acid comparison between WNT3A and WNT3. Amino acids are numbered on the right. Amino acids conserved between WNT3A and WNT3 (asterisk) are shown below the alignment. Exon junctions in WNT3A (arrow head) and an N-linked glycosylation site (sharp) are shown above the alignment. WNT3A and WNT3 show 84.9% total amino-acid identity.
PW14-04 primers (Fig. 2A). Nucleotide sequence of WNT14 cDNA was determined by combining nucleotide sequences of W141 (nucleotide position 306 –1110), W142 (nucleotide position 1057–1631), and W143 cDNAs (nucleotide position 1–333). Amino Acid Sequence of WNT3A and WNT14 WNT3A and WNT14 encoded polypeptide of 352 and 365 amino acid residues, respectively. WNT14 partial clone previously reported by another group (22) corresponds to codon 221–343 of WNT14 complete sequence determined in this study (Fig. 2B). Consensus aminoacid residues conserved among members of the WNT family and an N-linked glycosylation site were identified in both WNT3A (Fig. 1B) and WNT14 (Fig. 2B). Among human WNTs, WNT3A was most homologous to WNT3 (84.9% total amino-acid identity), while WNT14 was most homologous to WNT15 partial clone (63.6% partial amino-acid identity).
Expression Profile of WNT3A and WNT14 in Normal Human Tissues Expression of WNT3A and WNT14 mRNAs were investigated by Northern blot analyses with each specific probe, W3A2 and W142. The W3A2 probe detected the 3.0-kb WNT3A mRNA, and the W142 probe detected the 4.4-kb WNT14 mRNA (Figs. 3A and 3B). WNT3A mRNA was moderately expressed in placenta, and weakly expressed in adult lung, spleen, and prostate. WNT14 mRNA was moderately expressed in adult skeletal muscle and heart, and weakly expressed in placenta, adult lung, pancreas, spleen, ovary, fetal brain and lung (Figs. 3A and 3B). Expression Profile of WNT3A and WNT14 in Human Cancer Cell Lines WNT3A and WNT14 mRNAs were not detected by Northern blot analysis in 12 esophageal cancer, 7 brain tumor and 1 teratocarcinoma cell lines, and other 8
1170
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Structure of WNT14 cDNA and WNT14 polypeptide. (A) Schematic presentation of WNT14 cDNAs. ORF is depicted as an open box, and UTRs as bold bars. W141 cDNA corresponds to nucleotide position 306 –1110 of WNT14, W142 cDNA to nucleotide position 1057–1631, and W143 cDNA nucleotide position 1–333. (B) Amino-acid comparison between WNT14 and WNT15 partial clone. Amino acids are numbered on the right. Amino acids conserved between WNT14 and WNT15 (asterisk) are shown below the alignment. Exon junctions in WNT14 (arrow head), an N-linked glycosylation site (sharp), and position of previously reported WNT14 partial clone (overbar) are shown above the alignment. WNT14 and WNT15 partial clone show 63.6% partial amino-acid identity.
