- Email: [email protected]
Molecular Cloning and Mapping of the Brain-Abundant B1γ Subunit of Protein Phosphatase 2A, PPP2R2C, to Human Chromosome 4p16
All articles available online at http://www.idealibrary.com on
SHORT COMMUNICATION Molecular Cloning and Mapping of the Brain-Abundant B1␥ Subunit of Protein Phosphatase 2A, PPP2R2C, to Human Chromosome 4p16 Peirong Hu, Long Yu, 1 Min Zhang, Lihua Zheng, Yong Zhao, Qiang Fu, and Shouyuan Zhao State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433, People’s Republic of China Received November 10, 1999; accepted April 5, 2000
are substrates for PP2A, including protein kinase B, protein kinase C, p70 S6 kinase, calmodulin-dependent kinases, and cyclin-dependent kinase (8). The holoenzymic catalytic activity, the substrate specificity, and the subcellular targeting fraction of the PP2A protein complex are determined mainly by its structural composition (3). The PP2A complex consists of three subunits, a catalytic subunit (C), a regulatory subunit (A), and a highly variable regulatory subunit (B) (9). The B-subunit family is further divided into three subfamilies (B1, B2, and B3, i.e., reported previously as B, B⬘, and B⬙), which have been found to associate with the PP2A 1, PP2A 0 , and PCS m, respectively (11). Usui and co-workers found that three forms of PP2A (AC, AB1C, and AB3C) from human erythrocytes showed a very different turnover value with the same histone H1 as substrate (6). Subunits reconstitution studies of PP2A also suggested that combinations with different B-subunits could change the activities of the phosphatase (13). In the B1 subfamily of PP2A, three isoforms (␣, , and ␥) have been identified in rabbit and rat (1, 5, 10, 14). Investigation at the protein level by using specific antibodies showed that the B1␣-subunit was ubiquitously expressed, while B1 and B1␥ were expressed mainly in brain (1, 14). It was also found that B1␣ and B1 were mainly in the cytosolic region, and B1␥ was enriched in the cytoskeletal fraction (12). Furthermore, the expression levels of B1 and B1␥ are remarkably variable in different development phases (with B1 decreasing and B1␥ increasing sharply after birth), while the B1␣ subunit was expressed constantly (12). These studies suggested that the three isoforms have functional differences during development. However, only two subunits, B1␣ and B2, have been identified in human (7). In this study, the cDNA of the B1␥ subunit was identified, and its tissue expression pattern and chromosome localization were also determined. To clone the third member of the B1 subfamily of
Protein phosphatase 2A (PP2A) is one kind of serine/ threonine protein phosphatase regulating mainly cell growth and division. It comprises three subunits, A, B, and C. The B-subunit is involved in enzyme activity and substrate specificity. The B-subunit family is of great diversity and is divided into three classes, the B1, B2, and B3 subfamilies. Until now, two members of the B1 subfamily, B1␣ and B1, have been identified in human. In this report, the third member of the subfamily, B1␥, was identified, and its cDNA was isolated from a human brain cDNA library. This novel cDNA is 4120 bp in length and contains an open reading frame (nt 55–1398) encoding 447 amino acid residues. The putative protein shares 81 and 85% identity with B1␣ (PPP2R2A) and B1 (PPP2R2B), respectively, and was named PPP2R2C for its high level of homology to the other two isoforms. One remarkable characteristic of this novel gene is that it is highly expressed in brain with a 4.7-kb transcript while it is nearly undetectable in other tissues. In addition, the PPP2R2C gene was localized to human chromosome 4p16 between markers D4S2925 and D4S3007 with 5.45 cR (LOD > 14) and 2.63 cR (LOD > 15) RH distance, respectively, by radiation hybrid panel mapping. © 2000 Academic Press
Many cell biological processes are regulated by reversible protein phosphorylation, which is controlled by protein kinases and phosphatases. Among the serine/threonine phosphatases, protein phosphatase 2A (PP2A) plays an important role in the regulation of cell growth and division (3). In addition to the serine/ threonine phosphatase activity, PP2A has a low level of tyrosine phosphatase activity (4) and displays a broad range of substrate specificity in vitro (2). Several protein kinases in cellular signal transduction cascades Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AF086924. 1 To whom correspondence should be addressed. Telephone: (86) 21-65642422. Fax: (86)21-65643250. E-mail: [email protected].
