- Email: [email protected]
Molecular cloning and sequencing of a cDNA encoding a β-thyroid hormone receptor in muscovy duckling
BB
ELSEVIER
Biochimica et Biophysica Acta 1310 (1996) 127-130
Biochi f ic~a A~ta etBiophysica
Molecular cloning and sequencing of a cDNA encoding a/3-thyroid hormone receptor in muscovy duckling 1 JoE1 Lachuer a , * Catherine Legras b, Corinne Ronfort b Stdphane Barges a, Frdddrique Cohen-Adad a, Laurence Quivet a, Claude Duchamp a, Gdrard Verdier b, Hervd Barr6 a
a Laboratoire de Physiologie Compar£e de la Thermor~gulation, URA 1341 CNRS-LA 1NRA Universit£ Claude Bernard Lyon-L 43 bd. du 11 novembre 1918, B~t 404, 69622 Villeurbanne cedex, France b Laboratoire de Biologie Molgculaire et Transfert de Gbnes, UMR CNRS 106-LA 1NRA 810, Universitg Claude Bernard LYON-I, 43 bd. du 11 norembre 1918, Bgtt 741, 69622 Villeurbanne cedex, France
Received 26 June 1995; revised 15 September 1995; accepted 22 September 1995
Abstract
A cDNA clone encoding a /3-thyroid hormone receptor (TR/3 ) from muscovy duckling liver was isolated and sequenced. Comparison with the chicken TR/3 sequence showed a high degree of homology. This cDNA was used as a probe to characterize the TR/3 mRNA transcripts expressed in muscovy duckling liver. Keywords: /3-thyroid hormone receptor; TR/3; cDNA sequence; (chicken); (duck)
Thyroid hormones (TH) play a central role in the development, differentiation and metabolism of most tissues in all vertebrates (for review see Refs. [1,2]). In young birds, these hormones are especially important in the development of thermoregulatory capacity. Long-term coldexposed ducklings develop an increased capacity for muscle thermogenesis [3], and TH could well be involved in the morphological and functional changes observed in skeletal muscle of cold-acclimated ducklings [4]. Most TH effects are mediated by nuclear receptors which are members of a superfamily of ligand-dependant transcriptional factors [5,611. Thyroid receptors (TR) regulate gene expression by binding to specific TRE (thyroidresponsive elements) located upstream from target genes [7]. cDNAs encoding TR have been isolated from several
Abbreviations: TR a and TR/3, or- and /3-thyroid hormone receptors. * Corresponding author. Fax: -- 33 72 431172. i The complete nucleotide sequence reported in this paper is available from EMBL/GenBank Data Libraries under the accession number Z49151CMBTHR 0167-4889/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved SSDIO167-4889(95)OOI62-X
species of mammals, including human [8-12], rat [13-18] and mouse [19-22], as well as lower vertebrates, such as the Xenopus [23,24]. In birds, cDNAs encoding TR have only been isolated in the chicken [25-28]. Characterization of these cDNAs has revealed at least two distinct TR ( a and /3) which are similar in their overall structure: they are composed of five domains, including a cys-rich DNA binding domain and a C-terminal hormone binding domain. TR diversity is further increased by the generation of additional isoforms from the a and /3 genes. For instance, it was shown in the chicken that alternative splicing can produce two /3 variants (TR/30 and TR/32) differing in the length of their N-terminal region [28]. TR/3 0 is widely expressed while TR/32 appears to be specifically expressed in chick retina during development [28]. No chick TR/3 related to the mammalian TR/31 [8,14] has been identified. The numbers of TRs expressed, as well as the subtypes, is likely to influence the tissue response to the hormone [7]. Our understanding of the molecular mechanisms which modulate thermogenic capacity would be greatly enhanced by characterization of TR subtype expression. As a first
128
Z Lachuer et al. / Biochimica et Biophysica Acta 1310 (1996) 1 2 7 - 1 3 0