human cancer cell lines HL-60, HeLa S3, K-562, MOLT-4, Raji, SW480, A549, and G-361 (data not shown). Although WNT3A cDNA was not detected in gastric cancer cell lines, WNT14 cDNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III by cDNA-PCR (Fig. 3C). Structure of WNT3A–WNT14 Gene Cluster Exon–intron structures of the WNT3A and WNT14 genes were determined by the Blastn program, in which nucleotide sequences of the WNT3A and WNT14 cDNAs determined in this study were compared with human genome draft sequences. Exons 1– 4 of the WNT3A gene were located on human genome draft sequence AL136379.16 without gap. Exon 1
corresponded to nucleotide position 61664 – 61569, exon 2 to nucleotide position 46101– 45860, exon 3 to nucleotide position 18112–17847, and exon 4 to nucleotide position 9782– 8812. These results indicated that the WNT3A gene was about 53.0-kb in size (Fig. 4). Exons 1 of the WNT14 gene was located on human genome draft sequence AC004916.2, and exons 2– 4 of the WNT14 gene were located on human genome draft sequence AL360269.8 without gap. Two human genome draft sequences AC004916.2 and AL360269.8 were overlapped in intron 1 of the WNT14 gene. The WNT14 gene was estimated to be about 27.0-kb in size (Fig. 4). Exon 1 of the WNT14 gene and exons 1–3 of the WNT3A gene were located on human genome draft sequence AC004916.2 without gap. Exon 1 of the
1171
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Expression of WNT3A and WNT14. (A) Adult tissues. (B) Fetal tissues. W3A2 probe detected the 3.0-kb WNT3A mRNA, and W142 probe detected the 4.4-kb WNT14 mRNA. WNT3A mRNA was moderately expressed in placenta, while WNT14 mRNA was moderately expressed in adult skeletal muscle and heart, and weakly expressed in placenta. (C) Gastric cancer cell lines. WNT3A cDNA (541 bp) were detected by cDNA-PCR with PW3A-03 and PW3A-04 primers, WNT14 cDNA (575 bp) by cDNA-PCR with PW14-03 and PW14-04 primers, and -actin cDNA (428 bp) by cDNA-PCR with BACT-03 and BACT-02 primers. -actin cDNA was almost equally detected. Although WNT3A cDNA was not detected in gastric cancer cell lines, WNT14 cDNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45 and KATO-III.
WNT14 gene and WNT3A gene corresponded to nucleotide position 107075–107180 and nucleotide position 49004 – 48929 of AC004916.2, respectively. This result indicated that WNT3A and WNT14 genes were clustered in the head to head manner with an interval of about 58.0-kb (Fig. 4). Chromosomal Localization of the WNT3A–WNT14 Gene Cluster To determine the human chromosomal localization of the WNT3A–WNT14 gene cluster, W3A1 and W141 probes labeled with a biotin-14-dATP were hybridized to human metaphase chromosomes with replication
R-bands, separately. Both W3A1 and W141 probes hybridized to human chromosome 1q42 region (Fig. 5). DISCUSSION WNT3A and WNT14, encoding WNT family protein, have been cloned and characterized in this study (Figs. 1 and 2). WNT3A and WNT14 genes, consisting of 4 exons, were clustered in the head to head manner with an interval of about 58.0-kb (Fig. 3). Both WNT3A and WNT14 genes were mapped to human chromosome 1q42 region by FISH (Fig. 5). Based on these results, it was concluded that WNT3A and WNT14 genes were clustered in human chromosome 1q42 region.
1172
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Schematic presentation of the WNT3A–WNT14 gene cluster. Genome structure and human genome draft sequences are shown by bold bars, and gaps within human genome draft sequences were shown by gray bars. Exons are indicated by closed boxes above the genome structure. The WNT3A, consisting of 4 exons, was about 53.0-kb in size. The WNT14, consisting of 4 exons, was about 27.0-kb in size. The WNT3A and WNT14 genes were clustered in the head to head manner with an interval of about 58.0-kb.
Human WNT3A was moderately expressed in placenta, and weakly expressed in adult lung, spleen, and prostate (Fig. 3A). Mouse Wnt3A is expressed in adult lung and fetal neural tube (20). These results indicate
FIG. 5. Chromosomal localization of the WNT3A and WNT14 genes. (A) WNT3A gene. (B) WNT14 gene. Human metaphase chromosomes with replication R-bands were prepared and hybridized with a biotin-14-dATP-labeled W3A1 or W141 probe. After washing, signals were amplified using rabbit anti-biotin antibody (Enzo) and fluorescein-labeled goat anti-rabbit IgG (Enzo). Both WNT3A and WNT14 genes were mapped to human chromosome 1q42 region.