83
Genomics 67, 83– 86 (2000) doi:10.1006/geno.2000.6219 0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
84
SHORT COMMUNICATION
FIG. 1. PPP2R2C cDNA and its deduced amino acid sequence. The start codon (ATG) and stop codon (TAG) are underlined, and the polyadenylation signals (AATAAA) at the 3⬘UTR are shaded.
human PP2A, the cDNA sequences of human B1␣ and B1 were used as information probes to screen a human EST database based on the high level of homology among the members of the B1 subfamily of PP2A in other mammals. A set of ESTs were obtained and assembled into an intact 4120-bp sequence with GCG ASSEMBLING software. According to the sequence of the EST contig, primers A (5⬘-GCCTTCAATGGGCGAGGACACG-3⬘), B (5⬘-CAGCTGTCCTCATCAGTGCTGTG-3⬘), C (5⬘-TGGCAGTGTGTGGACACAGGAAG-3⬘), D (5⬘-GTG TCCTCTGGGACTGTGTGGTC3⬘), E (5⬘-GCCTCTGTCTTGTGAAGTAGGAC-3⬘), and F (5⬘-CTATTACACTGGTCCTTCCACCG-3⬘) were designed to perform PCR on a human brain cDNA library (Gibco). The amplified fragments (A/B, C/D, E/F) were
confirmed by DNA sequencing to be identical with the EST contig sequence mentioned above. This cDNA contains an intact open reading frame with a length of 1344 bp (nt 55–1398), which encodes 447 amino acid residues (Fig. 1). Previously referred to by the symbols (PPP2R2A, PPP2R2B) B1␣ and B1, this novel human isoform of the B1 subfamily was given the gene symbol PPP2R2C and named protein phosphatase 2, regulatory subunit B (PR52), gamma isoform by the HUGO Nomenclature Committee. The deduced protein sequence of PPP2R2C shows 81 and 85% identity with human PPP2R2A and PPP2R2B, respectively. The amino acid sequence alignment of the three members is shown in Fig. 2. The most obvious difference among them is 4 more amino
SHORT COMMUNICATION
85
FIG. 3. The expression pattern of PPP2R2C in human tissues. (A) Multiple Tissue Northern blots containing mRNA from 16 adult human tissues were hybridized with isotope-labeled PPP2R2C cDNA. A 4.7-kb transcript was detected more abundantly in brain and at low levels in prostate and testis and was nearly undetectable in other tissues; a 2.2-kb band can also be detected. (B) The same blots were hybridized with -actin cDNA as a control. FIG. 2. Homology comparison among PPP2R2C (B␥), PPP2R2A (B␣), and PPP2R2B (B). A period indicates the same amino acid residue compared with PPP2R2C.
