- Email: [email protected]
Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41)
ARTICLE IN PRESS Developmental and Comparative Immunology ■■ (2014) ■■–■■
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41) Q1 Xinyu Zhu, Dang Wang, Huan Zhang, Yanrong Zhou, Rui Luo, Huanchun Chen,
Shaobo Xiao, Liurong Fang * State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China
A R T I C L E
I N F O
Article history: Received 25 April 2014 Revised 26 July 2014 Accepted 26 July 2014 Available online Keywords: DDX41 Porcine Interferon-β
A B S T R A C T
DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), a member of the DEXDc helicase family, was recently identified as an intracellular DNA sensor in mouse myeloid dendritic cells. In this study, porcine DDX41 (poDDX41) was cloned and its role in the type I interferon (IFN) signaling pathway was investigated in porcine kidney (PK-15) cells. Full-length poDDX41 cDNA encodes 622 amino acid residues and contains a DEADc domain and a HELICc domain. poDDX41 mRNA is widely expressed in different tissues, especially the stomach and liver. Overexpression of poDDX41 in PK-15 cells induced IFN-β by activating transcription factors IRF3 and NF-κB. Knockdown of poDDX41 with siRNA significantly reduced IFN-β expression induced by poly(dA:dT), a double-stranded DNA (dsDNA) analogue, or pseudorabies virus, a dsDNA swine virus. Therefore, poDDX41 is involved in the dsDNA- and dsDNA-virus-mediated type I IFN signaling pathway in porcine kidney cells. © 2014 Published by Elsevier Ltd.
32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
1. Introduction The innate immune system is conserved in a wide variety of hosts. As the first line of defense against invading pathogens, the antiviral innate immune responses are triggered by the recognition of specific structures on the invading viruses, designated ‘pathogenassociated molecular patterns’, by pattern recognition receptors (PRRs). This results in the recruitment of adaptor molecules, such as virus-induced signaling adapter (VISA), myeloid differentiation primary response gene 88 (MyD88), and Toll/IL-1 receptor (TIR)domain-containing adaptor inducing IFN-β (TRIF) (Kawai and Akira, 2010; Xu et al., 2005; Yamamoto et al., 2002, 2003). The recruitment of adaptor molecules results in the activation of associated kinases and transcription factors, such as interferon regulatory factor 3 (IRF3) and nuclear factor-κB (NF-κB) (Jiang et al., 2004), thereby promoting the expression of type I interferon (IFN) and helping the host against the infection of pathogen (Bonjardim et al., 2009). PRRs, including Toll-like receptors, NOD-like receptors, C-type lectin receptors, and RIG-I-like receptors, play critical roles in the mechanism that induces type I IFN expression (Kanneganti et al., 2007; Lien and Ingalls, 2002; Takaoka et al., 2007; Valladeau et al., 2000).
54 55 56 57 58 59
* Corresponding author at: Laboratory of Infectious Diseases, College of Veterinary Medicine, Huazhong Agricultural University, 1 Shi-zi-shan Street, Wuhan 430070, China. Tel.: +86 27 8728 6884; fax: +86 27 8728 2608. E-mail address: [email protected] (L. Fang).
The initial antiviral responses are dominated by the recognition of nucleic acids, and several sensors of cytosolic DNA have been identified, including DNA-dependent activator of IFNregulatory factors (DAI), RNA polymerase III, the cyclic GMP-AMP (cGAMP) synthetase (cGAS) and gamma-inducible protein 16 (IFI16) (Chiu et al., 2009; Sun et al., 2013; Takaoka et al., 2007; Unterholzner et al., 2010). More recently, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 (DDX41) has also been showed to sense microbial DNA to trigger the early induction of type I IFN in mouse splenic myeloid dendritic cells (Barber, 2011; Fullam and Schroder, 2013; Zhang et al., 2011). When stimulated by poly(dA:dT), DDX41 combines with it physically and interacts with the downstream adaptor molecule STING (also called TMEM173, ERIS, MPYS, or MITA), triggering the activation of IRF3 and NF-κB, which are important transcription factors in regulating type I IFN expression (Jin et al., 2008; Sun et al., 2009; Takaoka and Taniguchi, 2008; Zhong et al., 2008). Until now, only mouse DDX41 has been identified as an important sensor of cytoplasmic DNA in myeloid dendritic cells. In this study, we cloned the full-length cDNA of porcine DDX41 (poDDX41) and characterized the protein’s function in regulating type I IFN signaling. Our results demonstrate that poDDX41 plays an important role in the induction of IFN-β and activates the transcription factors IRF3 and NF-κB in porcine kidney cells (PK15 cells). We also show that pseudorabies virus (PRV), a dsDNA swine virus, activates IFN-β expression in a poDDX41-dependent manner.
http://dx.doi.org/10.1016/j.dci.2014.07.020 0145-305X/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
2
1 2
features of poDDX41 at the Pfam database website (http:// pfam.sanger.ac.uk/).
Table 1 The sequences of siRNAs used in the study.
3 4 5 6 7 8 9 10 11
siRNA
Sequences (5′ to 3′)
sipoDDX41-1
GCCUAAAGAAGAAGGGCAUTT AUGCCCUUCUUCUUUAGGCTT GCGACAUCCGUACCAUCUUTT AAGAUGGUACGGAUGUCGCTT CCAUCCAGCAUGUCAUCAATT UUGAUGACAUGCUGGAUGGTT UUCUCCGAACCGUGUCACGUTT ACGUGACACGGUUCGGAGAATT
sipoDDX41-2 sipoDDX41-3 siNegative control
12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
2. Materials and methods 2.1. Cells, tissues, virus, and reagents PK-15 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. The experimental tissues, including heart, liver, spleen, lung, kidney, stomach, small intestine, and muscle, were taken from healthy Landrace pigs aged 3 months. All the tissues were washed three times in phosphate-buffered saline (PBS, pH 7.2) and snap frozen in liquid nitrogen for RNA isolation (Jiang et al., 2007). Poly(dA:dT) was purchased from Sigma. Pseudorabies virus (PRV) strain Ea is a wild virulent strain isolated in China (Xiao et al., 2004). Three pairs of small interfering RNA (siRNA) sequences targeting poDDX41 mRNA were synthesized by Shanghai GenePharma Co., Ltd. The details of the siRNA sequences are given in Table 1. 2.2. Cloning poDDX41 cDNA
Q2
A search of the pig expressed sequence tag (EST) database (http:// www.ncbi.nlm.nih.gov/blast/Blast.cgi?PAGE_TYPE=BlastSearch &PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&BLAST _SPEC=OGP_9823_10718) with the human DDX41 sequence (NM_016222.2) identified two porcine EST sequences (HX240689.1 and CK456180.1) with high similarity to the 5′ and 3′ ends of human DDX41, respectively. Based on these EST sequences, two primers (DDX41-F and DDX41-R, respectively; Table 2) were designed and used to amplify the full-length cDNA of poDDX41 with reverse transcription (RT)–PCR from the total RNA extracted from PK-15 cells. The PCR product was cloned into pCAGGS–Flag, a modified vector derived from pCAGGS–MCS (Niwa et al., 1991), to generate the eukaryotic expression construct pCAGGS–poDDX41.
