Molecular cloning and expression analyses of immunoglobulin tau heavy chain (IgT) in turbot, Scophthalmus maximus

Veterinary Immunology and Immunopathology 203 (2018) 1–12

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

Research paper

Molecular cloning and expression analyses of immunoglobulin tau heavy chain (IgT) in turbot, Scophthalmus maximus Xiaoqian Tanga,b, Yang Dua, Xiuzhen Shenga, Jing Xinga,b, Wenbin Zhana,b, a b

T

⁎

Laboratory of Pathology and Immunology of Aquatic Animals, KLMME, Ocean University of China, 5 Yushan Road, Qingdao 266003, China Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Turbot (Scophthalmus maximus) Immunoglobulin tau (IgT) Mucosal immune Gene cloning Gene expression response

Immunoglobulins (Igs) are humoral mediators playing the prevailing role in the innate and adaptive immunities of jawed vertebrates and provide obligatory duties to protect the organism from a wide variety of pathogens. In the present study, the membrane-bound and secretory immunoglobulin T (mIgT and sIgT) genes of turbot (Scophthalmus maximus) were cloned for the first time with the intention of better understanding the IgT functions. The mIgT cDNA is 2, 049 bp in length including a leader region, a variable region, four constant regions and a transmembrane region (TM), while the 1, 932 bp sIgT cDNA lacks the transmembrane region. In healthy turbot, the total IgT was highly expressed in gill, spleen and liver followed by peripheral blood leucocytes (PBL), skin and hindgut, and then in stomach, head kidney, trunk kidney, midgut and foregut. The expression levels of sIgT in PBL, gill, skin and spleen were much higher than mIgT. Furthermore, the expression profiles of turbot mIgT and sIgT were investigated post vaccination with formalin-inactivated Vibrio anguillarum via intraperitoneal injection and immersion, and the results showed that the expressions of mIgT and sIgT were both significantly induced by two administration routes, whereas intraperitoneal injection mostly induced mIgT expression in systematic organs including head kidney, spleen and trunk kidney, and the immersion vaccination elicited a much stronger response of sIgT in mucosa-associated tissues including gills, liver, hindgut and skin. Taken together, these results demonstrated that mIgT and sIgT were differentially expressed in different tissues and both responded positively to the vaccinations in turbot, and indicated that IgT-secreting plasma cells are abundant in mucosa-associated tissues and played important roles in mucosal immunity of turbot.

1. Introduction Immunoglobulins(Igs) expressed on the surface of mature B lymphocyte as B cell receptors (BCRs) or as antibodies (Abs) secreted into body fluids, such as serum and mucus, are playing important roles in the innate and adaptive immunities to eliminate extracellular and intracellular pathogens of jawed vertebrates (Flajnik and Kasahara, 2010; Parra et al., 2013). Five types of heavy chain immunoglobulins viz. IgM, IgD, IgG, IgA and IgE are reported in mammals, while teleost fish B cells were thought to express only two classes of immunoglobulins IgM and IgD. In zebrafish, a new immunoglobulin named IgZ (ζ) was discovered in 2005, while it was termed IgT (τ) in rainbow trout, and several isotypes, such as IgZ1, IgZ-2 and IgM-IgZ (μ-τ) chimera have been also identified (Danilova et al., 2005; Hansen et al., 2005; Hordvik et al., 1999; Hu et al., 2010). The transcripts of both membrane and secreted forms are generated from the IgT and IgM genes, and some teleosts also

appear to express the two forms of IgD (Hordvik et al., 1999; Stenvik and Jørgensen, 2000; Hordvik et al., 2002; Hirono et al., 2003; Saha et al., 2004; Bengten et al., 2002; Ramirez-Gomez et al., 2012). IgM monomer has been evolutionary conserved, comprising a primary structure with four constant Ig heavy chain domains (μ1–μ4), whereas IgD and IgT have exhibited structural divergence (Stenvik et al., 2001; Zhao et al., 2002; Danilova et al., 2005; Hu et al., 2010). It was believed that the IgT isotype occurs in most teleost fish as rainbow trout (Oncorhynchus mykiss), Atlantic salmon (Salmo salar) (Tadiso et al., 2011) and Pacific Bluefin tuna (Thunnus orientalis) (Mashoof et al., 2014), which was also reported as the orthologous molecule of IgZ in zebrafish (Danio rerio) (Zhang et al., 2012; Danilova et al., 2005; Hansen et al., 2005), fugu (Takifugu rubripes) (Savan et al., 2005a), carp (Cyprinus carpio) (Savan et al., 2005b) and stickleback (Gasterosteus aculeatus) (Gambón-Deza et al., 2010). Both the membrane and secreted forms in almost all fish species possess four Ig

⁎ Corresponding author at: Laboratory of Pathology and Immunology of Aquatic Animals, KLMME, Ocean University of China, 5 Yushan Road, Qingdao 266003, China. E-mail address: [email protected] (W. Zhan).

https://doi.org/10.1016/j.vetimm.2018.07.011 Received 12 January 2018; Received in revised form 15 July 2018; Accepted 29 July 2018 0165-2427/ © 2018 Elsevier B.V. All rights reserved.

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

SMARTerTM RACE cDNA Amplification Kit (Clontech Laboratories, Mountain View, CA). Primers, qIgT-F and mIgT-R (Table 1) were designed at the beginning of the 5'UTR region and the 3'UTR to amplify the full length of mIgT cDNA, and qIgT-F and sIgT-R were finally used to amplify the full cDNA of sIgT. Meanwhile, the genomic DNA was isolated from gill and kidney of the healthy turbot with a marine animal genome extraction kit (Tiangen, China) and amplified with 6 primer pairs (Table 1, CH1-F, CH2-F, CH3-F, CH4-F, CH2-R, CH3-R, CH4-R, TmR, SecR). The products were disposed as before and sequenced.

domains (τ/ζ1–τ/ζ4) as rainbow trout IgT and zebrafish IgZ (Danilova et al., 2005; Hansen et al., 2005), but in stickleback and fugu the IgZ gene encodes only three and two constant Ig domains respectively (Deza et al., 2009; Bao et al., 2010), which indicates IgT gene structure varies among teleosts. Interestingly, an Ig heavy chain chimera of IgMIgT was found in common carp which consists of an IgM μ1 domain and an IgZ ζ4 domain (Savan et al., 2005b). Recently, an independent homologue membrane-bound IgZ was reported in zebrafish (Hu et al., 2010), indicating that IgZ variants are encoded by different genes except alternative splicing. So, there was a divergence of IgZ/T genes structure in bony fishes, further cloning of IgT genes from teleost would provide a deeper insight not only into molecular evolution but also into the origin of structural diversity. The IgT in the gut and skin mucus was found mainly in polymeric form (Zhang et al., 2010; Xu et al., 2013), but in serum it was monomeric (Sunyer et al., 2009; Flajnik, 2010). IgT was well proved to play important roles in mucosal immunity in the gut (Zhang et al., 2010), skin (Xu et al., 2013) and gill (Xu et al., 2016) in rainbow trout, and the IgT-positive cells were also exhibited to have positive responses against viral and bacterial infections (Castro et al., 2013; Du et al., 2016) and DNA vaccination (Castro et al., 2014). Moreover, in situ hybridisation and immunohistochemistry studies revealed that IgT-positive cells were mainly present in the gills of mandarin fish (Siniperca chuatsi) and fugu (Savan et al., 2005a,b; Tian et al., 2009), which further indicated that IgT participated in gut and gill mucosal immunity. Taken together, these results suggest that IgT not only acts as a mucosal antibody, but plays important roles in systemic immune responses in teleost fish. Turbot (Scophthalmus maximus) is an important economic species cultured in northern China. However, fish intensive culture resulted in disease outbreaks and huge economic losses. In the past few years, though the information of genome and expressed sequence tags (ESTs) in turbot were increasingly accumulated (Pereiro et al., 2012; Ribas et al., 2013), the gene sequence and structure of the IgT were still unknown. Therefore, in the present study, we aimed to clone turbot (Scophthalmus maximus) IgT heavy chain gene by RACE method. Meanwhile, the mRNA transcript characteristics of IgT gene in different tissues of healthy turbot were analyzed by RT-PCR. The expression of IgT in turbot vaccinated by intraperitoneally (i.p.) injection and immersion with formalin-inactivated Vibrio anguillarum was further investigated to understand the biological functions of mIgT and sIgT in systematic and mucosal immune responses.