step, we have isolated and sequenced a cDNA encoding a duckling TR/3 similar to the chicken TR/30. We have also characterized the TR 13 mRNAs expressed in the liver. Livers from 5-week-old muscovy ducklings (Cairina moschata, R31 pedigree, INRA) were sampled after decapitation of the birds. Samples were immediately frozen in liquid nitrogen and stored at -80°C. Total RNA was isolated from 1-g portions of frozen tissue by the guanidinium thiocyanate method. First strand cDNA was derived from 10 /xg total RNA using an oligo(dT) primer and purified using a centricon-30 concentrator (Amicon). Using two pairs of oligonucleotide primers taken from the published chicken TR/30 sequence of Forrest et al. [26], polymerase chain reaction (PCR) was carried out with duckling liver cDNA to generate two DNA fragments, including most of the TR/3 coding sequence. For the first DNA fragment, the 5' primer [5'-GGCAGTGGTGACAGAAGAAG-3'] and the 3' primer [5'-TTCAAATGCCAGGAGGAAAC-3'] were the complement of nucleotides - 5 6 / - 3 7 and 917/936 in the published sequence (positions B1 sense and B3 antisense of Fig. 1A). For the second DNA fragment, the 5' primer [5'AGCAGCAGTTCGCTATGACC-3'] and the 3' primer [5'-ACAGCCAGTAGTGCGACAGG-3'] were complementary to nucleotides 672/691 and 1136/1155 in the published sequence (positions B2 sense and B4 antisense of Fig. 1A). The PCR products were 992-bp and 484-bp long respectively. In each case, two independent cDNA products ( 1 / 1 0 of the reaction) were submitted to 35 cycles of PCR amplification (denaturation 45 s at 94°C; hybridization 1 min at 62°C for B1-B3 primers and 69°C for B2-B4 primers; elongation 2.5 min at 72°C, plus a final elongation period of 10 min at 72°C). PCR products were analysed on 2% agarose gels stained with ethidium bromide (Fig. 1B), purified by electroelution and cloned into pcDNAII plasmids (Invitrogen). DNA plasmids were used as templates for dideoxy sequencing of both strands with a Sequenase 2.0 kit (USB) by using the oligonucleotides depicted in Fig. 1A. The possibility that variations in nucleotide sequence were generated as PCR artefacts by Taq polymerase errors was ruled out by sequencing three independent amplification products from the two independent cDNA products. Sequencing revealed a 1110 bp open reading frame encoding 369 amino acids (Fig. 2). Comparison of this duckling TR/3 coding sequence with that of the chicken TR/3 0 showed 25 substitutions, 24 of which were synonymous and only one non-synonymous (G ~ T, position 348). Also according to this sequence, the deduced duckling TR/3 protein sequence contains an lie instead of a Met residue in position 116 (Fig. 2). The PCR product of 992 pb was used as a probe to hybridize liver poly(A) + RNA isolated with the Fast Track mRNA isolation kit (Invitrogen). Northern blot analysis revealed that at least two species of TR/3 mRNA were expressed in the liver of muscovy ducklings (Fig. 3), a
Ao ATG
TAG
-82 1
I110
5' L ~ -56 B1 ~B1
iiiii~DNAiiiil
'
~
9
SIS2
'1
672
936 B3 ~,..~
bp ~-.~ S3
B,
13'(A)n
iiii!~liil!i~iHORMONE~.~iiiiiiillit
........
1
1378
!
1155
B2S4 $5133 132 134 I~484 b p ~ B2S4 $5 I~3 $6 B4
2
3
"I(992 bp
" ~ 4 8 4 bp
Fig. 1. A: Strategy for PCR experiments. Arrows labelled B represent the oligonucleotides used for amplification and arrowheads labelled S represent the oligonucleotides used for sequencing. B: Visualisation of the PCR products obtained with B 1/B3 (lane 2) and B 2 / B 4 (lane 3) primers and separated on 2% agarose gel stained with ethidium bromide. Lane 1, a DNA ladder of 123 bp (Gibco BRL).
predominant species of about 1.8 kb mRNA and two fainter species of about 1.9 and 8 kb. In conclusion, for the first time, we have isolated and sequenced a TR/3 cDNA from muscovy ducklings. The nucleotide sequence was closely related to that of the chicken TR/30 published elsewhere [26]. This suggests that the protein is highly conserved, particularly in the DNA- and hormone-binding domains, between these two species of birds and among vertebrates in general. Northern blot analysis revealed one type of TR/3 mRNA which was similar in size to the chicken TR/3 mRNA present in yolk sac and liver (1.9 kb [26] ). In contrast, the 7 kb TRfl mRNA present in some chicken tissues, including kidney, liver, yolk sac, and lung, was undetectable in duckling liver (even after prolonged autoradiographic exposures). Instead, we found at least two other species of 8 and 1.8 kb which appear to be unique to the duckling. The probe obtained in the present study will allow us to investigate TR/3 gene expression in several tissues of young growing ducklings. In particular, we will investigate the possible role of the various receptor subtypes in the differentiation of skeletal muscle into a major site of nonshivering thermogenesis in cold-acclimated ducklings [3,4].