51 52 53
69 2.4. Distribution analysis of poDDX41 mRNA in different tissues The total cellular RNAs from different tissues of three healthy Landrace pigs were extracted with Trizol Reagent (Invitrogen) and real-time RT–PCR was conducted with primers DDX41-qF and DDX41-qR (Table 2), using the SYBR Green Realtime PCR Master Mix (Toyobo). With the comparative cycle threshold method, the relative quantities of poDDX41 mRNA were assessed. As an internal control, the swine glyceraldehyde 3-phosphate dehydrogenase (GAPDH) transcript was amplified with primers GAPDH-F and GAPDH-R (Table 2) for the normalization of the relative quantities of poDDX41 mRNA.
Table 2 PCR primers used in the study.
54
Primer
Sequences (5′ to 3′)
55 56 57 58 59 60 61 62 63 64 65 66
DDX41-F DDX41-R DDX41(Δ1-182)-F DDX41(Δ1-182)-R DDX41(Δ1-407)-F DDX41(Δ1-407)-R DDX41(Δ408-622)-F DDX41(Δ408-622)-R DDX41q-F DDX41q-R GAPDH-F GAPDH-R
TTTGGTACCATGGAGGAATCCGAACCAGAGAG TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG GCCGGTACCTTCAAGGAAATGAAATTTCCTGC TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG TTTGGTACCGTCATCCAGGAAGTGGAATACGT TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG GCCGGTACCATGGAGGAATCCGAACCAGAGAG TTTAGATCTATCCAGGCTGGCAGCCCCGGCGC GCCACAGACGTAGCCTCCAA CCGATACGGTGCACATAATTCTC ACATGGCCTCCAAGGAGTAAGA GATCGAGTTGGGGCTGTGACT
70 71 72 73 74 75 76 77 78 79 80 81 82
2.5. Plasmid construction and transfection, and luciferase reporter assays The luciferase reporter plasmids IFN-β-Luc, NF-κB-Luc, and IRF3Luc have been described previously (Wang et al., 2008). IFN-β-Luc expresses firefly luciferase under the control of the porcine IFN-β promoter (from −296 to +52, the +1 position refers to the transcriptional start site of M86762 in GenBank). NF-κB-Luc and IRF3-Luc contain four copies of the NF-κB-(from −68 to −57) or IRF3-(from −94 to −66) binding positive regulatory domain (PRD) motif of the porcine IFN-β promoter in front of a luciferase reporter gene, respectively. Using PCR and the primers described in Table 2, we generated DNA expression constructs encoding deletion mutants of poDDX41: DDX41(aa183-622) (lacking amino acids 1–182 of the N-terminal [DEADc] domain), DDX41(aa408-622) (lacking the DEAD box helicase [DEADc] domain), and DDX41(aa1-407) (lacking the conserved C-terminal helicase [HELICc] domain). The constructs were subcloned into pCAGGS–Flag and all constructs were confirmed by sequencing. PK-15 cells seeded in 24-well plates were transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen). Luciferase assays were performed according to the manufacturer’s instructions (Promega). Briefly, cells were transfected with an expression plasmid (1.0 μg/well) or the empty vector (1.0 μg/well) together with 0.1 μg/well of a reporter plasmid (IFN-β–Luc, NF-κB– Luc, or IRF3–Luc) (Wang et al., 2008) and the pRL-TK plasmid expressing Renilla luciferase (0.1 μg/well; Promega) as the internal reference. All reporter assays were repeated at least three times.
2.3. Sequence alignment and phylogenetic analysis Amino acid sequences were aligned with the ClustalX 2.1 program, and phylogenetic and molecular evolutionary analyses were performed. We also analyzed the predicted domains and
67 68
83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
2.6. Western blotting analysis PK-15 cells were seeded in six-well tissue culture plates at a density of 2.5 × 105 cells/well. When the cells reached approximately 70–80% confluence, empty vector, poDDX41(aa1-407), poDDX41(aa408-622), poDDX41(aa183-622), or poDDX41 was respectively transfected at concentrations of 1.0 μg/well using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions. After 48 h, the cells were washed three times with PBS, collected, and lysed in 100 ml of SDS protein sample buffer (2% SDS, 60 mM Tris-HCl [pH 6.8], 10% glycerol, 0.001% bromophenol blue, and 0.33% β-mercaptoethanol). The cell lysates were resolved with 10% acrylamide SDS-PAGE and the separated proteins were electroblotted onto a nitrocellulose membrane. An anti-Flag monoclonal antibody (Macgene) and a horseradish-peroxidase-conjugated anti-mouse IgG antibody (Beyotime) were bound sequentially to the target proteins. The signals on the nitrocellulose membrane were detected with the SuperSignal West Pio Luminol/Enhancer Solution (Pierce).
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
1 2 3 4 5 6 7
3
Fig. 1. (A) Alignment of the deduced amino acid sequence of poDDX41 with other animal DDX41 proteins from human, mouse, cow, monkey, Drosophila, oyster, and tilapia. Asterisks or dots indicate identical amino acid residues or similar amino acid residues, respectively. (B) A phylogenetic tree of the deduced amino acid sequence of poDDX41 and other animal DDX41 proteins. The identified or predicted DDX41s on the phylogenetic tree are sequences from different species available from the National Center for Biotechnology Information. The sequences were taken from GenBank entries with accession numbers AGK93040.1 (pig), NP_057306.2 (human), XP_002744529.1 (monkey), BAE30391.1 (mouse), NP_001076071.1 (cow), XP_001381058.2 (Drosophila), EKC40522.1 (oyster), and XP_003445915.1 (tilapia). The unrooted tree was constructed with the neighbor-joining method based on the alignment of the DDX41 amino acid sequences. The scale bar is 0.05. The number in phylogenetic tree represents the bootstrap value.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44
2.7. Statistical analysis Student’s t test was used to determine the statistical significance of differences. P values of < 0.05 were considered statistically significant; P values of < 0.01 were considered extremely statistically significant. 3. Results and discussion 3.1. Cloning and sequence analysis of poDDX41 cDNA Primers DDX41-F and DDX41-R (Table 2) were designed based on the two porcine EST sequences (HX240689.1 and CK456180.1) found in the pig EST database, and were used to amplify the potential poDDX41 cDNA from the total RNA extracted from PK-15 cells with RT–PCR. The full-length cDNA of poDDX41 contains 1869 bp and encodes 622 amino acid residues (GenBank accession number KC412874; Fig. 1A). A multiple sequence alignment indicated that the amino acid sequence of poDDX41 is over 99% identical to that of the human, monkey, and cow DDX41 proteins, and 98.71%, 94.98%, 84.53%, and 70.90% identical to that of mouse, Drosophila, tilapia, and oyster DDX41 proteins, respectively. A phylogenetic analysis showed that poDDX41 belongs to the cluster containing cow DDX41 (Fig. 1B). 3.2. Tissue-specific expression of poDDX41 Until now, there are no published studies on the issue distribution of DDX41 in vivo. We analyzed the expression profiles of poDDX41 mRNA, and showed that poDDX41 is widely expressed in different tissues, including the intestine, adipose tissue, stomach, muscle, spleen, lung, liver, kidney, heart, and lymph (Fig. 2). Surprisingly, abundant expression of poDDX41 in all tested tissues is in stomach and liver. These results indicated that poDDX41 expression is not restricted to tissues of the immune system, but is also expressed in non-immune tissues, raising the possibility that poDDX41 possesses other unknown functions in addition to its immune regulating roles. 3.3. Overexpression of poDDX41 stimulates NF-κB and IRF3 to induce IFN-β To investigate the function of poDDX41 in the type I IFN signaling pathway, PK-15 cells were cotransfected with poDDX41
45
46 47 48 49 50 51
Fig. 2. Relative expression levels of poDDX41 mRNA transcripts in porcine tissues. Total RNAs extracted from different tissues of a healthy Landrace pig were treated with (RNase-free) DNaseI and analyzed with real-time RT–PCR. The expression of poDDX41 mRNA was normalized to the expression of the GAPDH gene. Data were normalized to the results for the intestine and the error bars indicate standard deviations.