2.3. Sequence and phylogenetic analysis Open reading frame (ORF) were found by the online program GENSCAN (http://genes.mit.edu/GENSCAN.html), and also by blasting genomic stretches against protein databases at NCBI (blastx). Immunoglobulin domains were predicted by PROSITE database (Falquet et al., 2002). The trans-membrane domain was predicted using the online program ‘TMpred’ (http://www.ch.embnet.org/software/ TMPREDform.html) and N-linked glycosylation sites were predicted by the NETNGLYC 1.0 server (www.cbs.dtu.dk/services/NetNGlyc). The draft genome databases and expressed sequence tag (EST) databases distributed at Swiss-Prot protein databases, Expasy, Ensembl, UCSC Genome Browser and TIGR were employed to retrieve the immunoglobulin molecules. Multiple alignments of sequences were conducted using the Clustal W program (version 1.83) (Thompson et al., 1994). On the basis of the alignment, phylogenetic trees were constructed with the program MEGA 5 software using neighbor-joining method. The isoelectric point (pI), potential N-glycosylation sites, and the molecular weight (MW) of the deduced IgT proteins were calculated by the Expert Protein Analysis System (http://expasy.org/tools/). 2.4. Preparation of inactivated Vibrio anguillarum bacterin The strain of V. anguillarum was isolated previously and stored in our laboratory (Xing et al., 2017), which was grown in seawater LuriaeBertani (LB) medium broth at 28 °C for 24 h, then the bacteria were harvested for inactivation with formalin solution (0.5% v/v) at 4 °C for 48 h. The inactivated cells were washed three times with sterilized 0.01 M phosphate buffered saline (PBS, pH 7.2) by centrifuging at 8000 × g for 10 min at 4 °C. After last wash, the concentration of bacterin suspension was adjusted to 1.0 × 1010 CFU ml−1 and stored at −20 °C for later use. The safety of the bacterin was checked by culturing the cells on BHI agar at 28 °C for 72 h and intraperitoneally injecting into healthy turbot (1 × 108 CFU/ml, 200 μl/fish), and no bacterin was growing on BHI agar and no mortality of fish was observed in the injected turbot.

2. Materials and methods 2.1. Fish Healthy Turbot (average weight: 30–35 g) were obtained from a fish farm in Haiyang city, of Shandong province, China. The fish were maintained at a temperature of 20–21 °C in aerated tanks with 500 L of volume supplied with a continuous flow of sand-filtered seawater. The salinity of the seawater was 2.9–3.0% and the dissolved oxygen was 6.8 mg/L. Fish were fed twice daily with commercial feed.

2.5. Fish vaccination and sampling In order to determine the transcript levels of total IgT, mIgT and sIgT in the healthy turbot, five fish were euthanized in 300 ng/ml MS222 for 15 min, whole blood was sampled from caudal vein for isolation of peripheral blood leucocytes (PBL) as previously described (Du et al., 2016), and gill, skin, spleen, head kidney, trunk kidney, liver, foregut, midgut, hindgut, muscle, stomach and heart were sampled using sterile scalpel blade. Meanwhile, in order to investigate the biological functions of mIgT and sIgT in systematic and mucosal immune system, the dynamic expressions of mIgT and sIgT were detected post vaccination by injection or immersion. For injection vaccination, 50 fish were intraperitoneally (i.p.) immunized with inactivated V. anguillarum bacterin (1 × 108 CFU/ml, 200 μl/fish), and the fish injected with phosphate buffered saline (PBS) was performed as control. For immersion vaccination, 50 fish were immersed (i.m.) in 50 L seawater for 60 min with 1 × 108 CFU/ml of inactivated V. anguillarum, and untreated fish were served as control. At 1, 2, 3, 5, 7, 14, 21 and 28 d post immunization (p.i.), gill,

2.2. Cloning of IgT cDNA and genomic DNA A partial IgT cDNA sequence were amplified using the degenerate primers IgT-F and IgT-R (Table 1), which were designed based on the conserved regions from the alignment of IgT amino acid sequences from other teleost fish as described previously (Du et al., 2016). The PCR products were electrophoresed by 2% agarose gel and purified with a commercial gel extraction kit (Tiangen, China). The purified PCR products were then subcloned into a pMD19-T Vector (TaKaRa, Otsu, Japan) and sequenced. The rapid amplification of cDNA ends (RACE) method was performed with gene specific primers IgT 3′-1st′/ IgT 3′nested and IgT 5′-1st / IgT 5′-nested (Table 1) designed according to the obtained segment and the adaptor primer UPM/NUP (Table 1) by 2

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Table 1 Primers used for gene cloning and qPCR in this study. Primer name

Oligonucleotide sequence

Core segment PCR IgT-F IgT-R

5′- ACAGTGACACTGAAMCMWCCAAGT -3 5′- GTYACMAGYGTYTWCACCATC -3

RACE PCR IgT 3′-1st′ IgT 3′-nested IgT 5′-1st IgT 5′-nested UPM NUP

5′-CCCTACTGACCTTTAAGCCA-3 5′-CGATCACCAATGTTCACTGC-3′ 5′-AGGCAGCACAGGTAACAGGT-3′ 5′-TTGGTGTGTATGCTGAAAGAT-3′ 5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′ 5′-AAGCAGTGGTATCAACGCAGAGT-3′

Full-length validation qIgT-F mIgT-R sIgT-R CH1-F CH2-F CH3-F CH4-F CH2-R CH3-R CH4-R Tm-R Sce-R

5′-TCTCACGCACGATTTCCCTC-3′ 5′-TGAAGGAGGAGGTTGTGGAC-3′ 5′-TTCAAGGGCGTAACCCATAC-3′ 5′-GCAAACCTGAGGCTGAAGAT-3′ 5′-AGGATTCTTCCTCCAAAAGTGAC-3′ 5′-GAGTCTGGAGGCAGTCAGCAC-3′ 5′-GACGTTGCAGTTGAACATGTAC-3′ 5′-AGTCACTTTTGGAGGAAGAATC-3′ 5′-TCCTTTCAAGACAGCCAGATCT-3′ 5′-TGGGGGAATATCCTTAGACACTC-3′ 5′- TCATCTTGACCAGGCTGAATA -3′ 5′- TACATTCAAGGGCGTAACCCA -3′