that expression profiles of human WNT3A and mouse Wnt3a are not consistent with each other. Although chicken wnt14 cDNA and human WNT14 partial cDNA are isolated by another group (22), expression profiles were not reported yet. Human WNT14 was moderately expressed in skeletal muscle and heart, and weakly expressed in placenta, adult lung, pancreas, spleen, ovary, fetal brain and fetal lung (Fig. 3A, B). WNT14 might play key roles in skeletal muscle and heart. Among 35 human cancer cell lines examined in this study, WNT3A mRNA was not detected. WNT14 mRNA was detected in gastric cancer cell lines TMK1, MKN7, MKN45, and KATO-III (Fig. 3C). We are next going to investigate expression profile of WNT14 in primary gastric cancer. WNT3A was most homologous to WNT3 (Fig. 1), while WNT14 was most homologous to WNT15 (Fig. 2). WNT3 and WNT15 genes were also clustered in human chromosome 17q21 region (22). WNT3A–WNT14 gene cluster and WNT3–WNT15 gene cluster might be generated due to duplication of ancestral gene cluster, just like WNT10A–WNT6 gene cluster and WNT10B– WNT1 gene cluster. To search for the existence of additional WNT gene clusters on human genome, chromosomal localization of human WNT genes are listed in Table 2. Although
1173
Vol. 284, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES
TABLE 2
Chromosomal Localization of Human WNT Genes WNT gene
Chromosomal localization
Reference
WNT3A and WNT14 WNT3 and WNT15
Clustered in 1q42 Clustered in 17q21
This study 22
WNT10A and WNT6 WNT10B and WNT1
Clustered in 2q35 Clustered in 12q13
28 28
WNT2 WNT16 WNT2B
7q31 7q31 1p13
29 12 30
WNT4 WNT5A WNT5B WNT7A WNT7B WNT8A WNT8B WNT11
Not determined 3p14–p21 Not determined 3p25 22q13 Not determined Not determined 11q13.5
32 33 34
35
WNT2 and WNT16 genes are mapped to human chromosome 7q31 region together (12, 29), WNT2 and WNT16 genes were not located on the same human genome draft sequence. WNT2 and WNT16 genes might be co-localized in the human chromosome 7q31 region by chance. Alternatively, WNT2 and WNT16 genes might be clustered in human chromosome 7q31 region with a relatively larger interval. As the WNT2B/WNT13 gene on human chromosome 1p13 (29, 30) is homologous to the WNT2 gene, a novel WNT16related gene might be located near the WNT2B/ WNT13 locus. Such a novel WNT gene was not identified on the human genome draft sequence by Tblastn or Blastn program; however, we are now still searching for the novel WNT gene near the WNT2B locus. In this study, we have cloned and characterized WNT3A and WNT14, which are clustered in the human chromosome 1q42 region. WNT3A–WNT14 gene cluster and WNT3–WNT15 gene cluster as well as WNT10A–WNT6 gene cluster and WNT10B–WNT1 gene cluster might be generated due to duplication of ancestral gene cluster, respectively. Integration sites of MMTV are located in the mouse chromosomal regions corresponding to these human WNT gene clusters. These results strongly suggest that unidentified nucleotide motif responsible for susceptibility to recombination might exist within the intergenic regions of these WNT gene clusters. ACKNOWLEDGMENTS This study was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and by a Grant-in-Aid from the Foundation for Promotion of Cancer Research.