expression plasmids and a porcine IFN-β gene (IFNB) promoter– luciferase reporter plasmid. Porcine IFNB promoter–luciferase reporter assays showed that the overexpression of poDDX41 significantly activated the porcine IFNB promoter (P < 0.01) in a dosedependent way, compared with that in PK-15 cells transfected with the empty vector (Fig. 3A). It is well known that IRF3 and NF-κB are two key transcription factors in IFN-β signaling, so we investigated whether poDDX41 activates IRF3 or NF-κB. As shown in Fig. 3B and C, the overexpression of poDDX41 activated IRF3 (P < 0.01; Fig. 3B) and NF-κB (P < 0.01; Fig. 3C). These results reveal that poDDX41 is an important molecule inducing IFN-β expression by activating NF-κB and IRF3 in PK-15 cells. To predict the structural domains of poDDX41, the putative amino acid sequence of poDDX41 was analyzed at the Pfam database website (http://pfam.sanger.ac.uk/). The results showed that poDDX41 contains a DEADc domain (amino acids 205–385) and a HELICc domain (amino acids 450–527). Based on these predicted domains, three mutants were constructed in which the different domains were deleted to investigate their roles in the induction of IFN-β expression. Western blotting showed that each mutant was expressed in the transfected PK-15 cells (Fig. 3E). The porcine IFNB promoter–luciferase reporter assays showed that only the overexpression of DDX41(aa408-622), lacking the DEADc domain, impaired the activation of the IFN-β promoter, indicating that the DEADc domain of poDDX41 is required for poDDX41mediated IFNB promoter activation (Fig. 3F). Interestingly, when the cells were transfected with the DDX41(aa1-407) mutant, the IFNB promoter was more strongly activated than in cells transfected with full-length poDDX41. It is possible that the HELICc domain causes some kind of obstruction of the IFN signaling pathway. 3.4. poDDX41 knockdown blocks poly(dA:dT)- or PRV-stimulated induction of IFN-β expression To further investigate the function of poDDX41 in type I IFN signaling, we designed three double-stranded 21-residue siRNA constructs targeting different regions of the poDDX41 mRNA (Table 1). A real-time RT–PCR analysis showed that transfection with sipoDDX41-3 reduced the endogenous transcription of DDX41 mRNA by more than 50% in PK-15 cells (Fig. 4A). Therefore, sipoDDX41-3 was selected for subsequent experiments. PK-15 cells were transfected with the siNegative control or sipoDDX41-3 together with an IFNB promoter–luciferase reporter plasmid and after 24 h, the PK-15 cells were transfected with poly(dA:dT). The knockdown of poDDX41 expression reduced the IFNB promoter activity after poly(dA:dT) stimulation, whereas in contrast, the PK-15 cells transfected with the siNegative control showed normal IFNB promoter activity (Fig. 4B), indicating that poDDX41 is required in the poly(dA:dT)-induced IFN-β signaling pathway. In the same way, the knockdown of poDDX41 reduced the activity of the porcine IFN-β promoter when PK-15 cells were stimulated with PRV (Fig. 4B). These data suggest that poDDX41 plays an important role in the antiviral response to PRV infection and to poly(dA:dT) stimulation in PK-15 cells. The results of our study are consistent with the conclusion of Zhang et al. that DDX41 senses dsDNA (Zhang et al., 2011). It is well known that DEAD-box helicases are essential in various cellular processes including mRNA export, transcriptional and translational regulation, and ribosome biogenesis (Rocak and Linder, 2004). More recent studies suggested that DDX41 could recognize the bacterial secondary messengers cyclic di-GMP or cyclic diAMP to activate the type I IFN immune response, and that DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells (Bowie, 2012; Miyabe et al., 2014; Parvatiyar et al., 2012). Interestingly, another recently identified DNA sensor, cGAS, also
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
1 2 3 4 5 6 7 8 9
5
Fig. 3. poDDX41 stimulates NF-κB and IRF3 expression to induce IFN-β. PK-15 cells were transfected with 1.0 μg/well of the expression plasmid (poDDX41 or empty vector) together with 0.1 μg/well of a reporter plasmid (IFN-β–Luc [A], IRF3–Luc [B] or NF–κB-Luc [C]) and the pRL-TK plasmid (0.1 μg/well) for normalization using Lipofectamine 2000. Luciferase assays were performed 30 h after transfection. **P < 0.01 compared with cells transfected with the empty vector. (D) Schematic diagram of the structure of full-length poDDX41 and its deletion mutants. (E) Western blotting analysis of the expression of different poDDX41 mutant constructs in PK-15 cells. Lanes 1–5 represents cells transfected with 1.0 μg/well of empty vector, poDDX41(aa183-622), poDDX41(aa408-622), poDDX41(aa1-407) and poDDX41, respectively. The details of the western blot were described in Materials and Methods. (F) The induction of IFNB promoter activity by poDDX41 and its mutants. PK-15 cells were transfected with different poDDX41 expression plasmids (empty vector, poDDX41, poDDX41(aa183-622), poDDX41(aa408-622), or poDDX41(aa1-407)), together with the reporter plasmid IFN-β–Luc and pRLTK for normalization. All luciferase assays were repeated at least three times and the data shown are means ± SD (n = 3) from single representative experiments. **P < 0.01 compared with cells transfected with poDDX41.