RT-PCR qRT-PCR IgT1-F IgT1-R IgT2-F IgT3-F mIgT2-R sIgT2-R β-actin F β-actin R

5′-CGACTCTGTTCCCTTTGGTTC-3′ 5′-GTTTTCCTCCGTAAGTTGCCT-3′ 5′-GAAAGGAGATGGGAGACAG-3′ 5′-GGTTACTCTGTTACAAGCGTT-3′ 5′-TTGCTTCATCTTGACCAGGC-3′ 5′- TATGGGTTACGCCCTTGAATG -3′ 5′- GATGGTGGGTATGGGCCAGAAG -3′ 5′- ATGTCACGCACGATTTCCCTCTC -3′

RACE, rapid amplification of cDNA ends; Ig, immunoglobulin; qRT, quantitative real time (−PCR); F, forward; R, reverse.

used to amplify a 537 bp gene fragment of total IgT, and the specific primers IgT2-F and mIgT2-R were used to amplify a 496bp gene fragment of mIgT, the specific primers IgT2-F and sIgT2-R were used to amplify a 354bp gene fragment of sIgT, actin primers β-actinF and βactinR were used as the internal control. PCR amplification was performed under the following conditions: 1 cycle of predenaturation at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 60 s, followed by a final extension of 72 °C for 10 min. The PCR products were gel-extracted and pictures were taken. The cloned amplicons were confirmed by sequencing. All the information of primers used are listed in Table 1.

skin, spleen, head kidney, trunk kidney, liver, foregut, midgut and hindgut were sampled from five fish. The tissues were immediately put into RNAlater (Tiangen, Beijing, China) and stored at −80 °C until use. In this study, the methods used in the animal experiments were approved by the Instructional Animal Care and Use Committee of the Ocean University of China (permit number: 20150101). All possible efforts were made to minimizing suffering. 2.6. Total RNA isolation and cDNA synthesis Total RNA was extracted from the sampled tissues of the healthy and vaccinated fish using the Trizol reagent (Invitrogen, Carlsbad, USA). The qualities and quantities of the purified RNA were determined by measuring the absorbance at 260 nm/280 nm using a Nanodrop ND1000 spectrophotometer (NanoDrop Technologies, USA). In order to normalize the gene expression levels for each sample, same amounts (1000 ng) of the total RNA were used for first-strand cDNA synthesis in a 20 μl reaction volume with an SMART PCR cDNA Synthesis Kit (Clontech, Mountain View, USA) according to manufacturer’s instructions. The synthesized cDNA was diluted with 75 μl of RNase-free water and used as template for RT-PCR and quantitative real-time PCR (qPCR).

2.8. qPCR analysis of mIgT and sIgT expressions in vaccinated turbot In order to determine the expression responses of mIgT and sIgT, the specific primers IgT3-F and mIgT2-R were designed for mIgT amplification of a 285 bp gene fragment, and the primers IgT3-F and sIgT2-R were used for sIgT amplification of a 143 bp gene fragment, and the primers β-actinF and β-actinR were used to amplify turbot β-actin gene fragment as the internal control (Table 1). All of the primer pairs used in qRT-PCR were qualified and the efficiencies were ranged from 90% to 105%, and the specificity of each primer pair was verified by monitoring the dissociation curve of the PCR products. qPCR was performed using a Roche480 real-time PCR system (LightCycler480, USA). Each qPCR was performed in a total volume of 20 μl containing 10 μl of SYBR Green I Master, 0.4 μl each of forward and reverse primers (10 mM), 2 μl of diluted cDNA and 7.2 μl of RNase-free water. The thermal cycling profile consisted of an initial denaturation at 95 °C for 30 s, followed by 45 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s. An additional temperature-ramping step was

2.7. Quantitative RT-PCR analysis of total IgT, mIgT and sIgT expression in healthy turbot The expression of total IgT, mIgT and sIgT mRNA in tissues of healthy fish, including PBL, gill, skin, spleen, head kidney, trunk kidney, liver, foregut, midgut, hindgut, muscle, stomach and heart were detected by RT-PCR. Two gene specific primers IgT1-F and IgT1-R were 3

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Fig. 1. A. Compiled full-length IgT (mIgT and sIgT) cDNA sequence of turbot (Scophthalmus maximus). Features highlighted include the start and stop codon and a potential glycosylation site. The putative signal peptide is underlined. In the 3′UTR the RNA instability motifs (ATTTA) are in boldface and the poly (A)+ signal (AATAAA) is in boldface of mIgT (GenBank accession: KU934277). Exons are in uppercase and introns are in lowercase. The translation of the exon-coding regions is also given, and the stop codon is indicated with an asterisk. Intron splice sites are boxed. The sequence was divided into VH and four CH domains on the basis of sequence comparisons with the IgH chains of other teleosts. B. Nucleotide and deduced amino acid sequences of secretory tail part of sIgT (GenBank accession: KU934278). The atypical polyadenylation signal (AATTAAA) in the 3′UTR was shaded in red grey. C. The genomic organization of constant region of turbot IgH (mIgT and sIgT) locus with τ exons. The coding region was indicated by black boxes. Tm: transmembrane region. Graph was draw to scale.

the significance level was defined as p < 0.05.

utilized to produce melting curves of the reaction from 65 to 95 °C. Three independent qPCR experiments were performed.

3. Results 2.9. Statistical analysis 3.1. Characterization of turbot IgT nucleotide and deduced amino acid sequences

The qRT-PCR data were analyzed using MX Pro-Mx3000P Multiplex Quantitative PCR system Software and the relative expression ratio (R) of mRNA was calculated according to the formula 2−△△Ct (Livak and Schmittgen, 2001). The data were normalized for each gene against those obtained for β-actin. All the statistical analysis was carried out with SPSS 19.0 software (SPSS Inc., IBM, Armonk, NY, USA). The differences were determined using a one-way analysis of variance (ANOVA). In all cases, the results were expression as means ± S.D. and

The full-length of cDNA sequences of mIgT and sIgT were obtained by RACE method and submitted to NCBI (mIgT GenBank accession nr: KU934277, sIgT GenBank accession nr: KU934278). The heavy chain of membrane IgT (mIgT) cDNA was 2049 bp in length with an open reading frame (ORF) of 1818 bp cDNA was, a 15 bp 5'-untranslated sequence (UTR) and a 216 bp 3'-untranslated sequence (UTR), encoding 4

Gasterosteus aculeatus

Epinephelus coioides Lutjanus sanguineus

Trematomus bernacchii Notothenia coriiceps Plecoglossue altivelis Dicentrarchus labrax

