Molecular cloning and expression analysis of interferon stimulated gene 15 (ISG15) in turbot, Scophthalmus maximus

Fish & Shellfish Immunology 45 (2015) 895e900

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Molecular cloning and expression analysis of interferon stimulated gene 15 (ISG15) in turbot, Scophthalmus maximus Jing-Yun Lin a, Guo-Bin Hu a, b, *, Da-Hai Liu b, Song Li a, Qiu-Ming Liu a, Shi-Cui Zhang a, b a b

College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 March 2015 Received in revised form 17 May 2015 Accepted 24 May 2015 Available online 18 June 2015

The interferon stimulated gene 15 (ISG15) is strongly induced in many cell types by double-stranded RNA (polyinosinic: polycytidylic acid, poly I:C) and viral infection. In this study, we described the nucleotide, mRNA tissue distribution and regulation of an ISG15 gene from turbot, Scophthalmus maximus (SmISG15). SmISG15 gene is 862 bp in length, composed of two exons and one intron, and encodes 158 amino acids. The deduced protein exhibits the highest homology (44.7e71.2% identity) with ISG15s from other fishes and possesses two conserved tandem ubiquitin-like (UBL) domains and a C-terminal RLRGG conjugating motif known to be important for the functions of ISG15s in vertebrates. Phylogenetic analysis grouped SmISG15 into fish ISG15. SmISG15 mRNA was constitutively expressed in all tissues examined, with higher levels observed in immune organs. Gene expression analysis was performed for SmISG15 in the spleen, head kidney, gills and muscle of turbots challenged with poly I:C or turbot reddish body iridovirus (TRBIV) over a 7-day time course. The result showed that SmISG15 was upregulated by both stimuli in all four tissues, with induction by poly I:C apparently stronger and initiated more quickly. A two-wave induced expression of SmISG15 was seen in the spleen, head kidney and gills, suggesting an induction of SmISG15 either by IFN-dependent or -independent pathway. These results provide insights into the roles of fish ISG15 in antiviral immunity. © 2015 Elsevier Ltd. All rights reserved.

Keywords: ISG15 Scophthalmus maximus TRBIV Poly I:C Gene expression

1. Introduction Type I interferons (IFN a/b), a group of proteins with antiviral, antiproliferative and immunomodulating activities, were first discovered in 1957 [1], since then they have been widely used as clinical drugs [2]. All vertebrate groups from fish to mammals possess type I IFNs. They play a crucial role in the innate antiviral response by inducing hundreds of interferon stimulated genes (ISGs) through the JAK-STAT pathway [3], among which the doublestranded RNA (dsRNA)-activated protein kinase (PKR), Myxovirus resistance (Mx) and 20 -50 oligoadenylate synthetase (OAS) are most studied [4], while other ISGs have not been well functionally characterized [5]. ISG15 is one of the first identified ISGs with molecule weight (MW) of 15 kDa and belongs to a small class of ubiquitin-like proteins (UBLs) that includes SUMO, FAT10, Nedd8 and Ubl1 [6].

* Corresponding author. College of Marine Life Sciences, Ocean University of China, Yushan Road 5#, Qingdao 266003, China. E-mail address: [email protected] (G.-B. Hu). http://dx.doi.org/10.1016/j.fsi.2015.05.050 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

It is also called ubiquitin cross-reactive protein (UCRP) because of cross-reactivity with ubiquitin antibodies [7]. Structurally, ISG15 contains two tandem ubiquitin-like domains and a conserved Cterminal RLRGG motif. Like ubiquitin, it can conjugate to target cellular proteins with the motif of RLRGG in a process called ISGylation, but it does not appear to target proteins for degradation, instead influences binding to other molecules, affects enzymatic degradation and subcellular localization, and may also determine the half-life of proteins [8]. ISG15 plays an important role in host response to pathogens. Its expression is a primary response to IFN a/b induction and a marker of viral or bacterial infection in many cell types [9]. It exists in conjugated or free form in cells. The conjugated ISG15 exerts antiviral activity through ISGylation of both host and viral proteins that impact viral replication [10]. However, there is currently no evidence that IFN-a/b-inducible human intracellular ISG15 exerts antiviral effects on documented viral infections via ISGylation. On the contrary, a recent literature has shown that IFN-a/b-inducible ISG15 is essential to negatively regulate IFN-a/b responses via stabilizing USP18, a potent negative regulator of IFN-a/b signalling, thereby preventing auto-