1. Pfeifer, M., and Polakis, P. (2000) Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus. Science 287, 1606 –1609. 2. Tokuhara, M., Hirai, M., Atomi, Y., Terada, M., and Katoh, M. (1998) Molecular cloning of human Frizzled-6. Biochem. Biophys. Res. Commun. 243, 622– 627, doi:10.1006/bbrc.1998.8143. 3. Sagara, N., Toda, G., Hirai, M., Terada, M., and Katoh, M. (1998) Molecular cloning differential expression, and chromosomal localization of human Frizzled-1, Frizzled-2, and Frizzled-7. Biochem. Biophys. Res. Commun. 252, 117–122, doi:10.1006/ bbrc.1998.9607. 4. Koike, J., Takagi, A., Miwa, T., Hirai, M., Terada, M., and Katoh, M. (1999) Molecular cloning of Frizzled-10, a novel member of the Frizzled gene family. Biochem. Biophys. Res. Commun. 262, 39 – 43, doi:10.1006/bbrc.1999.1161. 5. Kirikoshi, H., Sagara, N., Koike, J., Tanaka, K., Sekihara, H., Hirai, M., and Katoh, M. (1999) Molecular cloning and characterization of human Frizzled-4 on chromosome 11q14 – q21. Biochem. Biophys. Res. Commun. 264, 955–961, doi:10.1006/ bbrc.1999.1612. 6. Kirikoshi, H., Koike, J., Sagara, N., Saitoh, T., Tokuhara, M., Tanaka, K., Sekihara, H., Hirai, M., and Katoh, M. (2000) Molecular cloning and genomic structure of human Frizzled-3 at chromosome 8p21. Biochem. Biophys. Res. Commun. 271, 8 –14, doi:10.1006/bbrc.2000.2578. 7. Saitoh, T., Hirai, M., and Katoh, M. (2001) Molecular cloning and characterization of human Frizzled-8 gene on chromosome 10p11.2. Int. J. Oncol. 18, 991–996. 8. Saitoh, T., Hirai, M., and Katoh, M. (2001) Molecular cloning and characterization of human Frizzled-5 gene on chromosome 2q33.3– q34 region. Int. J. Oncol. 19, in press. 9. Molenaar, M., van de Wetering, M., Oosterwegel, M., PetersonMaduro, J., Godsave, S., Korinek, V., Roose, J., Destree, O., and Clevers, H. (1996) XTcf-3 transcription factor mediates -catenin-induced axis formation in Xenopus embryos. Cell 86, 391–399. 10. Boutros, M., Paricio, N., Strutt, D. I., and Mlodzik, M. (1998) Dishevelled activates JNK and discriminates between JNK pathway in planar polarity and wingless signaling. Cell 94, 109 –118. 11. Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R., and Moon, R. T. (2000) The Wnt/Ca 2⫹ pathway: A new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16, 279 –283. 12. McWhirter, J. R., Neuteboom, S. T., Wancewicz, E. V., Monia, B. P., Downing, J. R., and Murre, C. (1999) Oncogenic homeodomain transcription factor E2A-Pbx1 activates a novel WNT gene in pre-B acute lymphoblastoid leukemia. Proc. Natl. Acad. Sci. USA 96, 11464 –11469. 13. Kinzler, K. W., Nilbert, M. C., Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., Finniear, R., Markham, A., Groffen, J., Boguski, M. S., Altschul, S. F., Horii, A., Ando, H., Miyoshi, Y., Miki, Y., Nishisho, I., and Nakamura, Y. (1991) Identification of FAP locus genes from chromosome 5q21. Science 253, 661– 665. 14. Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T., Yamaoka, Y., and Nakamura, Y. (2000) AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virusmediated transfer of AXIN1. Nat. Genet. 24, 245–250. 15. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997) Activation of
1174
Vol. 284, No. 5, 2001
16.
17.
18.
19. 20.
21.
22.
23.
24.
25.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
-catenin—Tcf signaling in colon cancer by mutations in -catenin or APC. Science 275, 1787–1790. Duval, A., Gayet, J., Zhou, X. P., Iacopetta, B., Thomas, G., and Hamelin, R. (1999) Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res. 59, 4213– 4215. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Identification of c-MYC as a target of the APC pathway. Science 281, 1509 –1512. Pennica, D., Swanson, T. A., Welsh, J. W., Roy, M. A., Lawrence, D. A., Lee, J., Brush, J., Taneyhill, L. A., Deuel, B., Lew, M., Watanabe, C., Cohen, R. L., Melhem, M. F., Finley, G. G., Quirke, P., Goddard, A. D., Hillan, K. J., Gurney, A. L., Botstein, D., and Levine, A. J. (1998) WISP genes are members of the connective tissue growth factor family that are up-regulated in Wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc. Natl. Acad. Sci. USA 95, 14717–14722. Tetsu, O., and McCormick, F. (1999) -catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422– 426. Roelink, H., and Nusse, R. (1991) Expression of two members of the Wnt family during mouse development—restricted temporal and spatial patterns in the developing neural tube. Genes Dev. 5, 381–388. Wong, G. T., Gavin, B. J., and McMahon, A. P. (1994) Differential transformation of mammary epithelial cells by Wnt genes. Mol. Cell. Biol. 14, 6278 – 6286. Bergstein, I., Eisenberg, L. M., Bhalerao, J., Jenkins, N. A., Copeland, N. G., Osborne, M. P., Bowcock, A. M., and Brown, A. M. (1997) Isolation of two novel WNT genes, WNT14 and WNT15, one of which (WNT15) is closely linked to WNT3 on human chromosome 17q21. Genomics 46, 450 – 458. Katoh, M. (2001) Molecular cloning and characterization of MFRP, a novel gene encoding a membrane-type Frizzled-related protein. Biochem. Biophys. Res. Commun. 282, 116 –123, doi: 10.1006/bbrc.2001.4551. Koike, J., Sagara, N., Kirikoshi, H., Takagi, A., Miwa, T., Hirai, M., and Katoh, M. (2000) Molecular cloning and genomic structure of the TRCP2 gene on chromosome 5q35.1. Biochem. Biophys. Res. Commun. 269, 103–109, doi:10.1006/bbrc.2000.2241. Saitoh, T., and Katoh, M. (2001) Expression profiles of TRCP1 and TRCP2, and mutation analysis of TRCP2 in gastric cancer. Int. J. Oncol. 18, 959 –964.