J. Lachuer et a l . / Biochimica et Biophysica Acta 1310 (1996) 127-130
•-57
.-50
•-40
129
.-30
.-20
.-i0
taacaataataacanaaaaaaaacsagaatgattacatatctataactcccagcagt ...............
duck chicken
duck chicken
,10
.1
.20
.30
.40
~
.60
D N ~- - 5 0
.70
chicken
• 100 .If0 ACT TGT GAA GGT TGC AAG GGA TTT t h r c y s g l u g l y c y s lys q l y p h e ...........................
chicken
.290
.300
.310
~
chicken
GAG glu --A
chicken
chicken
duck chicken
duck chicken
duck
chicken
duck chicken
chicken
GCA ACA GAT ala t h r a s p
.330
TTG GTG l e u val
.340
.180
.390
.I|0 GTG v&l
TTG GAT leu a s p
.350
GAC asp
.360
HORMONE
.100
,410
.420
.430
.470
.450
.490
.500
.510
.140
.520
.560
.570
.$B0
.590
.600
TGG trp
• 640 ATe CTT CTG AAA GGC l l e l e u leu lys g l y ....................
.920 .e30 TTT AAC CTG GAT GAC ACC GAG GTT GCC p h e a s h l e u a s p a s p t h r g l u val a l a ................................
.840 •850 .860 •870 .880 CTT CTT CAG GCT GTT CTG CTC ATG TCG TCA GAT CGC CCA GGC CTT GTT leu l e u g l n ala v a l leu leo m e t ser set a s p a r g p r o g l y leu v a l e ........ C ........... A .......................
,1olo
.1o2o
.1o3o
. lo4o
CTT GCA val ala
. zo5o
ATG AAA CTG ACA GAT CTG CGA ATG ATT GGA GCC TGC CAT GCC AGC CGC TTC CTG CAC ATG AAG GTG m e t lys v a l t h r a s p leu a r g m e t ile g l y ala c y s h i s a l a ser a z g p h e leu h i s m e t lys val .......................................................................................... HORMONE . 1100
GAA GAC glu asp
.540
CAG gln
TTT phe
.630 CAG ATC g l n ile
.710 TTA ACG CTA AAT leu thr leu ash
. 720 GGG gly
.770 .780 .790 ,800 , 810 GTG TCT GAT GCC ATT TTT GAC CTG GGC ATG TCT CTT TCT TCA val set a s p ala ile p h e a s p l e u g l y m e t ser leu set ser T .......................................
,910 .920 ,930 .940 .950 .960 GAA AAG TGT CAA GAG GGT TTC CTC CTG GCA TTT GAA CAC TAC ATT AAT TAC AGA AAA CAC CAT g l u lys C y S g l n g l u g l y p h e leu leu ala p h e g l u his t y r ile a s n t y r a r g lys h i s h i s .......................................................................
• 1090
,620
CTG CCA TGT leu pro cys
. 650 .660 .670 .680 .690 .700 T G C T G C A T G G A G A T A A T C T C C C T C C G A C C A G C A G T T C G C T A T C,A C C C C G A G A G T G A G A C T c y s c y s m e t g l u ile m e t s e t leu a r g a l a ala v a l a r g t y r a s p p r o g l u ser g l u thr T .....................................................................
•730 ,740 .750 .960 GAG ATG GCG GTG ACG AGG GGC CAG CTG AAA AAT GGG GGT CTT GGC GTA g l u m e t a l a v a l t h r a r g g l y g l n leu lys a s h g l y g l y l e u g l y val .............. A ...................................
.450
AAG CAA AAA lys g l n lys G ---
.53Q
,610
ACA AAA ATT ATC ACA CCA GCG ATT ACA AGA GTG GTG GAT TTT GCC AAA AAG TTG CCT ATG TTT TGT GAG t h r lys i l e i l e t h r p r o ala ile t h r a r g v a l val a s p p h e a l a lys lys leu p r o m e t p h e c y s g l u ..........................................................................................