896

J.-Y. Lin et al. / Fish & Shellfish Immunology 45 (2015) 895e900

inflammatory consequences of uncontrolled IFN-a/b amplification [11]. In addition, intra- and extracellular free ISG15s also display cytokine-like functions by inducing IFN g in T-cells and stimulating natural killer cell proliferation [12]. At present, ISG15 has been reported in many mammals and fish species including Japanese flounder, black rockfish, Atlantic salmon, Atlantic cod, channel catfish and crucian carp [13e18], but not been found in plants and lower organisms, such as insects, nematode and yeast [19]. Turbot, Scophthalmus maximus, is an important marine fish species cultured widely in the world. However, the knowledge about turbot ISGs is very limited, in which only a molecule Mx is known [20]. The aim of this study is to better understand the innate antiviral immunity in turbot by structural and expression studies of a turbot ISG15 gene (SmISG15), which will be helpful to develop strategies of viral disease control for this commercially important species. Herein, we reported the sequencing, mRNA tissue distribution and transcriptional modulation of SmISG15. We challenged turbots with poly I:C, an artificial dsRNA, and turbot reddish body iridovirus (TRBIV), a DNA viral pathogen prevailing in farmed turbot in China, to explain the role of SmISG15 in innate antiviral response. 2. Materials and methods 2.1. Fish, poly I:C and virus Turbot (S. maximus) juveniles (68.4 ± 4.5 g, n ¼ 170) were purchased from a local fish farm. Fish were kept in aerated seawater tanks at 16  C for one week before use. Poly I:C was purchased from Sigma (St Louis, MO, USA). TRBIV was isolated from cultured turbots with TRBIV disease as previously described [21]. The viral titers were measured by a 50% tissue culture infective dose (TCID50) assay according to the method of Reed and Muench [22]. The viruses were aliquoted in 1 ml stock and stored at 80  C until use. 2.2. Challenges of turbots with poly I:C and TRBIV Two groups of turbots were intraperitoneally (i.p.) injected with poly I:C (10 mg/ml, 100 ml per fish) or TRBIV (2  106 TCID50/ml, 120 ml per fish), respectively. Control fish were injected phosphatebuffered saline (PBS) with the same volume (100 or 120 ml per fish, respectively). The spleen, head kidney, gills and muscle of injected fish were collected at various time points post injection (0, 3, 6 and 12 h and 1, 2, 3, 4, 5 and 7 days after poly I:C injection or 0, 3 and 6 h and 1, 2, 3, 4, 5 and 7 days after TRBIV injection) for gene expression assay. 2.3. RNA and genomic DNA extraction Total RNA was extracted using Isogen reagent (Nippon Gene, Tokyo, Japan) from various tissues of healthy turbots for mRNA tissue distribution analysis and from the specific tissues mentioned in Section 2.2 for gene expression assay. RNA samples were incubated with DNase I to remove genomic DNA contamination using Turbo DNA-free kit (Ambion, Austin, TX, USA). The RNA concentration was determined by measuring the absorbance at 260 nm, and its quality was monitored by A260 nm/A280 nm ratios >1.8. The genomic DNA was isolated from the muscle by a standard phenol/ chloroform extraction procedure [23]. 2.4. Cloning of SmISG15 cDNA and gene From 1 mg of total RNA extracted from head kidney of a turbot, the SMART cDNAs were produced by using a cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). Based on the conserved sequences

of known fish ISG15s, degenerate primers (Table 1) were designed. A 326-bp partial cDNA of SmISG15 was obtained by homology cloning, while the full-length cDNA was obtained by rapid amplification of cDNA ends (RACE) method. (With the genomic DNA template and gene specific primers (Table 1), the genomic PCR was performed.) Subsequently, the gene sequence of SmISG15 was obtained by a routine PCR procedure with the genomic DNA template and gene specific primers (Table 1). All PCRs in this group were carried out using Ex Taq DNA polymerase (TaKaRa, Dalian, Liaoning, China). The products of PCR were isolated using an E.Z.N.A Gel Extraction Kit (Omega Bio-tek, Doraville, GA, USA), cloned into pMD18-T vector (TaKaRa) and sequenced with an ABI PRISM 3100 DNA sequencer (Applied Biosystem, Foster City, CA). The exonintron boundaries were determined by alignment of the cDNA to the genomic sequence using Genetyx 7.0 software (GENETYX Corporation., Tokyo, Japan).