10 11 12 13 14 15 16 17 18
recognizes microbial DNA to generate the second messenger cGAMP to initiate the STING pathway and subsequent IFN production (Ablasser et al., 2013; Diner et al., 2013; Sun et al., 2013; Wu et al., 2013; Xiao and Fitzgerald, 2013). Furthermore, previous studies have suggested that DDX41 is involved in the detection of c-di-GMP and c-di-AMP and the interaction of DDX41 with c-di-GMP was shown higher affinity than that with STING (Parvatiyar et al., 2012). Thus, it is interesting to determine whether DDX41 functions in concert
with or engages directly with the cGAS-cGAMP system to induce IFN production. In summary, porcine DDX41 has a high degree of amino acid sequence homology with DDX41 of other mammals, and is widely expressed in different porcine tissues. Notably, the expression of poDDX41 is not restricted to tissues of the immune system. Our results also show that porcine DDX41 is an important molecule, inducing IFN-β expression by activating NF-κB and IRF3 in the porcine
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
19 20 21 22 23 24 25 26
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
6
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Fig. 4. poDDX41 knockdown blocks poly(dA:dT)- and PRV-induced IFN-β production. (A) The knockdown efficiency of siRNA targeting poDDX41. PK-15 cells were transfected with 1.0 μg/well sipoDDX41-1, sipoDDX41-2, sipoDDX41-3, or siNegative control (siNegative). At 36 h after transfection, the cells were collected and the endogenously transcribed poDDX41 mRNA in the cells was detected with real-time RT–PCR. The transcription of poDDX41 mRNA was normalized to that of GAPDH mRNA. *P < 0.05 or ** P < 0.01 compared with siNegative. (B) PK-15 cells were transfected with 1.0 μg/well sipoDDX41-3 or siNegative, together with IFN-β–Luc (0.1 μg/ well) and pRL-TK (0.1 μg/well). At 24 h after transfection, the cells were transfected with 1.0 μg/well poly(dA:dT) or infected with PRV. Luciferase assays were performed 12 h after poly(dA:dT) transfection or 10 h after PRV infection. All luciferase assays were repeated at least three times and the data shown are the means ± SD (n = 3) of single representative experiments. **P < 0.01 or *P < 0.05 compared with siNegative.
15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35
innate immune system, and is involved in the poly(dA:dT)- and PRVinduced expression of IFN-β in PK-15 cells. The DEADc domain of porcine DDX41 is essential in this signaling pathway. These data on porcine DDX41 extend our understanding of its role in the infectious diseases of pigs. Acknowledgements This work was supported by the National Basic Research Program (973) of China (2014CB522700), the National Natural Sciences Foundation of China (31225027, 31172326), the Key Grant Project of Chinese Ministry of Education (313025), and the Fundamental Research Funds for the Central Universities (2013PY058, 2013PY043). References Ablasser, A., Goldeck, M., Cavlar, T., Deimling, T., Witte, G., Rohl, I., et al., 2013. cGAS produces a 2′-5′-linked cyclic dinucleotide second messenger that activates STING. Nature 498, 380–384. Barber, G.N., 2011. STING-dependent signaling. Nat. Immunol. 12, 929–930.
Bonjardim, C.A., Ferreira, P.C., Kroon, E.G., 2009. Interferons: signaling, antiviral and viral evasion. Immunol. Lett. 122, 1–11. Bowie, A.G., 2012. Innate sensing of bacterial cyclic dinucleotides: more than just STING. Nat. Immunol. 13, 1137–1139. Chiu, Y.H., Macmillan, J.B., Chen, Z.J., 2009. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 138, 576–591. Diner, E.J., Burdette, D.L., Wilson, S.C., Monroe, K.M., Kellenberger, C.A., Hyodo, M., et al., 2013. The innate immune DNA sensor cGAS produces a noncanonical cyclic dinucleotide that activates human STING. Cell Rep. 3, 1355–1361. Fullam, A., Schroder, M., 2013. DExD/H-box RNA helicases as mediators of anti-viral innate immunity and essential host factors for viral replication. Biochim. Biophys. Acta 1829, 854–865. Jiang, Y., Fang, L., Xiao, S., Zhang, H., Pan, Y., Luo, R., et al., 2007. Immunogenicity and protective efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus. Vaccine 25, 547–560. Jiang, Z., Mak, T.W., Sen, G., Li, X., 2004. Toll-like receptor 3-mediated activation of NF-kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta. Proc. Natl. Acad. Sci. USA 101, 3533–3538. Jin, L., Waterman, P.M., Jonscher, K.R., Short, C.M., Reisdorph, N.A., Cambier, J.C., 2008. MPYS, a novel membrane tetraspanner, is associated with major histocompatibility complex class II and mediates transduction of apoptotic signals. Mol. Cell. Biol. 28, 5014–5026. Kanneganti, T.D., Lamkanfi, M., Nunez, G., 2007. Intracellular NOD-like receptors in host defense and disease. Immunity 27, 549–559. Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11, 373–384. Lien, E., Ingalls, R.R., 2002. Toll-like receptors. Crit. Care Med. 30, S1–S11. Miyabe, H., Hyodo, M., Nakamura, T., Sato, Y., Hayakawa, Y., Harashima, H., 2014. A new adjuvant delivery system ‘cyclic di-GMP/YSK05 liposome’ for cancer immunotherapy. J. Control. Release 184, 20–27. Niwa, H., Yamamura, K., Miyazaki, J., 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–199. Parvatiyar, K., Zhang, Z., Teles, R.M., Ouyang, S., Jiang, Y., Iyer, S.S., et al., 2012. The helicase DDX41 recognizes the bacterial secondary messengers cyclic di-GMP and cyclic di-AMP to activate a type I interferon immune response. Nat. Immunol. 13, 1155–1161. Rocak, S., Linder, P., 2004. DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232–241. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z.J., 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786– 791. Sun, W., Li, Y., Chen, L., Chen, H., You, F., Zhou, X., et al., 2009. ERIS, an endoplasmic reticulum IFN stimulator, activates innate immune signaling through dimerization. Proc. Natl. Acad. Sci. USA 106, 8653–8658. Takaoka, A., Taniguchi, T., 2008. Cytosolic DNA recognition for triggering innate immune responses. Adv. Drug Deliv. Rev. 60, 847–857. Takaoka, A., Wang, Z., Choi, M.K., Yanai, H., Negishi, H., Ban, T., et al., 2007. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448, 501–505. Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma, S., et al., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997–1004. Valladeau, J., Ravel, O., Dezutter-Dambuyant, C., Moore, K., Kleijmeer, M., Liu, Y., et al., 2000. Langerin, a novel C-type lectin specific to Langerhans cells, is an endocytic receptor that induces the formation of Birbeck granules. Immunity 12, 71–81. Wang, D., Fang, L., Li, T., Luo, R., Xie, L., Jiang, Y., et al., 2008. Molecular cloning and functional characterization of porcine IFN-beta promoter stimulator 1 (IPS-1). Vet. Immunol. Immunopathol. 125, 344–353. Wu, J., Sun, L., Chen, X., Du, F., Shi, H., Chen, C., et al., 2013. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826–830. Xiao, S., Chen, H., Fang, L., Liu, C., Zhang, H., Jiang, Y., et al., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of pseudorabies virus in mice. Vaccine 22, 345–351. Xiao, T.S., Fitzgerald, K.A., 2013. The cGAS-STING pathway for DNA sensing. Mol. Cell 51, 135–139. Xu, L.G., Wang, Y.Y., Han, K.J., Li, L.Y., Zhai, Z., Shu, H.B., 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 19, 727–740. Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., et al., 2002. Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling. J. Immunol. 169, 6668–6672. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., et al., 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301, 640–643. Zhang, Z., Yuan, B., Bao, M., Lu, N., Kim, T., Liu, Y.J., 2011. The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells. Nat. Immunol. 12, 959–965. Zhong, B., Yang, Y., Li, S., Wang, Y.Y., Li, Y., Diao, F., et al., 2008. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 29, 538–550.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41) Q1 Xinyu Zhu, Dang Wang, Huan Zhang, Yanrong Zhou, Rui Luo, Huanchun Chen,
Shaobo Xiao, Liurong Fang * State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China
A R T I C L E
I N F O
Article history: Received 25 April 2014 Revised 26 July 2014 Accepted 26 July 2014 Available online Keywords: DDX41 Porcine Interferon-β
A B S T R A C T
DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), a member of the DEXDc helicase family, was recently identified as an intracellular DNA sensor in mouse myeloid dendritic cells. In this study, porcine DDX41 (poDDX41) was cloned and its role in the type I interferon (IFN) signaling pathway was investigated in porcine kidney (PK-15) cells. Full-length poDDX41 cDNA encodes 622 amino acid residues and contains a DEADc domain and a HELICc domain. poDDX41 mRNA is widely expressed in different tissues, especially the stomach and liver. Overexpression of poDDX41 in PK-15 cells induced IFN-β by activating transcription factors IRF3 and NF-κB. Knockdown of poDDX41 with siRNA significantly reduced IFN-β expression induced by poly(dA:dT), a double-stranded DNA (dsDNA) analogue, or pseudorabies virus, a dsDNA swine virus. Therefore, poDDX41 is involved in the dsDNA- and dsDNA-virus-mediated type I IFN signaling pathway in porcine kidney cells. © 2014 Published by Elsevier Ltd.