acid residues ( 444SDMH 447) at the C-terminal of PPP2R2C than of the other two isoforms. The N-terminal region of PPP2R2C is more similar to that of PPP2R2B rather than PPP2R2A; only 4 residues are not identical within the first 25-amino-acid region of PPP2R2B and PPP2R2C. These different amino acid residues in B␣, B, and B␥ may be important for their distinct functions. Northern blot analysis of PPP2R2C was performed. The 1466-bp PPP2R2C cDNA fragment amplified by primer A/B was labeled with isotope-labeled [␣- 32P]dATP and hybridized to MTN membranes (MTN I and II, Clontech) blotting mRNA from 16 human tissues. The hybridization pattern revealed that a 4.7-kb transcript was abundantly expressed in brain, was expressed at low levels in prostate and testis, and was nearly undetectable in the 13 other tissues (see Fig. 3). A 2.2-kb transcript with low abundance in brain and testis was also observed. Since there are three polyadenylation signals (AATAAA) at nt 1613– 1618, nt 4036 – 4041, and nt 4071– 4076, it is suggested that the two transcripts may be the result of the alternative polyadenylation of mRNA. The expression pattern of PPP2R2C is quite different from that of PPP2R2A, which was expressed as two abundant transcripts of 2.3 and 2.5 kb and a low-abundance transcript of 4.4 kb in all 7 human cell lines originating from different tissues (HeLa, Bowes, A1146, A-431, MCF7, IMR32, and LA-N-1) (7). The expression pattern is also different from that of PPP2R2B, which was expressed highly as a 2.3-kb transcript in the neuroblastoma-derived cell line LA-N-1 and at much lower levels in the 6 other cell lines (7). The abundant expression of PPP2R2C in human brain suggests that it
might play a role together with PPP2R2B in neuronal development. The chromosomal location of PPP2R2C was determined by radiation hybrid panel mapping. After the GenBank NR database was searched with Blastn software, a short genomic sequence (AF096160) containing the partial coding sequence and 3⬘-UTR of the PPP2R2C cDNA was obtained. Based on this sequence, primer RH (5⬘-CATGTTCGATCGGAACACCAAGC-3⬘) was designed and paired with the primer B mentioned above to amplify a 370-bp DNA fragment. After the sequences of the PCR products from five normal Chinese individuals were confirmed by sequencing, the two primers were used to perform PCR on the Stanford Human Genome Center GB4 radiation hybrid panel (Research Genetics, 93 samples). The PCR results on
FIG. 4. Chromosome mapping of PPP2R2C to human chromosome 4p16. The radiation hybrid map was constructed with the GB4 multipoint program. The framework and the flanking genes in this region are shown.
86
SHORT COMMUNICATION
the GB4 panel were recorded as follows: 01000001010000000100-0011010010-0111000100-00001110001000000010-1100011100-0000000000-0100000100110. This result was sent to the Sanger RH Mapping Server for statistical analysis, which showed that the gene was mapped to chromosome 4p16 between markers D4S2925 (LOD ⬎ 14) with 5.45 cR and D4S3007 (LOD ⬎ 15) with 2.63 cR, in the order 4pter–D4S2925– PPP2R2C–D4S3007. In this region, a number of wellknown genes are also contained (shown in Fig.4). In conclusion, we have cloned, characterized, and mapped PPP2R2C, the third member of the human B-subunit B1 subfamily of PP2A.
6.
7.
8.
9.
ACKNOWLEDGMENTS This work was supported by the Chinese 863 High Technology Program (863-Z-02-04-01), the National 973 Program (973-2-3), and the National Natural Science Foundation of China (39525015, 39680019).
10.
REFERENCES 11. 1.
2. 3. 4.
5.
Akiyama, N., Shima, H., Hatano, Y., Osawa, Y., Sugimura, T., and Nagao, M. (1995). cDNA cloning of BR ␥, a novel brainspecific isoform of the B regulatory subunit of type-2A protein phosphatase. Eur. J. Biochem. 230: 766 –772. Cohen, P. (1989). The structure and regulation of protein phosphatases. Annu. Rev. Biochem. 58: 453–508. Goldberg, Y. (1999). Protein phosphatase 2A: Who shall regulate the regulator? Biochem. Pharmacol. 57: 321–328. Goris, J., Pallen, C. J., Parker, P. J., Hermann, J., Waterfield, M. D., and Merlevede, W. (1988). Conversion of a phosphoseryl/ threonyl phosphatase into a phosphotyrosyl phosphatase. Biochem. J. 256: 1029 –1034. Healy, A. M., Zolnierowicz, S., Stapelton, A. E., Goebl, M., DePaoli-Roach, A. A., and Pringle, J. R. (1991). CDC55, a Saccharomyces cerevisiae gene involved in cellular morphogenesis:
12.
13.
14.