2.5. Sequence analysis Sequence result of SmISG15 was compared with Genbank/EMBL database by using the BLASTX and BLASTP search programs (http:// blast.genome.ad.Jp). The nucleotide sequence was translated to protein sequence using Translate Tool DNAman. The multiple alignment of protein sequences was produced by the Clustal W (www.ddbj.nig.ac.jp/E-mail/clustalw-e.html). The phylogenetic tree was depicted on the overall amino acid sequences using the neighbor-joining (NJ) algorithm within MEGA version 5.0 with FAT10 as an outgroup that contains two UBL domains as ISG15. Bootstrap values were calculated with 1000 replications to estimate the robustness of internal branches.

2.6. Quantitative real time PCR (qPCR) qPCR analysis was used to investigate SmISG15 mRNA tissue distribution and immune responsive expression in specific organs. 1.0 mg of total RNA from each tissue (5 individuals for each time point) was reverse-transcribed into cDNA by random primers using Superscript First Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). Primer pair ISG15-tF/ISG15-tR (Table 1) was used for amplification of SmISG15. qPCR was conducted in 20 ml volume containing 1  SYBR Green Real time PCR Mast Mix (Toyobo, Osaka, Japan), 0.2 mM each of specific forward and reverse primers and 1.0 ml diluted cDNA (50 ng/ml) in an ABI Prism 7900HT Sequence Detection System (PE Applied Biosystems, Foster City, CA). PCR conditions were 94  C for 4 min, followed by 40 cycles of 94  C for 30 s, 54  C for 30 s, 72  C for 25 s. Turbot 18S rRNA (GenBank accession no.: EF126038) was used as an internal control. All samples were amplified in triplicates. Fluorescent detection was performed after each extension step. A dissociation protocol was performed after thermocycling to verify that a single amplicon of expected size was amplified. Expression levels of SmISG15 were normalized to 18S rRNA, and further expressed as fold change relative to the expression level in control according to the 2DDCT method [24] in the gene expression assay.

2.7. Statistical analysis Statistical analysis was performed using SPSS13.0 software (SPSS Inc., Chicago, IL, USA). Differences in the data were compared by one-way analysis of variance (ANOVA) followed by Duncan's post hoc test for multiple comparisons. Differences were considered significant at P < 0.05.

J.-Y. Lin et al. / Fish & Shellfish Immunology 45 (2015) 895e900

897

Table 1 Sequences of primers used in the present study. Primer ISG15-hF1 ISG15-hR1 ISG15-hF2 ISG15-hR2 ISG15-3F1 ISG15-3F2 ISG15-5R1 ISG15-5R2 ISG15-gF ISG15-gR ISG15-tF ISG15-tR 18S-F 18S-R

Sequence (50 /30 ) TCATHATHACNATGYTNAAYGG ACGTTGTAGTCNSWNARYTTNCC GACACGGTYGGNWSNYTNAA TGGTASACNARNCKYTGYTG TGCGGAACGAGAAGGGGAAGGTGA CCAGGGAGTCGGTGCCGGAGAGCCAA CCGTAGTGGCCGAGGGTCTGGGAGTC CCTCTCAGTCGGAACCCCCAGTTTGT GGGAAAAAAAAGAGATCATTT GGTCTGGGAGTCGTTGTTCA TCATTTTCATCATGGACATC CTGACGGTCTCTTCTGGTGT CACAGTGCCCATCTATGAG CCATCTCCTGCTCGAAGTC

Target gene ISG15

Usage First round homology PCR Nested homology PCR First round 30 -RACE PCR Nested 30 -RACE PCR First round 50 -RACE PCR Nested 50 -RACE PCR Genomic PCR qPCR

18S rRNA

Note: (1) N represents all four nucleotides; H, A, C or T; R, G or A; Y, C or T; S, C or G; W, A or T; K, G or T.