26. Sagara, N., and Katoh, M. (2000) Mitomycin C resistance induced by TCF-3 overexpression in gastric cancer cell line MKN28 is associated with DT-diaphorase down-regulation. Cancer Res. 60, 5959 –5962. 27. Hirai, M., Suto, Y., and Kanoh, M. (1994) A method for simultaneous detection of fluorescent G-bands and in situ hybridization signals. Cytogenet. Cell Genet. 66, 149 –151. 28. Kirikoshi, H., Sekihara, H., and Katoh, M. (2001) WNT10A and WNT6, clustered in human chromosome 2q35 region with head to tail manner, are strongly co-expressed in SW480 cells. Biochem. Biophys. Res. Commun. In press. 29. Scherer, S. W., Rommens, J. M., Soder, S., Wong, E., Plavsic, N., Tompkins, B. J., Beattie, A., Kim, J., and Tsui, L. C. (1993) Refined localization and yeast artificial chromosome (YAC) contig—Mapping of genes and DNA segments in the 7q21– q32 region. Hum. Mol. Genet. 2, 751–760. 30. Katoh, M., Hirai, M., Sugimura, T., and Terada, M. (1996) Cloning, expression and chromosomal localization of WNT13, a novel member of the WNT gene family. Oncogene 13, 873– 876. 31. Katoh, M., Kirikoshi, H., Saitoh, T., Sagara, N., and Koike, J. (2000) Alternative splicing of the WNT-2B/WNT-13 gene. Biochem. Biophys. Res. Commun. 275, 209 –216, doi:10.1006/ bbrc.2000.3252. 32. Clark, C. C., Cohen, I., Eichstetter, I., Cannizzaro, L. A., McPherson, J. D., Wasmuth, J. J., and Iozzo, R. V. (1993) Molecular cloning of the human proto-oncogene Wnt-5A and mapping of the gene (WNT5A) to chromosome 3p14 –p21. Genomics 18, 249 –260. 33. Bui, T. D., Lako, M., Lejeune, S., Curtis, A. R., Strachan, T., Lindsay, S., and Harris, A. L. (1997) Isolation of a full-length human WNT7A gene implicated in limb development and cell transformation, and mapping to chromosome 3p25. Gene 189, 25–29. 34. van Bokhoven, H., Kissing, J., Schepens, M., van Beersum, S., Simons, A., Riegman, P., McMahon, J. A., McMahon, A. P., and Brunner, H. G. (1997) Assignment of WNT7B to human chromosome band 22q13 by in situ hybridization. Cytogenet. Cell Genet. 77, 288 –289. 35. Lako, M., Strachan, T., Bullen, P., Wilson, D. I., Robson, S. C., and Lindsay, S. (1998) Isolation, characterisation and embryonic expression of WNT11, a gene which maps to 11q13.5 and has possible roles in the development of skeleton, kidney and lung. Gene 219, 101–110.
1175