32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
1. Introduction The innate immune system is conserved in a wide variety of hosts. As the first line of defense against invading pathogens, the antiviral innate immune responses are triggered by the recognition of specific structures on the invading viruses, designated ‘pathogenassociated molecular patterns’, by pattern recognition receptors (PRRs). This results in the recruitment of adaptor molecules, such as virus-induced signaling adapter (VISA), myeloid differentiation primary response gene 88 (MyD88), and Toll/IL-1 receptor (TIR)domain-containing adaptor inducing IFN-β (TRIF) (Kawai and Akira, 2010; Xu et al., 2005; Yamamoto et al., 2002, 2003). The recruitment of adaptor molecules results in the activation of associated kinases and transcription factors, such as interferon regulatory factor 3 (IRF3) and nuclear factor-κB (NF-κB) (Jiang et al., 2004), thereby promoting the expression of type I interferon (IFN) and helping the host against the infection of pathogen (Bonjardim et al., 2009). PRRs, including Toll-like receptors, NOD-like receptors, C-type lectin receptors, and RIG-I-like receptors, play critical roles in the mechanism that induces type I IFN expression (Kanneganti et al., 2007; Lien and Ingalls, 2002; Takaoka et al., 2007; Valladeau et al., 2000).
54 55 56 57 58 59
* Corresponding author at: Laboratory of Infectious Diseases, College of Veterinary Medicine, Huazhong Agricultural University, 1 Shi-zi-shan Street, Wuhan 430070, China. Tel.: +86 27 8728 6884; fax: +86 27 8728 2608. E-mail address: [email protected] (L. Fang).
The initial antiviral responses are dominated by the recognition of nucleic acids, and several sensors of cytosolic DNA have been identified, including DNA-dependent activator of IFNregulatory factors (DAI), RNA polymerase III, the cyclic GMP-AMP (cGAMP) synthetase (cGAS) and gamma-inducible protein 16 (IFI16) (Chiu et al., 2009; Sun et al., 2013; Takaoka et al., 2007; Unterholzner et al., 2010). More recently, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 (DDX41) has also been showed to sense microbial DNA to trigger the early induction of type I IFN in mouse splenic myeloid dendritic cells (Barber, 2011; Fullam and Schroder, 2013; Zhang et al., 2011). When stimulated by poly(dA:dT), DDX41 combines with it physically and interacts with the downstream adaptor molecule STING (also called TMEM173, ERIS, MPYS, or MITA), triggering the activation of IRF3 and NF-κB, which are important transcription factors in regulating type I IFN expression (Jin et al., 2008; Sun et al., 2009; Takaoka and Taniguchi, 2008; Zhong et al., 2008). Until now, only mouse DDX41 has been identified as an important sensor of cytoplasmic DNA in myeloid dendritic cells. In this study, we cloned the full-length cDNA of porcine DDX41 (poDDX41) and characterized the protein’s function in regulating type I IFN signaling. Our results demonstrate that poDDX41 plays an important role in the induction of IFN-β and activates the transcription factors IRF3 and NF-κB in porcine kidney cells (PK15 cells). We also show that pseudorabies virus (PRV), a dsDNA swine virus, activates IFN-β expression in a poDDX41-dependent manner.
http://dx.doi.org/10.1016/j.dci.2014.07.020 0145-305X/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
2
1 2
features of poDDX41 at the Pfam database website (http:// pfam.sanger.ac.uk/).
Table 1 The sequences of siRNAs used in the study.
3 4 5 6 7 8 9 10 11
siRNA
Sequences (5′ to 3′)
sipoDDX41-1
GCCUAAAGAAGAAGGGCAUTT AUGCCCUUCUUCUUUAGGCTT GCGACAUCCGUACCAUCUUTT AAGAUGGUACGGAUGUCGCTT CCAUCCAGCAUGUCAUCAATT UUGAUGACAUGCUGGAUGGTT UUCUCCGAACCGUGUCACGUTT ACGUGACACGGUUCGGAGAATT
sipoDDX41-2 sipoDDX41-3 siNegative control
12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
2. Materials and methods 2.1. Cells, tissues, virus, and reagents PK-15 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. The experimental tissues, including heart, liver, spleen, lung, kidney, stomach, small intestine, and muscle, were taken from healthy Landrace pigs aged 3 months. All the tissues were washed three times in phosphate-buffered saline (PBS, pH 7.2) and snap frozen in liquid nitrogen for RNA isolation (Jiang et al., 2007). Poly(dA:dT) was purchased from Sigma. Pseudorabies virus (PRV) strain Ea is a wild virulent strain isolated in China (Xiao et al., 2004). Three pairs of small interfering RNA (siRNA) sequences targeting poDDX41 mRNA were synthesized by Shanghai GenePharma Co., Ltd. The details of the siRNA sequences are given in Table 1. 2.2. Cloning poDDX41 cDNA
Q2
A search of the pig expressed sequence tag (EST) database (http:// www.ncbi.nlm.nih.gov/blast/Blast.cgi?PAGE_TYPE=BlastSearch &PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&BLAST _SPEC=OGP_9823_10718) with the human DDX41 sequence (NM_016222.2) identified two porcine EST sequences (HX240689.1 and CK456180.1) with high similarity to the 5′ and 3′ ends of human DDX41, respectively. Based on these EST sequences, two primers (DDX41-F and DDX41-R, respectively; Table 2) were designed and used to amplify the full-length cDNA of poDDX41 with reverse transcription (RT)–PCR from the total RNA extracted from PK-15 cells. The PCR product was cloned into pCAGGS–Flag, a modified vector derived from pCAGGS–MCS (Niwa et al., 1991), to generate the eukaryotic expression construct pCAGGS–poDDX41.