3. Results 3.1. Molecular characterization of SmISG15 The full-length SmISG15 cDNA (GenBank accession no.: KJ194175) is 803 bp long, containing an open reading frame (ORF) of 474 bp that encodes 158 amino acid residues (Supplementary Data, Fig. S1). The 50 -untranslated region (UTR) starts at 34 bp upstream of the putative ATG start codon. In the 30 -UTR, two polyadenylation signals (AATAAA and ATTAAA) and two mRNA instability motifs (ATTTA) were found. The deduced protein has a calculated MW of 17.8 kDa. It exhibits the highest sequence homology (42.2e71.2% identity) with ISG15s from other fishes, a less homology (30.1e34.1% identity) with those from mammals, and a relative low homology (16.5e21% identity) with FAT10, the other tandem domain ubiquitin-like protein (Supplementary Data, Table S1). The alignment of protein sequences shows that the SmISG15 has two tandem ubiquitin-like (UBL) domains, a linker (sequence between the two UBLs) and a C-terminal RLRGG conjugating motif as predicted by the Simple Modular Architecture Research Tool (SMART) (Fig. 1). Except the linker, these domains are conserved in fish and mammals. In each UBL domain, there are six invariant aliphatic residues that define the conserved hydrophobic core. 3.2. Genomic structure of SmISG15 SmISG15 gene (GenBank accession no.: KJ194176) is 862 bp in

length and composed of two exons and one intron (Fig. 2). The 50 and 30 -ends of the intron conform to canonical splicing motifs (GT/ intron/AG) [25] as shown in Supplementary Data, Fig. S1. Although all vertebrate ISG15 genes possess a structure of two-exon and oneintron, the intron in fish species is located in the 50 -UTR, while the intron in mammals is located at the N-terminus of coding region.

Fig. 2. Genomic structure of SmISG15 compared with those of other vertebrate ISGs. The exons are boxed and introns lined. Filled boxes indicate coding regions. The size (bp) of exons and introns are shown above the corresponding elements. Accession numbers or references: Japanese flounder, Yasuike et al., 2011; Atlantic cod, Seppola et al., 2007; zebrafish, Seppola et al., 2007; mouse, ENSMUSG00000035692; human, NG_033033.

Fig. 1. Alignment of SmISG15 with other ISG15 protein sequences. The predicted ubiquitin-like (UBL) domains are indicated by lines above the aligned sequences. The RLRGG -conjugating motif and six invariant aliphatic residues in each UBL domain are boxed. The accession numbers of the sequences are presented in Supplementary Data, Table S1.

898

J.-Y. Lin et al. / Fish & Shellfish Immunology 45 (2015) 895e900

3.3. Phylogenetic analysis A phylogenetic NJ-tree containing overall amino acid sequences of ISG15s from various vertebrates was construct with FAT10 as an outgroup (Fig. 3). In the tree, the ISG15s from mammals and teleosts segregated into two separate clusters. The further subdivision of the teleost sequences generally followed the established phylogeny, with SmISG15 having the closest phylogenetic distance to ISG15 from other two flatfishes, Japanese flounder and tongue solo. 3.4. Tissue distribution of SmISG15 mRNA SmISG15 mRNA was constitutively expressed in all tested tissues including brain, gills, stomach, intestine, heart, head kidney, kidney, liver, spleen, gonad, muscle and skin of healthy turbots (Fig. 4). Higher expression level was detected in the head kidney, kidney, spleen and skin, moderate level in the gills, digestion organs, heart, liver, gonad and muscle, and weak level in the brain. 3.5. Gene expression of SmISG15 in response to poly I:C or TRBIV challenge The SmISG15 expression was upregulated by poly I:C and TRBIV in spleen, head kidney, gills and muscle, with TRBIV having a weaker and later inductive action, and both poly I:C and TRBIV stimulations resulted in two waves of induced expression in a 7-day time course in the spleen, head kidney and gills (Fig. 5). After poly I:C stimulation, the first expression peak of SmISG15 arose at hour 12 in spleen and day 1 in head kidney and gills with an increase of 15.1-, 16.8- and 4.0-fold over the control, respectively; the second peak appeared at day 2, 5 and 7 in spleen, head kidney and gills with an increase of 22.9-, 10.5- and 2.9-fold, respectively. After TRBIV infection, the first expression peak of SmISG15 arose at day 1 in spleen and day 2 in head kidney and gills with an increase of about 4.0-, 13.4- and 1.9-fold, respectively; the second peak appeared at day 7 with a 23.1-fold increase in head kidney, while at day 4 in spleen and gills with a 12.8- and 2.0-fold increase, respectively. In muscle, the induction of SmISG15 was very weak and only a single expression peak was detected that appeared at