• 1ooo
duck
TGT cys
n
AGG AAA TTT CTG :CA GAA GAC ATT GGT CAA GCG CCA ATA GTT AAT GCC CCA GAA GGT GGG AAA GTG GAT TTA GAA GCC TTC ACC a r g lys p h e l e u pro g l u a s p ile g l y q l n a l a p r o i l e v a l a s n a l a p r o g l u g l y g l y lys val a s p leu g l u a l a p h e set .......................... G ..... A ....................... G .................................
.550
duck
.320
.170 GAA GGA AAA g l u g l y lys
CCA ACA CAT GAG GAG TGG GAG CTG ATe AAA ATT GTC ACT GAA GCA CAC GTG GCC ACC AAT GCA CAA GGA AGC CAC p r o t h r a s p g l u g l u t r p g l u l e u ile lys ile val t h r g l u a l a his val ala t h r a s n ala g l n g l y s e t h i s ............... A ................................ T ...................................
.460
duck
D~
A G C A A G C C G T T G (;CA A A G A G G A A G C T G A T A G A A G A A A A T C G A G A G A A G A G A C G T C G G G A A G A G C T G C A G A A A A C A A T T G G G C A C A A A C C G ser lys a r g l e u a l a lys a r g lys leu ile g l u g l u a s n a r g g l u lys a r g a r g a r g g l u g l u l e u q l n lys t h r ile g l y h i s lys p r o ...... A-- C ......................................... G ....................... G --G --T ........ A met ,370
duck
t .......
.80
.120 .130 .140 .150 ,I$0 TTT AGA AGA ACC ATT CAG AAA AAC CTC CAT CCA ACC TAT TCC TGT AAA TAT p h e a r q a r q t h r lle g i n lys a s n leu h i s p r o t h r t y r s e t c y s lys t y r C ...............................................................
ATA GAC AAA GTA ACA AGA AAT CAG TGC CAG GAA TGT CGC TTC AAA AAA TGT ATC TTT G ile a s p iys v a l t h r a r g a s n g i n c y s g i n g l u c y s a r g p h e lys lys cys ile p h e val g l y m e t ...........................................................................................
.250
duck
g ......
A~ TCA GGG TAT ATA CCC AGT TAC TTA GAC AAG GAT GAG CTAITGTGTA GTA TGT GGG GAC AAA GCC ACC GGA TAT CAT TAT CGC TGC ATC M e t s e t g l y t y r ile p r o set t y r leu a s p lys a s p g l u leu c y s val val c y s g l y a s p lys a l a t h r g l y t y r h i s t y r a r g c y s ile ..........................................................................................
D~4duck
g .....
.890 .900 TGT GTC GAG AGG ATA c y s v a l g l u a r g ile C ........ A ---
.970 ,950 .990 CAC TTT TGG CCA AAA CTC CTC his p h e t r p p r o lys leu leu T ..................
,1o6o
GAG TGC g l u cys
. ;070
CCC ACA p r o thr
GAA CTC TTC q l u leu p h e
. ;OaO
CCT pro
~ ! 110
. 1120
. 1130
duck
CCG pro
TTG TTC leu p h e
chicken
--A
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. ! 140
. 1150
CTG GAG GTG TTT GAG GAT TAG aqagactggagcggtcctctgcacccctatcocactactaactat leu g l u val p h e g l u a s p s t o p
Fig. 2. Comparison of the duckling TR/3 cDNA nucleotide sequence and deduced amino acid sequence with the chicken TR/30 sequence [26]. Nucleotide sequence is numbered sequentially from the translation initiating codon. Oligonucleotides used for amplification and sequencing are underlined• This duckling sequence was submitted to the EMBL nucleotide sequence database under accession number Z49151 CMBTHR. Nucleotide and amino acid substitutions deduced by comparison of the TR/3 duckling sequence with the TR/30 chicken sequence are indicated. ' - ' signifies homology.