51 52 53
69 2.4. Distribution analysis of poDDX41 mRNA in different tissues The total cellular RNAs from different tissues of three healthy Landrace pigs were extracted with Trizol Reagent (Invitrogen) and real-time RT–PCR was conducted with primers DDX41-qF and DDX41-qR (Table 2), using the SYBR Green Realtime PCR Master Mix (Toyobo). With the comparative cycle threshold method, the relative quantities of poDDX41 mRNA were assessed. As an internal control, the swine glyceraldehyde 3-phosphate dehydrogenase (GAPDH) transcript was amplified with primers GAPDH-F and GAPDH-R (Table 2) for the normalization of the relative quantities of poDDX41 mRNA.
Table 2 PCR primers used in the study.
54
Primer
Sequences (5′ to 3′)
55 56 57 58 59 60 61 62 63 64 65 66
DDX41-F DDX41-R DDX41(Δ1-182)-F DDX41(Δ1-182)-R DDX41(Δ1-407)-F DDX41(Δ1-407)-R DDX41(Δ408-622)-F DDX41(Δ408-622)-R DDX41q-F DDX41q-R GAPDH-F GAPDH-R
TTTGGTACCATGGAGGAATCCGAACCAGAGAG TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG GCCGGTACCTTCAAGGAAATGAAATTTCCTGC TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG TTTGGTACCGTCATCCAGGAAGTGGAATACGT TTTAGATCTTCAGAAGTCCATGGAGCTGTGGG GCCGGTACCATGGAGGAATCCGAACCAGAGAG TTTAGATCTATCCAGGCTGGCAGCCCCGGCGC GCCACAGACGTAGCCTCCAA CCGATACGGTGCACATAATTCTC ACATGGCCTCCAAGGAGTAAGA GATCGAGTTGGGGCTGTGACT
70 71 72 73 74 75 76 77 78 79 80 81 82
2.5. Plasmid construction and transfection, and luciferase reporter assays The luciferase reporter plasmids IFN-β-Luc, NF-κB-Luc, and IRF3Luc have been described previously (Wang et al., 2008). IFN-β-Luc expresses firefly luciferase under the control of the porcine IFN-β promoter (from −296 to +52, the +1 position refers to the transcriptional start site of M86762 in GenBank). NF-κB-Luc and IRF3-Luc contain four copies of the NF-κB-(from −68 to −57) or IRF3-(from −94 to −66) binding positive regulatory domain (PRD) motif of the porcine IFN-β promoter in front of a luciferase reporter gene, respectively. Using PCR and the primers described in Table 2, we generated DNA expression constructs encoding deletion mutants of poDDX41: DDX41(aa183-622) (lacking amino acids 1–182 of the N-terminal [DEADc] domain), DDX41(aa408-622) (lacking the DEAD box helicase [DEADc] domain), and DDX41(aa1-407) (lacking the conserved C-terminal helicase [HELICc] domain). The constructs were subcloned into pCAGGS–Flag and all constructs were confirmed by sequencing. PK-15 cells seeded in 24-well plates were transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen). Luciferase assays were performed according to the manufacturer’s instructions (Promega). Briefly, cells were transfected with an expression plasmid (1.0 μg/well) or the empty vector (1.0 μg/well) together with 0.1 μg/well of a reporter plasmid (IFN-β–Luc, NF-κB– Luc, or IRF3–Luc) (Wang et al., 2008) and the pRL-TK plasmid expressing Renilla luciferase (0.1 μg/well; Promega) as the internal reference. All reporter assays were repeated at least three times.
2.3. Sequence alignment and phylogenetic analysis Amino acid sequences were aligned with the ClustalX 2.1 program, and phylogenetic and molecular evolutionary analyses were performed. We also analyzed the predicted domains and
67 68
83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
2.6. Western blotting analysis PK-15 cells were seeded in six-well tissue culture plates at a density of 2.5 × 105 cells/well. When the cells reached approximately 70–80% confluence, empty vector, poDDX41(aa1-407), poDDX41(aa408-622), poDDX41(aa183-622), or poDDX41 was respectively transfected at concentrations of 1.0 μg/well using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions. After 48 h, the cells were washed three times with PBS, collected, and lysed in 100 ml of SDS protein sample buffer (2% SDS, 60 mM Tris-HCl [pH 6.8], 10% glycerol, 0.001% bromophenol blue, and 0.33% β-mercaptoethanol). The cell lysates were resolved with 10% acrylamide SDS-PAGE and the separated proteins were electroblotted onto a nitrocellulose membrane. An anti-Flag monoclonal antibody (Macgene) and a horseradish-peroxidase-conjugated anti-mouse IgG antibody (Beyotime) were bound sequentially to the target proteins. The signals on the nitrocellulose membrane were detected with the SuperSignal West Pio Luminol/Enhancer Solution (Pierce).
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
1 2 3 4 5 6 7
3
Fig. 1. (A) Alignment of the deduced amino acid sequence of poDDX41 with other animal DDX41 proteins from human, mouse, cow, monkey, Drosophila, oyster, and tilapia. Asterisks or dots indicate identical amino acid residues or similar amino acid residues, respectively. (B) A phylogenetic tree of the deduced amino acid sequence of poDDX41 and other animal DDX41 proteins. The identified or predicted DDX41s on the phylogenetic tree are sequences from different species available from the National Center for Biotechnology Information. The sequences were taken from GenBank entries with accession numbers AGK93040.1 (pig), NP_057306.2 (human), XP_002744529.1 (monkey), BAE30391.1 (mouse), NP_001076071.1 (cow), XP_001381058.2 (Drosophila), EKC40522.1 (oyster), and XP_003445915.1 (tilapia). The unrooted tree was constructed with the neighbor-joining method based on the alignment of the DDX41 amino acid sequences. The scale bar is 0.05. The number in phylogenetic tree represents the bootstrap value.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44
2.7. Statistical analysis Student’s t test was used to determine the statistical significance of differences. P values of < 0.05 were considered statistically significant; P values of < 0.01 were considered extremely statistically significant. 3. Results and discussion 3.1. Cloning and sequence analysis of poDDX41 cDNA Primers DDX41-F and DDX41-R (Table 2) were designed based on the two porcine EST sequences (HX240689.1 and CK456180.1) found in the pig EST database, and were used to amplify the potential poDDX41 cDNA from the total RNA extracted from PK-15 cells with RT–PCR. The full-length cDNA of poDDX41 contains 1869 bp and encodes 622 amino acid residues (GenBank accession number KC412874; Fig. 1A). A multiple sequence alignment indicated that the amino acid sequence of poDDX41 is over 99% identical to that of the human, monkey, and cow DDX41 proteins, and 98.71%, 94.98%, 84.53%, and 70.90% identical to that of mouse, Drosophila, tilapia, and oyster DDX41 proteins, respectively. A phylogenetic analysis showed that poDDX41 belongs to the cluster containing cow DDX41 (Fig. 1B). 3.2. Tissue-specific expression of poDDX41 Until now, there are no published studies on the issue distribution of DDX41 in vivo. We analyzed the expression profiles of poDDX41 mRNA, and showed that poDDX41 is widely expressed in different tissues, including the intestine, adipose tissue, stomach, muscle, spleen, lung, liver, kidney, heart, and lymph (Fig. 2). Surprisingly, abundant expression of poDDX41 in all tested tissues is in stomach and liver. These results indicated that poDDX41 expression is not restricted to tissues of the immune system, but is also expressed in non-immune tissues, raising the possibility that poDDX41 possesses other unknown functions in addition to its immune regulating roles. 3.3. Overexpression of poDDX41 stimulates NF-κB and IRF3 to induce IFN-β To investigate the function of poDDX41 in the type I IFN signaling pathway, PK-15 cells were cotransfected with poDDX41
45
46 47 48 49 50 51
Fig. 2. Relative expression levels of poDDX41 mRNA transcripts in porcine tissues. Total RNAs extracted from different tissues of a healthy Landrace pig were treated with (RNase-free) DNaseI and analyzed with real-time RT–PCR. The expression of poDDX41 mRNA was normalized to the expression of the GAPDH gene. Data were normalized to the results for the intestine and the error bars indicate standard deviations.