Megalabrama amblycephala Paralichthys olivaceus

Scophthalmus maximus

Grouper Red snappers

Antarctic fish Black rockcod Sweetfish European seabass

Wuchang bream Flounder

Turbot

Siniperca chuatsi Ctenopharyngodon idella

Perciformes Grass carp

Stickleback

Oncorhynchus mykiss Takifugu rubripes Salmo salar

Rainbow trout Fugu Atlantic salmon

Cyprinus carpio

Danio rerio

Zebrafish

Common carp

Species

Isotypes

5

IgT

IgZ IgT

IgT IgT IgT IgT

IgZ IgZ

IgT1, IgT2, IgT3, IgT4

IgZ IgT1 IgT2 IgT1 IgT2 (chimeric IgM-IgT)

IgT2

IgT2 IgT IgT IgT4, IgT5

IgT1

Potentially functional IgT/Z Subtypes

(VHDτJτCτ-DμJμCμCδ)3VHDτJτCτ

Data not available

VHDζJζCζ-DμJμCμCδ

Cζ1-Cζ2-Cζ3-Cζ4-(Sec) Cζ1-Cζ2-Cζ3-Cζ4-(TM or Sec) Cτ1-Cτ3-Cτ4-(TM or Sec) Cτ1-Cτ3-Cτ4 -(Sec) Cτ1-Cτ2-Cτ4-(TM or Sec) Cτ1-Cτ2-Cτ3-Cτ4-(TM or Sec) Cζ1-Cζ2-Cζ3-Cζ4-(Sec) Cτ1-Cτ2-Cτ3-Cτ4-(TM or Sec) Cτ1-Cτ2-Cτ3-Cτ4-(TM or Sec)

Cτ1–Cτ3-Cτ4 (TM or Sec)

Cζ1-Cζ2-Cζ3-Cζ4-(TM) Cμ1——Cζ4(Chimera type)

Cζ1-Cζ2-Cζ3-Cζ4-(Sec) Cζ1-Cζ2-Cζ3-Cζ4

Cτ1-Cτ2-Cτ3-Cτ4 Cζ1–Hb—Cζ4 (TM or Sec) Cτ1-Cτ2-Cτ3-Cτ4-(TM or Sec)

Cζ1-Cζ2-Cζ3-Cζ4-(TM or Sec)

VHDζJζCζ-DμJμCμCδ

VHDτJτCτ-VHDμJμCμCδ VHDζJζCζ-DμJμCμCδ locus A: (VHDτJτCτ)5VHDμJμCμCδ locus B: (VHDτJτCτ)3VHDμJμCμCδ

Constant region

Organization of igh locus

Table 2 Organization of teleost igh loci and the constant regions encoded by ighτ/ζ.

AMQ49169.1 AMQ49170.1

AGR34024.1 ANS12794.1; ANS12795.1

AKA09865.1; AKA09825.1 AKA09827.1; BAP75402.1; BAP75403.1 AKK32392.1; AKK32393.1

GU182366 AIC33829.1; AIC33828.1

BOARD S1, scaffold 11, 12.25–12.5Mb (ver.55.1j)

CA964701, AB004105, AU301009

DQ016660 DQ478943, DQ489733

AY870263–68, AY872256–57 AB194131–33, AB201354–55, AB217616–620

AY643750; AY643752; AY646263–282; AY735995; AAT67444, EU732710

mRNA/gene accession no.

Xia et al. (2016) Du et al. (2016)

Giacomelli et al. (2015) Giacomelli et al. (2015) Kato et al. (2015) Picchietti et al. (2016)

Gambón-Deza et al. (2010) and Bao et al. (2010)

Tian et al. (2009) Xiao et al. (2010) DQ478943 Ryo et al. (2010) Savan et al. (2005a) and Ryo et al. (2010)

Hu et al. (2010) Hansen et al. (2005) Savan et al. (2005b) Yasuike et al. (2010) and Tadiso et al. (2011)

Danilova et al. (2005)

References

X. Tang et al.

Veterinary Immunology and Immunopathology 203 (2018) 1–12

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

(caption on next page)

6

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Fig. 2. Alignment of translated IgT/IgZ sequences. A: Analysis of the turbot IgT variable region with other species. B: The first alignment shows CH1-CH4 and a segment encoding the membrane proximal extracellular part, the transmembrane peptide, and a short cytoplasmic tail (Cy). Cysteine and tryptophan residues are shaded light grey and dark grey respectively. The conservative cysteine (C) residues in CH1 domain linked to the immunoglobulins light chain to form inter chain disulfide bonds are labeled with arrows (↑). The conserved cysteine (C) residues in each CH domain used to form disulfide bonds in the chain was labeled by black bold, and the resulting disulfide bond is represented by a black line. The conservative tryptophan (W) residues, which play a key role in protein three-dimensional conformation, are labeled below the sequence. The C-terminal part of the secreted forms of the IgT, which is encoded by the CH4 exon, the letters are shown in the shadow. Predicted N-glycosylation sites are in black bold. * denotes identity, and - indicates gaps. Asterisks indicate the stop codon. White boxes represent deleted regions. The conserved antigen receptor transmembrane motif, CART (TxxxFxxLxxxSxxYx). GenBank accession numbers for membrane-bound and secretory-bound sequences IgT/IgZ are as following: Scophthalmus maximus (AMQ49169.1/AMQ49170.1); Paralichthys olivaceus (ANS12794.1/ANS12795.1); Lutjanus sanguineus (AIC33829.1/AIC33828.1); Bovichtus diacanthus (AKA09866.1/AKA09828.1); Trematomus bernacchii (AKA09865.1/AKA09826.1); Oncorhynchus mykiss (AAW66980. 1/AAW66981.1); Salmo salar (ACX50290.1/ACX50293.1); Danio rerio (AAT67444.1/AAT67446.1); Ctenopharyngodon idella (ABY76180.1/ADD82655.1).

Table 3 Closest reference gene and allele(s) from the IMGT V domain directory (All species). Species

Gene and allele

Domain

Domain label

Smith-Waterman score

% identity

Overlap

Trematomus bernacchli Oncorhynchus mykiss Notothenia coriliceps Salmo salar Trematomus bernacchli Oncorhynchus mykiss

IGHV2S1*01 IGHV5S3*01 IGHV1S4*01 IGHV5S10*01 IGHV2S2*01 IGHJ3*01

1 1 1 1 1 1

VH VH VH VH VH VH

556 557 540 538 537 86

85.6 83.5 83.5 82.7 82.7 78.6

97 97 97 98 98 14

turbot clustered with the group of other teleosts mIgτ/ζ, mIgμ and mIgδ at a high level of statistical confidence, and turbot τ and μ were clustered closely with flounder, but turbot δ was not clustered closely together with flounder. By comparing of the constant domains, turbot IgT Cτ1–Cτ4 showed a maximum similarity of 100% with that of flounder, turbot IgM Cμ1, Cμ2, Cμ3 and Cμ4 showed maximum similarity of 67%, 53%, 53% and 78% with that of flounder, and turbot IgD Cζ1-Cζ7 showed maximum identity of 53%, 54%, 70%, 67%, 69.5%, 67.3%, 70.9%, 73.8% and 78.3% with that of flounder, respectively (Table 4).

a single-spanning transmembrane protein of 605 amino acid residues, which possessed a 21-amino acid signal peptide, a variable region, four constant regions (CH1, CH2, CH3 and CH4), a transmembrane region (TM) and a 51-amino acid intracellular region. A 385 bp intron exists between CH1 and CH2, 107 bp intron between CH2 and CH3, 96 bp intron between CH3 and CH4, and last intron of 483 bp between CH4 and TM. All the exon-intron boundaries and the splicing sites were determined and mapped by comparing the cDNAs and genomic sequences. The relative molecular weight (MW) of mIgT was 67.06 kDa and the isoelectric point (IP) was 7.37 (Fig. 1A). The cDNA sequences of secreted IgT (sIgT) was 1, 932 bp, containing an ORF of 1, 686 bp encoding 561 amino acid residues (MW = 61.96 kDa, IP = 8.31) with a leader region, variable region, four constant regions (CH1, CH2, CH3 and CH4) and a C-terminal (Fig. 1B). sIgT shares the same introns among CH1–CH4 with mIgT, but there was no intron between the CH4 and secretory tail region (Table 2).