Fig. 3. Phylogenic tree showing the relationship of ubiquitin-like proteins. The tree was constructed by neighbor-joining (NJ) method. The bootstrap values for replicated 1000 were represented by percentages on the edge of node. The scale bar indicates the branch length. The SmISG15 (turbot ISG15) is marked by a black triangle. The accession numbers of the sequences are presented in Supplementary Data, Table S1.

Fig. 4. qPCR analysis of SmISG15 expression in brain (Br), gill (Gi), stomach (St), intestine (In), heart (He), kidney (Ki), head kidney (HK), liver (Liver), Spleen (Sp), gonad (Go), muscle (Mu) and skin (Sk) of healthy turbots. The values are expressed as relative value to the 18S rRNA levels. Values are means ± standard error (S.E.), n ¼ 5. Values marked by different letters are significantly different from each other.

day 1 with a 1.3-fold increase after poly I:C stimulation and day 3 with a 1.7-fold increase after TRBIV infection. 4. Discussion In this study, we cloned the full-length cDNA and genomic sequences of an ISG15 homologue from turbot that encode a peptide of 158 residues (Supplementary Data, Fig. S1). On the basis of the ISG-like structure of the inferred peptide and its homology with other vertebrate ISG15s, the cloned sequence was identified as SmISG15. The SmISG15 has two UBL domains, a linker and a Cterminal RLRGG motif as other known ISG15s (Fig. 1). Each UBL domain has six invariant aliphatic residues crucial for the hydrophobic core of b-grasp fold of ubiquitin. But fish ISG15 lacks the conserved Cys residue in the linker, which is essential for the stabilization of mammalian ISG15 [26]. The RLRGG motif is located only at the C-terminus to the second UBL domain, therefore, the ISG15 is distinct from polyubiquitin that has several RLRGG motifs with each following an UBL at the C-terminus. The RLRGG motif has a function to conjugate to target cellular proteins and lead to their ubiquitinylation or ISGylation. Interestingly, the ISGylation pattern following IFN stimulation is immunologically distinct from that of ubiquitylation, indicating that the two systems, although related, are modifying different sets of proteins [27]. ISG15s from human and mouse are synthesized as a 17-kDa precursor and subsequently processed to a 15-kDa protein through the removal of the additional C-terminal amino acids downstream the RLRGG motif by a protease [28]. But in fish as well as in ruminant, ISG15 has no the additional sequence [13], indicating that no post-translational processing occurs for fish ISG15 proteins. Although only a single intron was found for both mammals and fish ISG15 genes, but the intron of fish ISG15 is located in 50 -UTR, while mammalian intron within ORF after the first methionine (Fig. 2). It has been reported that the position of intron has a direct effect on the maturation pathway and translational efficiency of mRNA, an intron at 50 -end of ORF intends to direct mRNA toward translational silencing and one at 30 -end represses the translation [29]. In this study, the SmISG15 is intronless in the ORF like other fish ISG15s, which may relieves the translational silencing. Based on a Clustal W alignment of full-length amino acid sequences of various ISG15s, a phylogenetic tree was constructed (Fig. 3). The ISG15s from mammals and teleosts segregated into two separate clusters with SmISG15 grouped into teleost ISG15 cluster. The SmISG15 exhibited the closest relationship to the ISG15 from its relatives, Japanese flounder and tongue solo, and a less close relationship to those from lower teleosts (zebrafish, goldfish, etc) and mammals. This result matches well the evolutionary relationship in various vertebrates.

J.-Y. Lin et al. / Fish & Shellfish Immunology 45 (2015) 895e900

899

Fig. 5. Induced expression of SmISG15 gene upon challenge with 1.0 mg poly I:C or 2.4  105 TCID50 TRBIV per fish during a 7-day time course. AeD shows fold changes of SmISG15 expression upon poly I:C challenge in the spleen, head kidney, gills and muscle, respectively; EeH shows fold changes of SmISG15 expression upon TRBIV challenge in the spleen, head kidney, gills and muscle, respectively. Values are means ± standard error (S.E.), n ¼ 5. The level of significance of the comparison to the control is indicated by *P < 0.05 and **P < 0.01.