Identification, characterization, and homology to the B subunit of mammalian type 2A protein phosphatase. Mol. Cell. Biol. 11: 5767–5780. Imaoka, T., Imazu, M., Usui, H., Kinohara, N., and Tadeda, M. (1983). Resolution and reassociation of three distinct components from pig heart phosphoprotein phosphatase. J. Biol. Chem. 258: 1526 –1535. Mayer, R. E., Hendrix, P., Cron, P., Matthies, R., Stone, S. R., Goris, J., Merlevede, W., Hofsteenge, J., and Hemmings, B. A. (1991). Structure of the 55 kDa regulatory subunit of protein phosphatase 2A: Evidence for a neuronal specific isoform. Biochemistry 30: 3589 –3597. Millward, T. A., Zolnierowicz, S., and Hemmings, B. A. (1999). Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem. Sci. 24: 186 –191. Mumby, M. C., and Walter, G. (1993). Protein serine/threonine phosphatases: Structure, regulation, and functions in cell growth. Physiol. Rev. 73: 673– 699. Pallas, D. C., Weller, W., Jaspers, S., Miller, T. B., Lane, W. S., and Roberts, T. M. (1992). The third subunit of protein phosphatase 2A(PP2A), a 55-kilodalton protein which is apparently substituted for by T antigens in complexes with the 36- and 63-kilodalton PP2A subunits, bears little resemblance to T antigens. J. Virol. 66: 886 – 893. Shenolikar, S., and Nairn, A. C. (1991). Protein phosphatases: Recent progress. Adv. Second Messenger Phosphoprotein Res. 23: 1–121. Strack, S., Zaucha, J. A., Ebner, F. F., Colbran, R. J., and Wadzinski, B. E. (1998). Brain protein phosphatase 2A: Developmental regulation and distinct cellular and subcellular localization by B subunits. J. Comp. Neurol. 392: 515–527. Usui, H., Imazu, M., Maeta, K., Tsukamoto, H., Azuma, K., and Takeda, M. (1988). Three distinct forms of type 2A protein phosphatase in human erythrocyte cytosol. J. Biol. Chem. 263: 3752–3761. Zolnierowicz, S., Csortos, C., Bondor, J., Verin, A., Mumby, M. C., and Depaoli-Roach, A. A. (1994). Diversity in the regulatory B-subunits of protein phosphatase 2A: Identification of a novel isoform highly expressed in brain. Biochemistry 33: 11858 –11867.
SHORT COMMUNICATION Molecular Cloning and Mapping of the Brain-Abundant B1␥ Subunit of Protein Phosphatase 2A, PPP2R2C, to Human Chromosome 4p16 Peirong Hu, Long Yu, 1 Min Zhang, Lihua Zheng, Yong Zhao, Qiang Fu, and Shouyuan Zhao State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433, People’s Republic of China Received November 10, 1999; accepted April 5, 2000
are substrates for PP2A, including protein kinase B, protein kinase C, p70 S6 kinase, calmodulin-dependent kinases, and cyclin-dependent kinase (8). The holoenzymic catalytic activity, the substrate specificity, and the subcellular targeting fraction of the PP2A protein complex are determined mainly by its structural composition (3). The PP2A complex consists of three subunits, a catalytic subunit (C), a regulatory subunit (A), and a highly variable regulatory subunit (B) (9). The B-subunit family is further divided into three subfamilies (B1, B2, and B3, i.e., reported previously as B, B⬘, and B⬙), which have been found to associate with the PP2A 1, PP2A 0 , and PCS m, respectively (11). Usui and co-workers found that three forms of PP2A (AC, AB1C, and AB3C) from human erythrocytes showed a very different turnover value with the same histone H1 as substrate (6). Subunits reconstitution studies of PP2A also suggested that combinations with different B-subunits could change the activities of the phosphatase (13). In the B1 subfamily of PP2A, three isoforms (␣, , and ␥) have been identified in rabbit and rat (1, 5, 10, 14). Investigation at the protein level by using specific antibodies showed that the B1␣-subunit was ubiquitously expressed, while B1 and B1␥ were expressed mainly in brain (1, 14). It was also found that B1␣ and B1 were mainly in the cytosolic region, and B1␥ was enriched in the cytoskeletal fraction (12). Furthermore, the expression levels of B1 and B1␥ are remarkably variable in different development phases (with B1 decreasing and B1␥ increasing sharply after birth), while the B1␣ subunit was expressed constantly (12). These studies suggested that the three isoforms have functional differences during development. However, only two subunits, B1␣ and B2, have been identified in human (7). In this study, the cDNA of the B1␥ subunit was identified, and its tissue expression pattern and chromosome localization were also determined. To clone the third member of the B1 subfamily of