130
J. Lachuer et al. / Biochimica et Biophysica Acta 1310 (1996) 127-130
References
9.49 kb
kb
7.46 kb 4.40 kb
2.37 kb 1.35 kb
• kb
Fig. 3. Northern blot analysis of TR/3 mRNA in duckling liver. Poly(A) + RNA (10 /xg) isolated from liver of 5-week-old muscovy duckling was separated by electrophoresis on a 1.5% agarose gel containing 1 M formaldehyde and then transferred to a nitrocellulose membrane filter (Amersham). The blot was prehybridized at 42°C in a solution consisting of 5×SSPE (0.75M NaC1, 50 mM NaH2PO 4, 5 mM EDTA, pH 7.4), 0.5% sodium dodecyl sulfate, 50% deionised formamide, 5 × Denhardt's and 0.2 mg/ml salmon sperm DNA for 12 h and then hybridized with radiolabelled DNA probe at 42°C for 24 h. The hybridized filter was washed at room temperature with I×SSC (0,15 M NaCI/0.015 M sodium citrate, pH 7), 0.1% SDS (30 min) and with 0.1 ×SSC, 0.1% SDS at 65°C (30 min). The probe used for hybridization was the 992-bp PCR product. This DNA was labelled with [a-32p]dCTP using a random labelling kit (Boehringer Mannheim). Small horizontal bars indicate RNA size markers (Gibco BRL) and the arrowheads indicate the transcripts of 8 kb and 1.8 and 1.9 kb, respectively.
Acknowledgements T h i s w o r k w a s s u p p o r t e d b y the U n i v e r s i t ~ C l a u d e B e r n a r d L Y O N - l , the Institut N a t i o n a l de la R e c h e r c h e A g r o n o m i q u e ( I N R A ) , the C e n t r e N a t i o n a l de la R e c h e r c h e S c i e n t i f i q u e ( C N R S ) a n d the A s s o c i a t i o n F r a n ~ a i s e c o n t r e les M y o p a t h i e s ( A F M ) . T h e a u t h o r s t h a n k P e t e r W h i t e for his a s s i s t a n c e in c o r r e c t i n g the E n g l i s h m a n u s c r i p t .
[1] Chatterjee, V.K.K. and Tata, J.R. (1992) Cancer Surveys in Growth Regulation by Nuclear Hormone Receptors 14, 147-167. [2] Samuels, H.H., Forman, B.M., Horowitz, Z.D. and Ye, Z.-S. (1988) J. Clin. Invest. 81,957-967. [3] Duchamp, C. and Barr6, H. (1993) Am. J. Physiol. 265, RI076R1083. [4] Duchamp, C., Cohen-Adad, F., Rouanet, J.L. and Barr6, H. (1992) J. Physiol. 457, 27-45. [5] Evans, R.M. (1988) Science 240, 889-895. [6] Green, S. and Chambon, P. (1988) TIG 4, 309-314. [7] Lazar, M. (1993) Endocr. Rev 14, 184-193. [8] Weinberger, C., Thompson, C.C., Ong, E.S., Lebo, R., Gruol, D.J. and Evans, R.M. (1986) Nature 324, 641-646. [9] Laudet, V. Begue, A., Henry-Duthoit, C., Joubel, A., Martin, P., Stehelin, D. and Saule, S. (1991) Nucleic Acids Res. 19, 1005-1112. [10] Pfahl, M. and Benbrook, D, (1987) Nucleic Acids Res. 15, 9613. [11] Nakai, A., Sakurai, A., Bell, G.I., De Groot, L.J. (1988) Mol. Endocrinol. 2, 1087-1092. [12] Nakai, A., Seino, S., Sakurai, A., Szilak, I., Bell, G.I. and De Groot, L.J. (1988) Proc. Natl. Acad. Sci. USA 85, 2781-2785. [13] Thompson, C.C., Weinberger, C., Lebo, R. and Evans, R. (1987) Science 237, 1610-1614. [14] Murray, M.B., Zitz, N.D., McCreary, N.L., McDonald, M.J. and Towle, H.C. (1988). J. Biol. Chem. 263, 12770-12777. [15] Koenig, R., Warne, R.L., Brent, G.A., Harney, J.W., Larsen, P.R. and Moore, D.D. (1988) Proc. Natl. Acad. Sci. USA 85, 5031-5035. [16] Mitsuhashi, T., Tennyson, G. and Nikodem, V. (1988) Nucleic Acids Res. 16, 5697. [17] Mitsuhashi, T., Tennyson, G. and Nikodem, V. (1988) Proc. Natl. Acad. Sci. USA 85, 5804-5808. [18] Hodin, R.A., Lazar, M.A., Wintman, B.I., Darling, D.S., Koenig, R.J., Larsen, P.R., Moore, D.D. and Chin, W.W. (1989) Science 244, 76-79. [19] Prost, E., Koenig, R.J., Moore, D.D., Larsen, P.R. and Whalen, R.G. (1988) Nucleic Acids Res. 16, 6248. [20] Masuda, M., Yasuhara, S., Yamashita, M., Shibuya, M and Odaka, T. (1990) Nucleic Acids Res. 18, 3055. [21] Wood, W.M., Ocran, K.W., Gordon, D.F. and Ridgway, E.C. (1991) Mol. Endocrinol. 5, 1049-1061. [22] Moeller, M., Rapoport, B. and Gavin, L.A. (1989) J. Neuroendocrinol. 1,351-356. [23] Brooks, A.R., Sweeney, G. and Old, R.W. (1989) Nucleic Acids Res. 17, 9395-9405. [24] Yaiota, Y., Shi, Y.B. and Brown, D.D. (1990) Proc. Natl. Acad. Sci. USA 87, 7090-7094. [25] Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H. and VennstrSm, B. (1986) Nature 324, 635-640. [26] Forrest, D., Sjtiberg, M. and Vennstr~m, B. (1990) EMBO J. 9, 1519-1528. [27] Showers, M., Darling, D., Kieffer, G. and Chin, W.W. (1991) DNA and Cell Biol. 10, 211-221. [28] Sji3berg, M., Vennstr~Sm, B. and Forrest, D. (1992) Development 114, 39-47.