SmISG15 transcripts were constitutively expressed in all tested tissues (Fig. 4), suggesting its relation to diverse cellular pathways including those involved in RNA splicing, translation, chromatin remodeling, cytoskeleton organization and stress responses [30]. The strong expression of SmISG15 was detected in leukocyte-rich organs, such as head kidney, kidney and spleen, a tissue expression pattern similar to Japanese flounder ISG15 [13]. A high level of SmISG15 was also detected in skin, which may be explained by the finding of macrophages and lymphocytes in skin of rainbow trout, Atlantic salmon and coho [31]. These results indicate that SmISG15 is synthesized predominantly in leukocytes and may have a role in leukocyte proliferation which has been proved in human [32]. Meanwhile, the ISG15 is a target gene of a number of IRF family transcription factors like IRF3, -5 and -7 that are constitutively expressed in most tissue and cell types with a strong expression in leukocyte-rich organs in turbot [33e35]. Such a similar tissue expression pattern indicates a close contact of SmISG15 with IRFs. The upregulation of SmISG15 was observed in all four tested

tissue types after treatment with poly I:C or TRBIV (Fig. 5), suggesting its general inducibility in the immune and non-immune organs by RNA and DNA viruses. Also, the enhanced expression of ISG15 followed poly I:C or virus treatments has been observed in other fish species, such as Japanese flounder, black rockfish, Atlantic salmon and Atlantic cod [13e16]. Further, studies with mammalian models have demonstrated that ISG15 possesses a broad spectrum of antiviral activity [36], supporting the induction of SmISG15 by the two different viral stimuli. The induction of SmISG15 were found stronger in lymphatic tissues (head kidney and spleen), followed by mucosa-associated lymphatic tissue (gills) and quite weak in muscle that lacks lymphocytes, suggesting a positive correlation between SmISG15 inducibility and leukocyte content in the tested organs. Compared to TRBIV, the induction by poly I:C was apparently stronger and initiated more quickly, indicating that it acts as a highly pure and concentrated PAMP to activate host's immune response directly. In contrast, TRBIV has to go through replication cycles to produce PAMPs before triggering a detectable response.

900

J.-Y. Lin et al. / Fish & Shellfish Immunology 45 (2015) 895e900

Besides, as a synthetic mimic of dsRNA and a strong inducer of fish type I IFNs and ISGs [17], poly I:C has a different PAMP property from TRBIV. The TRBIV is a double-stranded DNA virus and, therefore, expected to trigger host's antiviral response via a different mechanism. Furthermore, TRBIV was found to inefficiently induce another ISG, Mx, in turbots [33,35]. Two peaks of SmISG15 expression were observed in three tissue types, the spleen, head kidney and gills after injection of poly I:C or TRBIV. The first peak was observed in an early stage, i.e, within one day after poly I:C injection or one or two days after TRBIV injection, and the second peak relatively later. Based on this phenomenon and previous studies [3,37,38], we hypothesize that SmISG15 was induced by both IFN-independent and -dependent pathways. The first expression peak is IFN-independent, caused by a direct activation of SmISG15 by poly I; C or virus, as poly I:C and virus was reported to direct stimulate ISG15 by the binding of IRFs or p53 to the ISRE elements or p53-responsive elements in ISG15 promoter, respectively [39]. This process doesn't involve new protein synthesis. On the other hand, as an effector molecule of type I IFN system, the ISG15 locates at the end of type I IFN signaling cascade, prior to which is the inducible production of type I IFNs upon viral infection that is mediated by PRR signaling cascades. The both steps took a period of time and thus resulted in a lagged second expression peak of SmISG15. In summary, the structure and expression pattern of SmISG15 gene were identified and characterized in the present study. We demonstrate that the tissue distribution profile and transcriptional modulation fashion of SmISG15 were similar with those of its mammalian orthologs. The inductions by poly I:C and DNA virus support the role of SmISG15 in the antiviral responses, but further understanding of the mechanism by which SmISG15 acts in antiviral responses is needed. Acknowledgments This work was supported by grants from the National Basic Research Program of China (2012CB114404), National Natural Science Foundation of China (30671604), Fundamental Research Funds for the Central Universities (201362024), Program for New Century Excellent Talents in University of Ministry of Education of China (NCET-11-0467) and Shandong Provincial Natural Science Foundation (ZR2013CM045). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.05.050. References [1] A. Isaacs, J. Lindenmann, Virus interference. I. The interferon, Proc. R. Soc. Lond. 147 (1957) 258e267. [2] R.M. Friedman, Clinical uses of interferons, Br. J. Clin. Pharmacol. 65 (2008) 158e162. [3] B. Robertsen, The interferon system of teleost fish, Fish Shellfish Immunol. 20 (2006) 172e191. [4] C.E. Samuel, Antiviral actions of interferons, Clin. Microbiol. Rev. 14 (2001) 778e809. [5] I.F. Pitha-Rowe, P.M. Pitha, Viral defense, carcinogenesis and ISG15: novel roles for an old ISG, Cytokine Growth Factor Rev. 18 (2007) 409e417. [6] D.C. Schwartz, M. Hochstrasser, A superfamily of protein tags: ubiquitin, SUMO and related modifiers, Trends Biochem. Sci. 28 (2003) 321e328. [7] A.L. Haas, P. Ahrens, P.M. Bright, et al., Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin, J. Biol. Chem. 262 (1987) 11315e11323. [8] J. Herrmann, L.O. Lerman, A. Lerman, Ubiquitin and ubiquitin-like proteins in protein regulation, Circ. Res. 100 (2007) 1276e1291. [9] C.T. Dao, D.E. Zhang, ISG15: a ubiquitin-like enigma, Front. Biosci. 10 (2005) 2701e2722.