3.3. Tissue distribution of total IgT, mIgT and sIgT transcripts in healthy turbot The expression patterns of total IgT, mIgT and sIgT in healthy turbot were investigated using RT-PCR. As shown in Fig. 4, the transcript levels of total IgT were highly expressed in gill, PBL, spleen, head kidney, trunk kidney and liver, followed by skin, hindgut, foregut and midgut, but expressed at a very low level in muscle, stomach and heart. Moreover, the mIgT and sIgT were differentially expressed in different tissues. The expression level of mIgT was a bit higher than sIgT in trunk kidney and liver, but lower in PBL, gill, skin, spleen and hindgut. Similar expression levels were observed in head kidney, foregut and midgut, and both mIgT and sIgT were low expressed in muscle, stomach and heart (Table 4).

3.2. Multiple sequences alignment and phylogenetic analysis The amino acid sequence of turbot IgT variable region was highly similar with those of other species (Fig. 2A1), which shared 85.6% with Trematomaus bernacchli (IGHV2S1*01), 83.5% with Oncorhynchun mykiss (IGHV5S3*01) and Notothenia coriliceps (IGHV1S4*01), 82.7% with Salmo salar (IGHV5S10*01) and Trematomaus bernacchli (IGHV2S2*01), and the JH was shared 78.6% with Oncorhynchun mykiss (IGHJ3*01) (Table 3). The identified variable region invariantly harbored two cysteines (international immunogenetics information system (IMGT) numbering 23 and 104) that were important for intradomain disulfide bridge, Trp41 residue in the FR2 region and the YYS motif in the FR3 region. The CDR3 region is encoded by the DH and JH segments and has two typical conserved ××FDYWG and ×GT×VT×TS motifs conserved (Fig. 2A2). Multiple sequences alignment analysis showed the turbot mIgT gene consisted of one variable domain (V), four Ig-like constant domains (Cτ1–Cτ4) and a short transmembrane region (TM), which shared 100% amino acid sequence identity with flounder (Paralichthys olivaceus) in the constant region (Fig. 2B). The variable domain is organized into three complementarity determining regions (CDR) separated by four framework regions (FR). The phylogenetic relationship of turbot τ, μ and δ to other teleosts IgH genes was examined by analysis of deduced amino acid sequences of the membrane-form H-chain C region. As shown in Fig. 3, the clustering pattern of different isotypes were highly consistent with respect to the τ, μ and δ genes. The τ, μ and δ genes of

3.4. Expression responses of mIgT and sIgT post injection vaccination with V. anguillarum After intraperitoneal injection with formalin-killed V. anguillarum, the transcriptional levels of mIgT and sIgT in all the tested tissues of turbot significantly increased as compared with the control group (Fig. 5). In general, the mIgT exhibited a much stronger response to the injection vaccination in the head kidney, spleen and trunk kidney as compared with sIgT, especially in head kidney, where the expression level of mIgT reached a peak value of 260-fold over the control at day 7 (Fig. 5C–E). In contrast, comparing with the mIgT, the sIgT showed a much stronger response in gill, skin and liver with their peak levels at 2–3 d p.i. (Fig. 5A, B and F). The strongest response of sIgT was observed in gill with an up-regulated expression level of approximately 210-fold over the control group (Fig. 5A). In the gut, the mIgT exhibited a much quicker response to the injection vaccination as compared with the sIgT, and the peak expression levels occurred within 3 days p.i. However, the sIgT showed different expression profiles in foregut, 7

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Fig. 3. Phylogenetic tree analysis of immunoglobulin family members from flounder and other species. The accession number for each sequence followed the common species name.

Table 4 Amino acid sequence identity matrix of the single constant domains of IgT (τ1–τ4), IgM (μ1–μ4) and IgD (δ1–δ7) between Scophthalmus maximus (IgT: AMQ49169.1; IgM: AHN62819.1; IgD: AFQ38975.1) and Paralichthys olivaceus (IgT: KX174301; IgM: AB052744; IgD: AB052658). Font bold and grey shadow denote the maximum similarity of amino acid sequence each row.

8

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Fig. 4. The IgT, mIgT and sIgT mRNA transcripts in different tissues of turbot (Scophthalmus maximus) was determined by RT-PCR analysis. PBL: peripheral blood leucocytes; Gi: gill; Sk: skin; SL: spleen; HK: head kidney; TK: trunk kidney; Li: liver; Fg: Foregut; Mg: Midgut; Hg: Hindgut; Mu: muscle; St: stomach; He: heart.

Fig. 5. The expression profiles of mIgT and sIgT determined by qPCR in nine tissues of turbot post intraperitoneal injection vaccination with formalin-killed Vibrio Anguillarum. Values are presented as means ± standard deviation (n = 3), and the asterisk represents statistically significant difference in the expression level of sIgT or mIgT when compared with their control groups (P < 0.05).

midgut and hindgut, the significantly higher expression levels of sIgT was observed at day 5 and 28 in foregut, while in hindgut it occurred at 2–14 d p.i (Fig. 5G– I).

than the sIgT. Interestingly, the expression of mIgT and sIgT both displayed strong responses post immersion vaccination in gill, and reached their peak levels of > 100-fold over the control at day 5 (Fig. 6A).

3.5. Expression responses of mIgT and sIgT post immersion vaccination with V. anguillarum

4. Discussion Immunoglobulins are immune effector molecules secreted by B lymphocytes after activation and proliferation in vertebrates, which play vital roles in recognizing and binding antigen in the process of immune response. In turbot, the gene information of IgM and IgD were available, whereas IgT has not been reported. This work presents the first description of turbot membrane and secreted IgT genes, and the mIgT and sIgT cDNA both contain a leader region, a variable region, four constant regions (CH1, CH2, CH3 and CH4), but with a different C terminal part. The constant domains of mIgT and sIgT were in accordance with the IgHτ/ζ structures of the trout (Cτ1–Cτ4) and zebrafish (Cζ1–Cζ4), and the amino acid sequence present 100% similarity with flounder IgT. Although the basic structure of IgT/Z is conserved, a wide divergence of the IgH chain loci organization occurs among