ELSEVIER
Biochimica et Biophysica Acta 1310 (1996) 127-130
Biochi f ic~a A~ta etBiophysica
Molecular cloning and sequencing of a cDNA encoding a/3-thyroid hormone receptor in muscovy duckling 1 JoE1 Lachuer a , * Catherine Legras b, Corinne Ronfort b Stdphane Barges a, Frdddrique Cohen-Adad a, Laurence Quivet a, Claude Duchamp a, Gdrard Verdier b, Hervd Barr6 a
a Laboratoire de Physiologie Compar£e de la Thermor~gulation, URA 1341 CNRS-LA 1NRA Universit£ Claude Bernard Lyon-L 43 bd. du 11 novembre 1918, B~t 404, 69622 Villeurbanne cedex, France b Laboratoire de Biologie Molgculaire et Transfert de Gbnes, UMR CNRS 106-LA 1NRA 810, Universitg Claude Bernard LYON-I, 43 bd. du 11 norembre 1918, Bgtt 741, 69622 Villeurbanne cedex, France
Received 26 June 1995; revised 15 September 1995; accepted 22 September 1995
Abstract
A cDNA clone encoding a /3-thyroid hormone receptor (TR/3 ) from muscovy duckling liver was isolated and sequenced. Comparison with the chicken TR/3 sequence showed a high degree of homology. This cDNA was used as a probe to characterize the TR/3 mRNA transcripts expressed in muscovy duckling liver. Keywords: /3-thyroid hormone receptor; TR/3; cDNA sequence; (chicken); (duck)
Thyroid hormones (TH) play a central role in the development, differentiation and metabolism of most tissues in all vertebrates (for review see Refs. [1,2]). In young birds, these hormones are especially important in the development of thermoregulatory capacity. Long-term coldexposed ducklings develop an increased capacity for muscle thermogenesis [3], and TH could well be involved in the morphological and functional changes observed in skeletal muscle of cold-acclimated ducklings [4]. Most TH effects are mediated by nuclear receptors which are members of a superfamily of ligand-dependant transcriptional factors [5,611. Thyroid receptors (TR) regulate gene expression by binding to specific TRE (thyroidresponsive elements) located upstream from target genes [7]. cDNAs encoding TR have been isolated from several
Abbreviations: TR a and TR/3, or- and /3-thyroid hormone receptors. * Corresponding author. Fax: -- 33 72 431172. i The complete nucleotide sequence reported in this paper is available from EMBL/GenBank Data Libraries under the accession number Z49151CMBTHR 0167-4889/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved SSDIO167-4889(95)OOI62-X
species of mammals, including human [8-12], rat [13-18] and mouse [19-22], as well as lower vertebrates, such as the Xenopus [23,24]. In birds, cDNAs encoding TR have only been isolated in the chicken [25-28]. Characterization of these cDNAs has revealed at least two distinct TR ( a and /3) which are similar in their overall structure: they are composed of five domains, including a cys-rich DNA binding domain and a C-terminal hormone binding domain. TR diversity is further increased by the generation of additional isoforms from the a and /3 genes. For instance, it was shown in the chicken that alternative splicing can produce two /3 variants (TR/30 and TR/32) differing in the length of their N-terminal region [28]. TR/3 0 is widely expressed while TR/32 appears to be specifically expressed in chick retina during development [28]. No chick TR/3 related to the mammalian TR/31 [8,14] has been identified. The numbers of TRs expressed, as well as the subtypes, is likely to influence the tissue response to the hormone [7]. Our understanding of the molecular mechanisms which modulate thermogenic capacity would be greatly enhanced by characterization of TR subtype expression. As a first