[10] J.A. Campbell, D.J. Lenschow, Emerging roles for immunomodulatory functions of free ISG15, J. Interferon Cytokine Res. 33 (2013) 728e738. [11] X. Zhang, D. Bogunovic, B. Payelle-Brogard, V. Francois-Newton, S.D. Speer, C. Yuan, et al., Human intracellular ISG15 prevents interferon-a/b overamplification and auto-inflammation, Nature 517 (2015) 89e93. [12] J. D'Cunha, E. Knight, A.L. Haas, R.L. Truitt, E.C. Borden, Immunoregulatory properties of ISG15, an interferon-induced cytokine, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 211e215. [13] M. Yasuike, H. Kondo, I. Hirono, T. Aoki, Identification and characterization of Japanese flounder, Paralichthys olivaceus interferon-stimulated gene 15 (JfISG15), Comp. Immunol. Microbiol. Infect. Dis. 34 (2011) 83e91. [14] G.W. Baeck, J.W. Kim, C.I. Park, Identification and expression analysis of an interferon stimulated gene 15 (ISG15) from black rockfish, Sebastes schlegeli, Fish Shellfish Immunol. 25 (2008) 679e681. [15] T.P. RØ kenes, R. Larsen, B. Robertsen, Atlantic salmon ISG15: expression and conjugation to cellular proteins in response to interferon, double-stranded RNA and virus infections, Mol. Immunol. 44 (2007) 950e959. [16] M. Seppola, J. Stenvik, K. Steiro, T. Solstad, B. Robertsen, I. Jensen, Sequence and expression analysis of an interferon stimulated gene (ISG15) from Atlantic cod (Gadus morhua L.), Dev. Comp. Immunol. 31 (2007) 156e171. [17] I. Milev-Milovanovic, S. Majji, V. Thodima, Y. Deng, L. Hanson, A. Arnizaut, et al., Identification and expression analyses of poly [I: C]-stimulated genes in channel catfish (Ictalurus punctatus), Fish Shellfish Immunol. 33 (2009) 811e820. [18] Y.B. Zhang, Y.L. Wang, J.F. Gui, Identification and characterization of two homologues of interferon-stimulated gene ISG15 in crucian carp, Fish Shellfish Immunol. 23 (2007) 52e61. [19] K.I. Kim, D.E. Zhang, ISG15, not just another ubiquitin-like protein, Biochem. Biophys. Res. Commun. 307 (2003) 431e434. [20] E. Abollo, C. Ord as, S. Dios, A. Figureas, B. Novoa, Molecular characterisation of a turbot Mx cDNA, Fish Shellfish Immunol. 19 (2005) 185e190. [21] C.Y. Shi, Y.G. Wang, S.L. Yang, J. Huang, Q.Y. Wang, The first report of an iridovirus-like agent infection in farmed turbot, Scophthalmus maximus, in China, Aquaculture 236 (2004) 11e25. [22] R.J. Reed, H. Muench, A simple method of estimating fifty percent endpoints, Am. J. Hyg. 27 (1938) 493e503. [23] S. Palumbi, R.A. Martin, S. Romano, W.O. McMillan, L. Stice, G. Grabowski, The Simple Fools Guide to PCR, Version 2, University of Hawaii Zoology Department, Honolulu, HI, USA, 1991, p. 46. [24] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method, Methods 25 (2001) 402e408. [25] R. Breathnach, P. Chambon, Organization and expression of eucaryotic split genes coding for proteins, Annu. Rev. Biochem. 