Post immersion vaccination with inactivated V. anguillarum, both mIgT and sIgT mRNA levels appeared to increase in all the detected tissues. Compared with mIgT, the expression levels of sIgT in skin, liver, midgut and hindgut exhibited much stronger responses (Fig. 6B, F, H and I). In liver, the sIgT showed a quick response and reached peak level of about 100-fold over the control at day 1 post immersion vaccination (Fig. 6F). Similarly, the sIgT mRNA in midgut and skin also exhibited quick responses and reached their peak levels at day 2 and day 5, respectively (Fig. 6B and H). In the hindgut, the expression level of sIgT significantly increased post immersion vaccination and reached peak level at day 14 (Fig. 6I). In contrast, the expression levels of mIgT in spleen, head kidney and foregut showed much stronger responses 9

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Fig. 6. The expression profiles of mIgT and sIgT determined by qPCR in nine tissues of turbot post immersion vaccination with formalin-killed Vibrio Anguillarum. Values are presented as means ± standard deviation (n = 3), and the asterisk represents statistically significant difference in the expression level of sIgT or mIgT when compared with their control groups (P < 0.05).

different fish species. In T. rubripes, only two constant domains corresponding to the trout Cτ1 and Cτ4 linked by a hinge-like region, unraveling that the fugu IgT has lost the second and the third domains during evolution (Savan et al., 2005a; Fu et al., 2015). In common carp, IgZ1 contained four constant domains, while IgZ2 is a chimeric form with two constant domains μ1 and ζ4 which was transcripted only via the stimulation of toxin (Savan et al., 2005b; Ryo et al., 2010). In addition, recent findings showed that Cτ2 was lost in Trematomus bernacchii and Notothenia coriiceps (Giacomelli et al., 2015), and Cτ3 was absent in Plecoglossue altivelis (Kato et al., 2015), further demonstrating the high structural diversity of IgHτ/ζ. Moreover, each Ig-like constant area of founder IgT contained two conserved cysteine and tryptophan residues, which might be involved in the formation of intradomain disulphide bond and might play a decisive role in the formation and maintenance of the immunoglobulin domain architecture (Beale and Feinstein, 1976). Apart from the conserved cysteine, an extra cysteine residue occurred ion CH1, which might be important to connect the H chain to the L chain, and two additional cysteine residues within the CH3 maybe assisting the connection of the H chain dimerisation. The turbot immunoglobulin IgT heavy (IgH) chain is encoded by the genomic loci of igh as other teleost species (Yasuike et al., 2010; Xiao et al., 2010; Zhang et al., 2011), the V domain was encoded by the variable (V), diversity (D) and joining (J) gene segments, and the C domain was encoded by the constant (C) gene segments. The V domain of the IgH chain is composed of three hypervariable CDRs that are separated by four FRs. The diversity of the V domain is provided mostly by the three CDRs, among them, the CDR1 and CDR2 are encoded by the V gene alone, whereas CDR3 is encoded by the V-D-J rearrangement junction, which was similar with turbot IgM (Schroeder and Cavacini, 2010; Gao et al., 2014). In mammals, birds and amphibians, the membrane form of μ chain was generated by splicing the μTM1 exon into a cryptic donor splice site

(T/C/G↓GGTAAA) within the Cμ4 exon (Peterson and Perry, 1989). However, the cryptic donor splice site within Cμ4 is lacking in teleost, so the production of membrane form of μ chain occurs by splicing the TM sequences directly to the donor splice site at the 3′ boundary of the Cμ3 exon (Bengten et al., 2002). The membrane form of IgT is generated by splicing from a cryptic splice site in Cτ4 to the first transmembrane exon, similar to the membrane form of mammalian IgM, but different from the splicing from Cμ3 to the first transmembrane exon that generates the membrane form of teleost. Our results support this finding because a cryptic splice site (A/T↓GGTA/T) appeared in turbot Cτ4. The transmembrane region contains residues typical of B cell receptors, including hydrophobic and hydrophilic residues consistent with the CART domain and Thr, Ser and Tyr residues known to be essential for association with the B cell coreceptors CD79A/B (Campbell et al., 1994). Pathogen neutralization provided by mucosal immunity is an essential first line defence for vertebrates, which is executed by the polymeric IgA isotype. Comparative analysis has determined that the PX3NXS_TL_VX4E_DX4CY motif is typically required for multimeric polymerization, where the N-linked glycosylation site and penultimate cysteine are critical for association of the J chain (Yoo et al., 1999; Wiersma et al., 1997). For IgT, it contains an N-linked glycosylation site near the end of CH4 and a Cys residue in the secretory tail, but overall, this region bears little similarity to the motif required for J-chain association. In addition, IgT lacks the obvious hinge features typical of IgA, but interestingly, there are five Pro residues near the CH1 and -2 junction, suggesting that this region may be flexible. Turbot and flounder have a close genetic relationship, the genetic information of IgM, IgD and IgT in Paralichthys olivaceus confirmed that secretory IgM consists of CH1–CH4 while the membrane-bound type IgM consists of CH1–CH3 and two transmembrane regions TM1 and TM2. IgD gene was located downstream IgM gene, which contains seven exons and two membrane-bound regions (Srisapoome et al., 10

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

References

2004). Membrane-bound and secretory form IgT both consists of CH1–CH4 (Du et al., 2016). The structure of turbot IgM, IgD and IgT were similar with flounder (Gao et al., 2014). The comparison of the amino acid sequences of constant domains of IgT, IgM and IgD between turbot and flounder revealed that IgT displayed a highest similarity, which indicated that the IgT between these two fish species was more conserved in evolution than IgM and IgD. The expression of IgT showed a certain tissue specificity, but still exhibited differences among fish species. Zebrafish IgZ is mainly expressed in lymphoid organs, including thymus (Danilova et al., 2005). The IgT mRNA levels in ayu (Plecoglossus altivelis) are higher in spleen, head kidney, trunk kidney and gill (Kato et al., 2015). The present study showed that the total IgT (mIgT and sIgT) expression level was much higher in gill, PBL, skin, spleen, head kidney, trunk kidney, liver and hindgut than that in other tested tissues, which was in line with the report in flounder (Du et al., 2016). It’s known that membrane-bound immunoglobulin T (mIgT) molecules are antigen specific receptors expressed on the B cell membrane and deliver signals upon crosslinked by antigens, whereas sIgT is produced by plasma cells and secreted into body mucus as effector molecules (Zhang et al., 2010). This work further showed that the transcripts of mIgT and sIgT in healthy turbot were differentially distributed in different tissues, mIgT transcript was much higher than sIgT in trunk kidney and liver, but lower in PBL, gill, skin, spleen and hindgut. These results implied that the IgT-secreting plasma cells are abundant in mucosa-associated lymphoid tissues of turbot, whereas naïve IgT+B cells mainly distributed in systemic tissues. It has been reported previously that mIgT/Z or sIgT/Z or total IgT/Z could be induced by vaccination and infections. For instance, the transcripts of IgZ1 and IgZ2 in common carp changed a lot in both systemic organs and mucosal organs post stimulation with Trypanoplasma borreli, and similar results were also found in Megalobrama amblycephala (Ryo et al., 2010; Xia et al., 2016). The secretory IgZ of trout was significantly upregulated upon the treatment with V. anguillarum bacterin or Escherichia coli lipopolysaccharide (Zhang et al., 2010). In the present work, the responses of mIgT and sIgT transcripts were both investigated in mucosal and systemic immunity, the results showed that the expressions of mIgT and sIgT were both significantly increased after intraperitoneal injection and immersion vaccinations with a formalin-killed V. anguillarum, which was in accordance with results reported in other teleost fishes, such as Atlantic salmon (Tadiso et al., 2011), fugu (Savan et al., 2005a,b), and rainbow trout (Hansen et al., 2005). Moreover, a much stronger response of sIgT was observed post vaccinations in mucosal tissues such as gill, skin and hindgut, whereas the mIgT exhibited stronger responses in systematic organs such as spleen and kidney. In addition, the immersion vaccination could induce higher expressions of sIgT in the mucosal tissues, and the injection vaccination induced higher levels of mIgT transcripts in the systematic organs. These data indicated that the IgT-secreting plasma cells are abundant in mucosa-associated tissues, and the sIgT as effector molecules played important roles in mucosal immunity of turbot. Taken together, the fundamental knowledge of the IgT genetic structure, expression pattern and immune responses are of potential importance for the future design of novel immunotherapies that not only stimulate systemic immunity, but also mucosal immune responses to control disease in the turbot aquaculture industry.