128
Z Lachuer et al. / Biochimica et Biophysica Acta 1310 (1996) 1 2 7 - 1 3 0
step, we have isolated and sequenced a cDNA encoding a duckling TR/3 similar to the chicken TR/30. We have also characterized the TR 13 mRNAs expressed in the liver. Livers from 5-week-old muscovy ducklings (Cairina moschata, R31 pedigree, INRA) were sampled after decapitation of the birds. Samples were immediately frozen in liquid nitrogen and stored at -80°C. Total RNA was isolated from 1-g portions of frozen tissue by the guanidinium thiocyanate method. First strand cDNA was derived from 10 /xg total RNA using an oligo(dT) primer and purified using a centricon-30 concentrator (Amicon). Using two pairs of oligonucleotide primers taken from the published chicken TR/30 sequence of Forrest et al. [26], polymerase chain reaction (PCR) was carried out with duckling liver cDNA to generate two DNA fragments, including most of the TR/3 coding sequence. For the first DNA fragment, the 5' primer [5'-GGCAGTGGTGACAGAAGAAG-3'] and the 3' primer [5'-TTCAAATGCCAGGAGGAAAC-3'] were the complement of nucleotides - 5 6 / - 3 7 and 917/936 in the published sequence (positions B1 sense and B3 antisense of Fig. 1A). For the second DNA fragment, the 5' primer [5'AGCAGCAGTTCGCTATGACC-3'] and the 3' primer [5'-ACAGCCAGTAGTGCGACAGG-3'] were complementary to nucleotides 672/691 and 1136/1155 in the published sequence (positions B2 sense and B4 antisense of Fig. 1A). The PCR products were 992-bp and 484-bp long respectively. In each case, two independent cDNA products ( 1 / 1 0 of the reaction) were submitted to 35 cycles of PCR amplification (denaturation 45 s at 94°C; hybridization 1 min at 62°C for B1-B3 primers and 69°C for B2-B4 primers; elongation 2.5 min at 72°C, plus a final elongation period of 10 min at 72°C). PCR products were analysed on 2% agarose gels stained with ethidium bromide (Fig. 1B), purified by electroelution and cloned into pcDNAII plasmids (Invitrogen). DNA plasmids were used as templates for dideoxy sequencing of both strands with a Sequenase 2.0 kit (USB) by using the oligonucleotides depicted in Fig. 1A. The possibility that variations in nucleotide sequence were generated as PCR artefacts by Taq polymerase errors was ruled out by sequencing three independent amplification products from the two independent cDNA products. Sequencing revealed a 1110 bp open reading frame encoding 369 amino acids (Fig. 2). Comparison of this duckling TR/3 coding sequence with that of the chicken TR/3 0 showed 25 substitutions, 24 of which were synonymous and only one non-synonymous (G ~ T, position 348). Also according to this sequence, the deduced duckling TR/3 protein sequence contains an lie instead of a Met residue in position 116 (Fig. 2). The PCR product of 992 pb was used as a probe to hybridize liver poly(A) + RNA isolated with the Fast Track mRNA isolation kit (Invitrogen). Northern blot analysis revealed that at least two species of TR/3 mRNA were expressed in the liver of muscovy ducklings (Fig. 3), a
Ao ATG
TAG
-82 1
I110
5' L ~ -56 B1 ~B1
iiiii~DNAiiiil
'
~
9
SIS2
'1
672
936 B3 ~,..~
bp ~-.~ S3
B,
13'(A)n
iiii!~liil!i~iHORMONE~.~iiiiiiillit
........
1
1378
!