Protein phosphatase 2A (PP2A) is one kind of serine/ threonine protein phosphatase regulating mainly cell growth and division. It comprises three subunits, A, B, and C. The B-subunit is involved in enzyme activity and substrate specificity. The B-subunit family is of great diversity and is divided into three classes, the B1, B2, and B3 subfamilies. Until now, two members of the B1 subfamily, B1␣ and B1, have been identified in human. In this report, the third member of the subfamily, B1␥, was identified, and its cDNA was isolated from a human brain cDNA library. This novel cDNA is 4120 bp in length and contains an open reading frame (nt 55–1398) encoding 447 amino acid residues. The putative protein shares 81 and 85% identity with B1␣ (PPP2R2A) and B1 (PPP2R2B), respectively, and was named PPP2R2C for its high level of homology to the other two isoforms. One remarkable characteristic of this novel gene is that it is highly expressed in brain with a 4.7-kb transcript while it is nearly undetectable in other tissues. In addition, the PPP2R2C gene was localized to human chromosome 4p16 between markers D4S2925 and D4S3007 with 5.45 cR (LOD > 14) and 2.63 cR (LOD > 15) RH distance, respectively, by radiation hybrid panel mapping. © 2000 Academic Press
Many cell biological processes are regulated by reversible protein phosphorylation, which is controlled by protein kinases and phosphatases. Among the serine/threonine phosphatases, protein phosphatase 2A (PP2A) plays an important role in the regulation of cell growth and division (3). In addition to the serine/ threonine phosphatase activity, PP2A has a low level of tyrosine phosphatase activity (4) and displays a broad range of substrate specificity in vitro (2). Several protein kinases in cellular signal transduction cascades Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AF086924. 1 To whom correspondence should be addressed. Telephone: (86) 21-65642422. Fax: (86)21-65643250. E-mail: [email protected].
83
Genomics 67, 83– 86 (2000) doi:10.1006/geno.2000.6219 0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
84
SHORT COMMUNICATION
FIG. 1. PPP2R2C cDNA and its deduced amino acid sequence. The start codon (ATG) and stop codon (TAG) are underlined, and the polyadenylation signals (AATAAA) at the 3⬘UTR are shaded.
human PP2A, the cDNA sequences of human B1␣ and B1 were used as information probes to screen a human EST database based on the high level of homology among the members of the B1 subfamily of PP2A in other mammals. A set of ESTs were obtained and assembled into an intact 4120-bp sequence with GCG ASSEMBLING software. According to the sequence of the EST contig, primers A (5⬘-GCCTTCAATGGGCGAGGACACG-3⬘), B (5⬘-CAGCTGTCCTCATCAGTGCTGTG-3⬘), C (5⬘-TGGCAGTGTGTGGACACAGGAAG-3⬘), D (5⬘-GTG TCCTCTGGGACTGTGTGGTC3⬘), E (5⬘-GCCTCTGTCTTGTGAAGTAGGAC-3⬘), and F (5⬘-CTATTACACTGGTCCTTCCACCG-3⬘) were designed to perform PCR on a human brain cDNA library (Gibco). The amplified fragments (A/B, C/D, E/F) were
confirmed by DNA sequencing to be identical with the EST contig sequence mentioned above. This cDNA contains an intact open reading frame with a length of 1344 bp (nt 55–1398), which encodes 447 amino acid residues (Fig. 1). Previously referred to by the symbols (PPP2R2A, PPP2R2B) B1␣ and B1, this novel human isoform of the B1 subfamily was given the gene symbol PPP2R2C and named protein phosphatase 2, regulatory subunit B (PR52), gamma isoform by the HUGO Nomenclature Committee. The deduced protein sequence of PPP2R2C shows 81 and 85% identity with human PPP2R2A and PPP2R2B, respectively. The amino acid sequence alignment of the three members is shown in Fig. 2. The most obvious difference among them is 4 more amino
SHORT COMMUNICATION
85
FIG. 3. The expression pattern of PPP2R2C in human tissues. (A) Multiple Tissue Northern blots containing mRNA from 16 adult human tissues were hybridized with isotope-labeled PPP2R2C cDNA. A 4.7-kb transcript was detected more abundantly in brain and at low levels in prostate and testis and was nearly undetectable in other tissues; a 2.2-kb band can also be detected. (B) The same blots were hybridized with -actin cDNA as a control. FIG. 2. Homology comparison among PPP2R2C (B␥), PPP2R2A (B␣), and PPP2R2B (B). A period indicates the same amino acid residue compared with PPP2R2C.