Bao, Y., Wang, T., Guo, Y., Zhao, Z., Li, N., Zhao, Y., 2010. The immunoglobulin gene loci in the teleost Gasterosteus aculeatus. Fish Shellfish Immunol. 28, 40–48. Beale, D., Feinstein, A., 1976. Structure and function of the constant regions of immunoglobulins. Q. Rev. Biophys. 9, 135–180. Bengten, E., Quiniou, S.M.A., Stuge, T.B., Katagiri, T., Miller, N.W., Clem, L.W., Warr, G.W., Wilson, M., 2002. The IgH locus of the channel catfish, Ictalurus punctatus, contains multiple constant region gen sequences: different genes encode heavy chains of membrane and secreted IgD. J. Immunol. 169, 2488–2497. Campbell, K.S., Backstrom, B.T., Tiefenthaler, G., Palmer, E., 1994. Cart: a conserved antigen receptor transmembrane motif. Semin. Immunol. 6, 393–410. Castro, R., Jouneau, L., Pham, H.P., Bouchez, O., Giudicelli, V., Lefranc, M.P., Quillet, E., Benmansour, A., Cazals, F., Six, A., Fillatreau, S., Sunyer, J.O., Boudinot, P., 2013. Teleost fish mount complex clonal IgM and IgT responses in spleen upon systemic viral infection. Fish Shellfish Immunol. 34, 1643–1644. Castro, R., Martínez-Alonso, S., Fischer, U., Haro, N.Á., Sotolampe, V., Wang, T., Secombes, C.J., Lorenzen, N., Lorenzen, E., Tafalla, C., 2014. DNA vaccination against a fish rhabdovirus promotes an early chemokine-related recruitment of B cells to the muscle. Vaccine 32, 1160–1168. Danilova, N., Bussmann, J., Jekosch, K., Steiner, L.A., 2005. The immunoglobulin heavy chain locus in zebrafish: identification and expression of a previously unknown isotype, immunoglobulin Z. Nat. Immunol. 6, 295–302. Deza, F.G., Espinel, C.S., Mompo, S.M., 2009. Presence of a unique IgT on the IGH locus in Gasterosteus aculeatus and the very recent generation of a repertoire of VH genes. Dev. Comp. Immunol. 34, 114–122. Du, Y., Tang, X., Zhan, W., Xing, J., Sheng, X., 2016. Immunoglobulin tau heavy chain (IgT) in flounder, Paralichthys olivaceus: molecular cloning, characterization, and expression analyses. Int. J. Mol. Sci. 17, 1571. Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, C.J., Hofmann, K., Bairoch, A., 2002. The PROSITE database, its status in 2002. Nucleic Acids Res. 30, 235–238. Flajnik, M.F., 2010. All god’s creatures got dedicated mucosal immunity. Nat. Immunol. 11, 777–779. Flajnik, M.F., Kasahara, M., 2010. Origin and evolution of the adaptive immune system: genetic events and selective pressures. Nat. Rev. Genet. 11, 47–59. Fu, X., Zhang, H., Tan, E., Watabe, S., Asakawa, S., 2015. Characterization of the torafugu (Takifugu rubripes) immunoglobulin heavy chain gene locus. Immunogenetics 67, 179–193. Gambón-Deza, F., Sánchez-Espinel, C., Magadán-Mompó, S., 2010. Presence of a unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes. Dev. Comp. Immunol. 34, 114–122. Gao, Y., Yi, Y., Wu, H., Wang, Q., Qu, J., Zhang, Y., 2014. Molecular cloning and Characterization of secretory and membrane-bound IgM of turbot. Fish Shellfish Immunol. 40, 354–361. Giacomelli, S., Buonocore, F., Albanese, F., Scapigliati, G., Gerdol, M., Oreste, U., Coscia, M.R., 2015. New insights into evolution of IgT genes coming from Antarctic teleosts. Mar. Genom. 24, 55–68. Hansen, J.D., Landis, E.D., Phiollips, R.B., 2005. Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: implications for a distinctive B cell developmental pathway in teleost fish. Proc. Natl. Acad. Sci. U. S. A. 102, 6919–6924. Hirono, I., Nam, B.H., Enomoto, J., Uchino, K., Aoki, T., 2003. Cloning and characterisation of a cDNA encoding Japanese flounder Paralichthys olivaceus IgD. Fish Shellfish Immunol. 15, 63–70. Hordvik, I., Thevarajan, J., Samdal, I., Bastani, N., Krossoy, B., 1999. Molecular cloning and phylogenetic analysis of the Atlantic salmon immunoglobulin D gene. Scand. J. Immunol. 50, 202–210. Hordvik, I., Berven, F.S., Solem, S.T., Hatten, F., Endresen, C., 2002. Analysis of two IgM isotypes in Atlantic salmon and brown trout. Mol. Immunol. 39, 313–321. Hu, Y.L., Xiang, L.X., Shao, J.Z., 2010. Identification and characterization of a novel immunoglobulin Z isotype in zebrafish: implications for a distinct B cell receptor in lower vertebrates. Mol. Immunol. 47, 738–746. Kato, G., Takano, T., Sakai, T., Matsuyama, T., Sano, N., Nakayasu, C., 2015. Cloning and expression analyses of a unique IgT in ayu Plecoglossus altivelis. Fish. Sci. 81, 29–36. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2T−ΔΔC method. Methods 25, 402–408. Mashoof, S., Pohlenz, C., Chen, P.L., Deiss, T.C., Gatlin, D., Buentello, A., Criscitiello, M.F., 2014. Expressed IgH μ and τ transcripts share diversity segment in ranched Thunnus orientalis. Dev. Comp. Immunol. 43, 76–86. Parra, D., Takizawa, F., Sunyer, J.O., 2013. Evolution of B cell immunity. Annu. Rev. Anim. Biosci. 1, 65–97. Pereiro, P., Balseiro, P., Romero, A., Dios, S., Forn-Cuni, G., Fuste, B., 2012. Highthroughput sequence analysis of turbot (Scophthalmus maximus) transcriptome using 454-pyrosequencing for the discovery of antiviral immune genes. PLoS One 7, e35369. Peterson, M.L., Perry, R.P., 1989. The regulated production of mu m and mu s mRNA is dependent on the relative efficiencies of mu s poly (A) site usage and the c mu 4-toM1 splice. Mol. Cell. Biol. 9, 726–738. Picchietti, S., Buonocore, F., Ortiz, N.N., Stocchi, V., Guerra, L., Randelli, E., 2016. IgT and IgD from sea bass (Dicentrarchus labrax): localization of expressing and immunoreactive cells in lymphoid tissues. Fish Shellfish Immunol. 53, 77. Ramirez-Gomez, F., Greene, W., Rego, K., Hansen, J.D., Costa, G., Kataria, P., Bromage, E.S., 2012. Discovery and characterization of secretory IgD in rainbow trout: secretory IgD is produced through a novel splicing mechanism. J. Immunol. 188, 1341–1349.