expression plasmids and a porcine IFN-β gene (IFNB) promoter– luciferase reporter plasmid. Porcine IFNB promoter–luciferase reporter assays showed that the overexpression of poDDX41 significantly activated the porcine IFNB promoter (P < 0.01) in a dosedependent way, compared with that in PK-15 cells transfected with the empty vector (Fig. 3A). It is well known that IRF3 and NF-κB are two key transcription factors in IFN-β signaling, so we investigated whether poDDX41 activates IRF3 or NF-κB. As shown in Fig. 3B and C, the overexpression of poDDX41 activated IRF3 (P < 0.01; Fig. 3B) and NF-κB (P < 0.01; Fig. 3C). These results reveal that poDDX41 is an important molecule inducing IFN-β expression by activating NF-κB and IRF3 in PK-15 cells. To predict the structural domains of poDDX41, the putative amino acid sequence of poDDX41 was analyzed at the Pfam database website (http://pfam.sanger.ac.uk/). The results showed that poDDX41 contains a DEADc domain (amino acids 205–385) and a HELICc domain (amino acids 450–527). Based on these predicted domains, three mutants were constructed in which the different domains were deleted to investigate their roles in the induction of IFN-β expression. Western blotting showed that each mutant was expressed in the transfected PK-15 cells (Fig. 3E). The porcine IFNB promoter–luciferase reporter assays showed that only the overexpression of DDX41(aa408-622), lacking the DEADc domain, impaired the activation of the IFN-β promoter, indicating that the DEADc domain of poDDX41 is required for poDDX41mediated IFNB promoter activation (Fig. 3F). Interestingly, when the cells were transfected with the DDX41(aa1-407) mutant, the IFNB promoter was more strongly activated than in cells transfected with full-length poDDX41. It is possible that the HELICc domain causes some kind of obstruction of the IFN signaling pathway. 3.4. poDDX41 knockdown blocks poly(dA:dT)- or PRV-stimulated induction of IFN-β expression To further investigate the function of poDDX41 in type I IFN signaling, we designed three double-stranded 21-residue siRNA constructs targeting different regions of the poDDX41 mRNA (Table 1). A real-time RT–PCR analysis showed that transfection with sipoDDX41-3 reduced the endogenous transcription of DDX41 mRNA by more than 50% in PK-15 cells (Fig. 4A). Therefore, sipoDDX41-3 was selected for subsequent experiments. PK-15 cells were transfected with the siNegative control or sipoDDX41-3 together with an IFNB promoter–luciferase reporter plasmid and after 24 h, the PK-15 cells were transfected with poly(dA:dT). The knockdown of poDDX41 expression reduced the IFNB promoter activity after poly(dA:dT) stimulation, whereas in contrast, the PK-15 cells transfected with the siNegative control showed normal IFNB promoter activity (Fig. 4B), indicating that poDDX41 is required in the poly(dA:dT)-induced IFN-β signaling pathway. In the same way, the knockdown of poDDX41 reduced the activity of the porcine IFN-β promoter when PK-15 cells were stimulated with PRV (Fig. 4B). These data suggest that poDDX41 plays an important role in the antiviral response to PRV infection and to poly(dA:dT) stimulation in PK-15 cells. The results of our study are consistent with the conclusion of Zhang et al. that DDX41 senses dsDNA (Zhang et al., 2011). It is well known that DEAD-box helicases are essential in various cellular processes including mRNA export, transcriptional and translational regulation, and ribosome biogenesis (Rocak and Linder, 2004). More recent studies suggested that DDX41 could recognize the bacterial secondary messengers cyclic di-GMP or cyclic diAMP to activate the type I IFN immune response, and that DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells (Bowie, 2012; Miyabe et al., 2014; Parvatiyar et al., 2012). Interestingly, another recently identified DNA sensor, cGAS, also
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
1 2 3 4 5 6 7 8 9
5
Fig. 3. poDDX41 stimulates NF-κB and IRF3 expression to induce IFN-β. PK-15 cells were transfected with 1.0 μg/well of the expression plasmid (poDDX41 or empty vector) together with 0.1 μg/well of a reporter plasmid (IFN-β–Luc [A], IRF3–Luc [B] or NF–κB-Luc [C]) and the pRL-TK plasmid (0.1 μg/well) for normalization using Lipofectamine 2000. Luciferase assays were performed 30 h after transfection. **P < 0.01 compared with cells transfected with the empty vector. (D) Schematic diagram of the structure of full-length poDDX41 and its deletion mutants. (E) Western blotting analysis of the expression of different poDDX41 mutant constructs in PK-15 cells. Lanes 1–5 represents cells transfected with 1.0 μg/well of empty vector, poDDX41(aa183-622), poDDX41(aa408-622), poDDX41(aa1-407) and poDDX41, respectively. The details of the western blot were described in Materials and Methods. (F) The induction of IFNB promoter activity by poDDX41 and its mutants. PK-15 cells were transfected with different poDDX41 expression plasmids (empty vector, poDDX41, poDDX41(aa183-622), poDDX41(aa408-622), or poDDX41(aa1-407)), together with the reporter plasmid IFN-β–Luc and pRLTK for normalization. All luciferase assays were repeated at least three times and the data shown are means ± SD (n = 3) from single representative experiments. **P < 0.01 compared with cells transfected with poDDX41.