50 (1981) 349e383. [26] J. Narasimhan, M. Wang, Z. Fu, J.M. Klein, A.L. Hass, J.P. Kim, Crystal structure of the interferon-induced ubiquitin-like protein ISG15, J. Biol. Chem. 280 (2005) 27356e27365. [27] K.R. Loeb, A.L. Haas, The interferon-inducible 15-kDa ubiquitin homolog conjugates to intracellular proteins, J. Biol. Chem. 267 (1992) 7806e7813. [28] E. Knight, D. Fahey, B. Cordova, M. Hillman, N. Reich, D.A. Blomstrom, 15-kDa interferon-induced protein is derived by COOH-terminal processing of a 17kDa precursor, J. Biol. Chem. 263 (1988) 4520e4522. [29] K. Matsumoto, K.M. Wassarman, A.P. Wolffe, Nuclear history of a pre-mRNA determines the translational activity of cytoplasmic mRNA, Embo J. 17 (1988) 2107e2121. [30] C. Zhao, C. Denison, J.M. Huibregtse, S. Gygi, R.M. Krug, Human ISG15 conjugation targets both IFN-induced and constitutively expressed proteins functioning in diverse cellular pathways, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 10200e10205. [31] M.D. Fast, D.E. Sims, J.F. Burka, A. Mustaf, N.W. Ross, Skin morphology and humoral non-specific defence parameters of mucus and plasma in rainbow trout, coho and Atlantic salmon, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 132 (2002) 645e657. [32] C. Bebington, S.C. Bell, F.J. Doherty, A.T. Fazleabas, S.D. Fleming, Localization of ubiquitin and ubiquitin cross-reactive protein in human and baboon endometrium and decidua during the menstrual cycle and early pregnancy, Biol. Reprod. 60 (1999) 920e928. [33] G.B. Hu, J. Xia, H.M. Lou, X.L. Chen, J. Li, Q.M. Liu, An IRF-3 homolog that is upregulated by DNA virus and poly I: C in turbot, Scophthalmus maximus, Fish Shellfish Immunol. 31 (2011) 1224e1231. [34] J. Xia, G.B. Hu, X.Z. Dong, Q.M. Liu, S.C. Zhang, Molecular characterization and expression analysis of interferon regulatory factor 5 (IRF-5) inturbot, Scophthalmus maximus, Fish Shellfish Immunol. 32 (2012) 211e218. [35] G.B. Hu, J. Xia, H.M. Lou, Q.M. Liu, J.Y. Lin, X.Y. Yin, X.Z. Dong, Cloning and expression analysis of interferon regulatory factor 7 (IRF-7) in turbot, Scophthalmus maximus, Dev. Comp. Immunol. 35 (2011) 416e420. [36] R.N. Harty, P.M. Pitha, A. Okumura, Antiviral activity of innate immune protein ISG15, J. Innate Immun. 1 (2009) 397e404. [37] B. Robertsen, Expression of interferon and interferon-induced genes in salmonids in response to virus infection, interferon-inducing compounds and vaccination, Fish Shellfish Immunol. 25 (2008) 351e357. [38] M.P. Gantier, B.R.G. Williams, The response of mammalian cells to doublestranded RNA, Cytokine Growth Factor Rev. 18 (2007) 363e371. [39] B.T. Hummer, X.L. Li, B.A. Hassel, Role for p53 in gene induction by doublestranded RNA, J. Virol. 75 (2001) 7774e7777.