Acknowledgements This study was supported by the National Natural Science Foundation of China (31730101; 31672685; 31672684; 31472295; 31302216), Taishan Scholar Program of Shandong Province, and the Open Foundation of Functional Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology (2016LMFS-A01). 11

Veterinary Immunology and Immunopathology 203 (2018) 1–12

X. Tang et al.

Wiersma, E.J., Chen, F., Bazin, R., Collins, C., Painter, R.H., Lemieux, R., Shulman, M.J., 1997. Analysis of IgM structures involved in J chain incorporation. J. Immunol. 158, 1719–1726. Xia, H., Liu, W., Wu, K., Wang, W., Zhang, X., 2016. sIgZ exhibited maternal transmission in embryonic development and played a prominent role in mucosal immune response of Megalabrama amblycephala. Fish Shellfish Immunol. 54, 107–117. Xiao, F.S., Wang, Y.P., Yan, W., Chang, M.X., Yao, W.J., Xu, Q.Q., 2010. Ig heavy chain genes and their locus in grass carp Ctenopharyngodon idella. Fish Shellfish Immunol. 29, 594–599. Xing, J., Xu, H.S., Wang, Y., Tang, X.Q., Sheng, X.Z., Zhan, W.B., 2017. Protective efficacy of six immunogenic recombinant proteins of Vibrio anguillarum and evaluation them as vaccine candidate for flounder (Paralichthys olivaceus). Microb. Pathog. 107, 155–163. Xu, Z., Parra, D., Gómez, D., Salinas, I., Zhang, Y.A., Von, G.J.L., Sunyer, J.O., 2013. Teleost skin, an ancient mucosal surface that elicits gut-like immune responses. Proc. Natl. Acad. Sci. 110, 13097–13102. Xu, Z., Takizawa, F., Parra, D., Gómez, D., Von, G.J.L., Lapatra, S.E., Sunyer, J.O., 2016. Mucosal immunoglobulins at respiratory surfaces mark an ancient association that predates the emergence of tetrapods. Nat. Commun. 7, 10728. Yasuike, M., Boer, J., Schalburg, K.R., Cooper, G.A., McKinnel, L., Messmer, A., 2010. Evolution of duplicated IgH loci in Atlantic salmon, Salmo salar. BMC Genom. 11, 486. Yoo, E.M., Coloma, M.J., Trinh, K.R., Nguyen, T.Q., Vuong, L.U., Morrison, S.L., Chintalacharuvu, K.R., 1999. Structural requirements for polymeric immunoglobulin assembly and association with J chain. J. Biol. Chem. 274, 33771–33777. Zhang, Y.A., Salinas, I., Li, J., Parra, D., Bjork, S., Xu, Z., LaPatra, S.E., Bartholomew, J., Sunyer, J.O., 2010. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat. Immunol. 11, 827–835. Zhang, Y.A., Salinas, I., Sunyer, J.O., 2011. Recent findings on the structure and function of teleost IgT. Fish Shellfish Immunol. 31, 627–634. Zhang, Z.H., Wu, H.Z., Xiao, J.F., Wang, Q.Y., Liu, Q., Zhang, Y.X., 2012. Immune responses of zebrafish (Danio rerio) induced by bath-vaccination with a live attenuated Vibrio anguillarum vaccine candidate. Fish Shellfish Immunol. 33, 36–41. Zhao, Y., Kacskovics, I., Pan, Q., Liberles, D.A., Geli, J., Davis, S.K., Rabbani, H., Hammarstrom, L., 2002. Artiodactyl IgD: the missing link. J. Immunol. 169, 4408–4416.

Ribas, L., Pardo, B.G., Fern, C., Alvarez-Di, J.A., Gomez-Tato, A., Quiroga, M.I., 2013. A combined strategy involving Sanger and 454 pyrosequencing increases genomic resources to aid in the management of reproduction, disease control and genetic selection in the turbot (Scophthalmus maximus). BMC Genom. 14, 180. Ryo, S., Wijdeven, R.H., Tyagi, A., Hermsen, T., Kono, T., Karunasagar, I., 2010. Common carp have two subclasses of bonyfish specific antibody IgZ showing differential expression in response to infection. Dev. Comp. Immunol. 34, 1183–1190. Saha, N.R., Suetake, H., Kikuchi, K., Suzuki, Y., 2004. Fugu immunoglobulin D: a highly unusual gene with unprecedented duplications in its constant region. Immunogenetics 56, 438–447. Savan, R., Aman, A., Sato, K., Yamaguchi, R., Sakai, M., 2005a. Discovery of a new class of immunoglobulin heavy chain from fugu. Eur. J. Immunol. 35, 3320. Savan, R., Aman, A., Nakao, M., Watanuki, H., Sakai, M., 2005b. Discovery of a novel immunoglobulin heavy chain gene chimera from common carp (Cyprinus carpio L.). Immunogenetics 57, 458–463. Schroeder Jr., H.W., Cavacini, L., 2010. Structure and function of immunoglobulins. J. Allergy Clin. Immunol. Pract. 125, S41–S52. Srisapoome, P., Ohira, T., Hirono, I., 2004. Genes of the constant region of functional immunoglobulin heavy chain of Japanese flounder Paralychthys olivaceus. Immunogenetics 56, 292–300. Stenvik, J., Jørgensen, T., 2000. Immunoglobulin D (IgD) of Atlantic cod has a unique structure. Immunogenetics 51, 452–461. Stenvik, J., Schroder, M.B., Olsen, K., Zapata, A., Jørgensen, T., 2001. Expression of immunoglobulin heavy chain transcripts (VH-families, IgM, and IgD) in head kidney and spleen of the Atlantic cod (Gadus morhua L.). Dev. Comp. Immunol. 25, 291–302. Sunyer, O., Zhang, Y.A., Li, J., Parra, D., LaPatra, S.E., 2009. Is IgT the evolutionary equivalent of IgA? Insights into its structure and function. J. Immunol. 182 81-21. Tadiso, T.M., Lie, K.K., Hordvik, I., 2011. Molecular cloning of IgT from Atlantic salmon, and analysis of the relative expression of τ, μ and δ in different tissues. Vet. Immunol. Immunopathol. 139, 17–26. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tian, J., Sun, B., Luo, Y., Zhang, Y., Nie, P., 2009. Distribution of IgM, IgD and IgZ in mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation. Aquaculture 288, 14–21.

12