10 11 12 13 14 15 16 17 18
recognizes microbial DNA to generate the second messenger cGAMP to initiate the STING pathway and subsequent IFN production (Ablasser et al., 2013; Diner et al., 2013; Sun et al., 2013; Wu et al., 2013; Xiao and Fitzgerald, 2013). Furthermore, previous studies have suggested that DDX41 is involved in the detection of c-di-GMP and c-di-AMP and the interaction of DDX41 with c-di-GMP was shown higher affinity than that with STING (Parvatiyar et al., 2012). Thus, it is interesting to determine whether DDX41 functions in concert
with or engages directly with the cGAS-cGAMP system to induce IFN production. In summary, porcine DDX41 has a high degree of amino acid sequence homology with DDX41 of other mammals, and is widely expressed in different porcine tissues. Notably, the expression of poDDX41 is not restricted to tissues of the immune system. Our results also show that porcine DDX41 is an important molecule, inducing IFN-β expression by activating NF-κB and IRF3 in the porcine
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
19 20 21 22 23 24 25 26
ARTICLE IN PRESS X. Zhu et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■
6
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Fig. 4. poDDX41 knockdown blocks poly(dA:dT)- and PRV-induced IFN-β production. (A) The knockdown efficiency of siRNA targeting poDDX41. PK-15 cells were transfected with 1.0 μg/well sipoDDX41-1, sipoDDX41-2, sipoDDX41-3, or siNegative control (siNegative). At 36 h after transfection, the cells were collected and the endogenously transcribed poDDX41 mRNA in the cells was detected with real-time RT–PCR. The transcription of poDDX41 mRNA was normalized to that of GAPDH mRNA. *P < 0.05 or ** P < 0.01 compared with siNegative. (B) PK-15 cells were transfected with 1.0 μg/well sipoDDX41-3 or siNegative, together with IFN-β–Luc (0.1 μg/ well) and pRL-TK (0.1 μg/well). At 24 h after transfection, the cells were transfected with 1.0 μg/well poly(dA:dT) or infected with PRV. Luciferase assays were performed 12 h after poly(dA:dT) transfection or 10 h after PRV infection. All luciferase assays were repeated at least three times and the data shown are the means ± SD (n = 3) of single representative experiments. **P < 0.01 or *P < 0.05 compared with siNegative.
15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35
innate immune system, and is involved in the poly(dA:dT)- and PRVinduced expression of IFN-β in PK-15 cells. The DEADc domain of porcine DDX41 is essential in this signaling pathway. These data on porcine DDX41 extend our understanding of its role in the infectious diseases of pigs. Acknowledgements This work was supported by the National Basic Research Program (973) of China (2014CB522700), the National Natural Sciences Foundation of China (31225027, 31172326), the Key Grant Project of Chinese Ministry of Education (313025), and the Fundamental Research Funds for the Central Universities (2013PY058, 2013PY043). References Ablasser, A., Goldeck, M., Cavlar, T., Deimling, T., Witte, G., Rohl, I., et al., 2013. cGAS produces a 2′-5′-linked cyclic dinucleotide second messenger that activates STING. Nature 498, 380–384. Barber, G.N., 2011. STING-dependent signaling. Nat. Immunol. 12, 929–930.
Bonjardim, C.A., Ferreira, P.C., Kroon, E.G., 2009. Interferons: signaling, antiviral and viral evasion. Immunol. Lett. 122, 1–11. Bowie, A.G., 2012. Innate sensing of bacterial cyclic dinucleotides: more than just STING. Nat. Immunol. 13, 1137–1139. Chiu, Y.H., Macmillan, J.B., Chen, Z.J., 2009. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 138, 576–591. Diner, E.J., Burdette, D.L., Wilson, S.C., Monroe, K.M., Kellenberger, C.A., Hyodo, M., et al., 2013. The innate immune DNA sensor cGAS produces a noncanonical cyclic dinucleotide that activates human STING. Cell Rep. 3, 1355–1361. Fullam, A., Schroder, M., 2013. DExD/H-box RNA helicases as mediators of anti-viral innate immunity and essential host factors for viral replication. Biochim. Biophys. Acta 1829, 854–865. Jiang, Y., Fang, L., Xiao, S., Zhang, H., Pan, Y., Luo, R., et al., 2007. Immunogenicity and protective efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus. Vaccine 25, 547–560. Jiang, Z., Mak, T.W., Sen, G., Li, X., 2004. Toll-like receptor 3-mediated activation of NF-kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta. Proc. Natl. Acad. Sci. USA 101, 3533–3538. Jin, L., Waterman, P.M., Jonscher, K.R., Short, C.M., Reisdorph, N.A., Cambier, J.C., 2008. MPYS, a novel membrane tetraspanner, is associated with major histocompatibility complex class II and mediates transduction of apoptotic signals. Mol. Cell. Biol. 28, 5014–5026. Kanneganti, T.D., Lamkanfi, M., Nunez, G., 2007. Intracellular NOD-like receptors in host defense and disease. Immunity 27, 549–559. Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11, 373–384. Lien, E., Ingalls, R.R., 2002. Toll-like receptors. Crit. Care Med. 30, S1–S11. Miyabe, H., Hyodo, M., Nakamura, T., Sato, Y., Hayakawa, Y., Harashima, H., 2014. A new adjuvant delivery system ‘cyclic di-GMP/YSK05 liposome’ for cancer immunotherapy. J. Control. Release 184, 20–27. Niwa, H., Yamamura, K., Miyazaki, J., 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–199. Parvatiyar, K., Zhang, Z., Teles, R.M., Ouyang, S., Jiang, Y., Iyer, S.S., et al., 2012. The helicase DDX41 recognizes the bacterial secondary messengers cyclic di-GMP and cyclic di-AMP to activate a type I interferon immune response. Nat. Immunol. 13, 1155–1161. Rocak, S., Linder, P., 2004. DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232–241. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z.J., 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786– 791. Sun, W., Li, Y., Chen, L., Chen, H., You, F., Zhou, X., et al., 2009. ERIS, an endoplasmic reticulum IFN stimulator, activates innate immune signaling through dimerization. Proc. Natl. Acad. Sci. USA 106, 8653–8658. Takaoka, A., Taniguchi, T., 2008. Cytosolic DNA recognition for triggering innate immune responses. Adv. Drug Deliv. Rev. 60, 847–857. Takaoka, A., Wang, Z., Choi, M.K., Yanai, H., Negishi, H., Ban, T., et al., 2007. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448, 501–505. Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma, S., et al., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997–1004. Valladeau, J., Ravel, O., Dezutter-Dambuyant, C., Moore, K., Kleijmeer, M., Liu, Y., et al., 2000. Langerin, a novel C-type lectin specific to Langerhans cells, is an endocytic receptor that induces the formation of Birbeck granules. Immunity 12, 71–81. Wang, D., Fang, L., Li, T., Luo, R., Xie, L., Jiang, Y., et al., 2008. Molecular cloning and functional characterization of porcine IFN-beta promoter stimulator 1 (IPS-1). Vet. Immunol. Immunopathol. 125, 344–353. Wu, J., Sun, L., Chen, X., Du, F., Shi, H., Chen, C., et al., 2013. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826–830. Xiao, S., Chen, H., Fang, L., Liu, C., Zhang, H., Jiang, Y., et al., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of pseudorabies virus in mice. Vaccine 22, 345–351. Xiao, T.S., Fitzgerald, K.A., 2013. The cGAS-STING pathway for DNA sensing. Mol. Cell 51, 135–139. Xu, L.G., Wang, Y.Y., Han, K.J., Li, L.Y., Zhai, Z., Shu, H.B., 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 19, 727–740. Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., et al., 2002. Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling. J. Immunol. 169, 6668–6672. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., et al., 2003. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301, 640–643. Zhang, Z., Yuan, B., Bao, M., Lu, N., Kim, T., Liu, Y.J., 2011. The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells. Nat. Immunol. 12, 959–965. Zhong, B., Yang, Y., Li, S., Wang, Y.Y., Li, Y., Diao, F., et al., 2008. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 29, 538–550.
Please cite this article in press as: Xinyu Zhu, et al., Molecular cloning and functional characterization of porcine DEAD (Asp–Glu–Ala–Asp) box polypeptide 41 (DDX41), Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.07.020
36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119