acid residues ( 444SDMH 447) at the C-terminal of PPP2R2C than of the other two isoforms. The N-terminal region of PPP2R2C is more similar to that of PPP2R2B rather than PPP2R2A; only 4 residues are not identical within the first 25-amino-acid region of PPP2R2B and PPP2R2C. These different amino acid residues in B␣, B, and B␥ may be important for their distinct functions. Northern blot analysis of PPP2R2C was performed. The 1466-bp PPP2R2C cDNA fragment amplified by primer A/B was labeled with isotope-labeled [␣- 32P]dATP and hybridized to MTN membranes (MTN I and II, Clontech) blotting mRNA from 16 human tissues. The hybridization pattern revealed that a 4.7-kb transcript was abundantly expressed in brain, was expressed at low levels in prostate and testis, and was nearly undetectable in the 13 other tissues (see Fig. 3). A 2.2-kb transcript with low abundance in brain and testis was also observed. Since there are three polyadenylation signals (AATAAA) at nt 1613– 1618, nt 4036 – 4041, and nt 4071– 4076, it is suggested that the two transcripts may be the result of the alternative polyadenylation of mRNA. The expression pattern of PPP2R2C is quite different from that of PPP2R2A, which was expressed as two abundant transcripts of 2.3 and 2.5 kb and a low-abundance transcript of 4.4 kb in all 7 human cell lines originating from different tissues (HeLa, Bowes, A1146, A-431, MCF7, IMR32, and LA-N-1) (7). The expression pattern is also different from that of PPP2R2B, which was expressed highly as a 2.3-kb transcript in the neuroblastoma-derived cell line LA-N-1 and at much lower levels in the 6 other cell lines (7). The abundant expression of PPP2R2C in human brain suggests that it
might play a role together with PPP2R2B in neuronal development. The chromosomal location of PPP2R2C was determined by radiation hybrid panel mapping. After the GenBank NR database was searched with Blastn software, a short genomic sequence (AF096160) containing the partial coding sequence and 3⬘-UTR of the PPP2R2C cDNA was obtained. Based on this sequence, primer RH (5⬘-CATGTTCGATCGGAACACCAAGC-3⬘) was designed and paired with the primer B mentioned above to amplify a 370-bp DNA fragment. After the sequences of the PCR products from five normal Chinese individuals were confirmed by sequencing, the two primers were used to perform PCR on the Stanford Human Genome Center GB4 radiation hybrid panel (Research Genetics, 93 samples). The PCR results on
FIG. 4. Chromosome mapping of PPP2R2C to human chromosome 4p16. The radiation hybrid map was constructed with the GB4 multipoint program. The framework and the flanking genes in this region are shown.
86
SHORT COMMUNICATION
the GB4 panel were recorded as follows: 01000001010000000100-0011010010-0111000100-00001110001000000010-1100011100-0000000000-0100000100110. This result was sent to the Sanger RH Mapping Server for statistical analysis, which showed that the gene was mapped to chromosome 4p16 between markers D4S2925 (LOD ⬎ 14) with 5.45 cR and D4S3007 (LOD ⬎ 15) with 2.63 cR, in the order 4pter–D4S2925– PPP2R2C–D4S3007. In this region, a number of wellknown genes are also contained (shown in Fig.4). In conclusion, we have cloned, characterized, and mapped PPP2R2C, the third member of the human B-subunit B1 subfamily of PP2A.
6.
7.
8.
9.
ACKNOWLEDGMENTS This work was supported by the Chinese 863 High Technology Program (863-Z-02-04-01), the National 973 Program (973-2-3), and the National Natural Science Foundation of China (39525015, 39680019).
10.
REFERENCES 11. 1.
2. 3. 4.
5.
Akiyama, N., Shima, H., Hatano, Y., Osawa, Y., Sugimura, T., and Nagao, M. (1995). cDNA cloning of BR ␥, a novel brainspecific isoform of the B regulatory subunit of type-2A protein phosphatase. Eur. J. Biochem. 230: 766 –772. Cohen, P. (1989). The structure and regulation of protein phosphatases. Annu. Rev. Biochem. 58: 453–508. Goldberg, Y. (1999). Protein phosphatase 2A: Who shall regulate the regulator? Biochem. Pharmacol. 57: 321–328. Goris, J., Pallen, C. J., Parker, P. J., Hermann, J., Waterfield, M. D., and Merlevede, W. (1988). Conversion of a phosphoseryl/ threonyl phosphatase into a phosphotyrosyl phosphatase. Biochem. J. 256: 1029 –1034. Healy, A. M., Zolnierowicz, S., Stapelton, A. E., Goebl, M., DePaoli-Roach, A. A., and Pringle, J. R. (1991). CDC55, a Saccharomyces cerevisiae gene involved in cellular morphogenesis:
12.
13.
14.
Identification, characterization, and homology to the B subunit of mammalian type 2A protein phosphatase. Mol. Cell. Biol. 11: 5767–5780. Imaoka, T., Imazu, M., Usui, H., Kinohara, N., and Tadeda, M. (1983). Resolution and reassociation of three distinct components from pig heart phosphoprotein phosphatase. J. Biol. Chem. 258: 1526 –1535. Mayer, R. E., Hendrix, P., Cron, P., Matthies, R., Stone, S. R., Goris, J., Merlevede, W., Hofsteenge, J., and Hemmings, B. A. (1991). Structure of the 55 kDa regulatory subunit of protein phosphatase 2A: Evidence for a neuronal specific isoform. Biochemistry 30: 3589 –3597. Millward, T. A., Zolnierowicz, S., and Hemmings, B. A. (1999). Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem. Sci. 24: 186 –191. Mumby, M. C., and Walter, G. (1993). Protein serine/threonine phosphatases: Structure, regulation, and functions in cell growth. Physiol. Rev. 73: 673– 699. Pallas, D. C., Weller, W., Jaspers, S., Miller, T. B., Lane, W. S., and Roberts, T. M. (1992). The third subunit of protein phosphatase 2A(PP2A), a 55-kilodalton protein which is apparently substituted for by T antigens in complexes with the 36- and 63-kilodalton PP2A subunits, bears little resemblance to T antigens. J. Virol. 66: 886 – 893. Shenolikar, S., and Nairn, A. C. (1991). Protein phosphatases: Recent progress. Adv. Second Messenger Phosphoprotein Res. 23: 1–121. Strack, S., Zaucha, J. A., Ebner, F. F., Colbran, R. J., and Wadzinski, B. E. (1998). Brain protein phosphatase 2A: Developmental regulation and distinct cellular and subcellular localization by B subunits. J. Comp. Neurol. 392: 515–527. Usui, H., Imazu, M., Maeta, K., Tsukamoto, H., Azuma, K., and Takeda, M. (1988). Three distinct forms of type 2A protein phosphatase in human erythrocyte cytosol. J. Biol. Chem. 263: 3752–3761. Zolnierowicz, S., Csortos, C., Bondor, J., Verin, A., Mumby, M. C., and Depaoli-Roach, A. A. (1994). Diversity in the regulatory B-subunits of protein phosphatase 2A: Identification of a novel isoform highly expressed in brain. Biochemistry 33: 11858 –11867.