1155
B2S4 $5133 132 134 I~484 b p ~ B2S4 $5 I~3 $6 B4
2
3
"I(992 bp
" ~ 4 8 4 bp
Fig. 1. A: Strategy for PCR experiments. Arrows labelled B represent the oligonucleotides used for amplification and arrowheads labelled S represent the oligonucleotides used for sequencing. B: Visualisation of the PCR products obtained with B 1/B3 (lane 2) and B 2 / B 4 (lane 3) primers and separated on 2% agarose gel stained with ethidium bromide. Lane 1, a DNA ladder of 123 bp (Gibco BRL).
predominant species of about 1.8 kb mRNA and two fainter species of about 1.9 and 8 kb. In conclusion, for the first time, we have isolated and sequenced a TR/3 cDNA from muscovy ducklings. The nucleotide sequence was closely related to that of the chicken TR/30 published elsewhere [26]. This suggests that the protein is highly conserved, particularly in the DNA- and hormone-binding domains, between these two species of birds and among vertebrates in general. Northern blot analysis revealed one type of TR/3 mRNA which was similar in size to the chicken TR/3 mRNA present in yolk sac and liver (1.9 kb [26] ). In contrast, the 7 kb TRfl mRNA present in some chicken tissues, including kidney, liver, yolk sac, and lung, was undetectable in duckling liver (even after prolonged autoradiographic exposures). Instead, we found at least two other species of 8 and 1.8 kb which appear to be unique to the duckling. The probe obtained in the present study will allow us to investigate TR/3 gene expression in several tissues of young growing ducklings. In particular, we will investigate the possible role of the various receptor subtypes in the differentiation of skeletal muscle into a major site of nonshivering thermogenesis in cold-acclimated ducklings [3,4].
J. Lachuer et a l . / Biochimica et Biophysica Acta 1310 (1996) 127-130
•-57
.-50
•-40
129
.-30
.-20
.-i0
taacaataataacanaaaaaaaacsagaatgattacatatctataactcccagcagt ...............
duck chicken
duck chicken
,10
.1
.20
.30
.40
~
.60
D N ~- - 5 0
.70
chicken
• 100 .If0 ACT TGT GAA GGT TGC AAG GGA TTT t h r c y s g l u g l y c y s lys q l y p h e ...........................
chicken
.290
.300
.310
~
chicken
GAG glu --A
chicken
chicken
duck chicken
duck chicken
duck
chicken
duck chicken
chicken
GCA ACA GAT ala t h r a s p
.330
TTG GTG l e u val
.340
.180
.390
.I|0 GTG v&l
TTG GAT leu a s p
.350
GAC asp
.360
HORMONE
.100
,410
.420
.430
.470
.450
.490
.500
.510
.140
.520
.560
.570
.$B0
.590
.600
TGG trp
• 640 ATe CTT CTG AAA GGC l l e l e u leu lys g l y ....................
.920 .e30 TTT AAC CTG GAT GAC ACC GAG GTT GCC p h e a s h l e u a s p a s p t h r g l u val a l a ................................
.840 •850 .860 •870 .880 CTT CTT CAG GCT GTT CTG CTC ATG TCG TCA GAT CGC CCA GGC CTT GTT leu l e u g l n ala v a l leu leo m e t ser set a s p a r g p r o g l y leu v a l e ........ C ........... A .......................
,1olo
.1o2o
.1o3o
. lo4o
CTT GCA val ala
. zo5o
ATG AAA CTG ACA GAT CTG CGA ATG ATT GGA GCC TGC CAT GCC AGC CGC TTC CTG CAC ATG AAG GTG m e t lys v a l t h r a s p leu a r g m e t ile g l y ala c y s h i s a l a ser a z g p h e leu h i s m e t lys val .......................................................................................... HORMONE . 1100
GAA GAC glu asp
.540
CAG gln
TTT phe
.630 CAG ATC g l n ile
.710 TTA ACG CTA AAT leu thr leu ash
. 720 GGG gly
.770 .780 .790 ,800 , 810 GTG TCT GAT GCC ATT TTT GAC CTG GGC ATG TCT CTT TCT TCA val set a s p ala ile p h e a s p l e u g l y m e t ser leu set ser T .......................................
,910 .920 ,930 .940 .950 .960 GAA AAG TGT CAA GAG GGT TTC CTC CTG GCA TTT GAA CAC TAC ATT AAT TAC AGA AAA CAC CAT g l u lys C y S g l n g l u g l y p h e leu leu ala p h e g l u his t y r ile a s n t y r a r g lys h i s h i s .......................................................................
• 1090
,620
CTG CCA TGT leu pro cys
. 650 .660 .670 .680 .690 .700 T G C T G C A T G G A G A T A A T C T C C C T C C G A C C A G C A G T T C G C T A T C,A C C C C G A G A G T G A G A C T c y s c y s m e t g l u ile m e t s e t leu a r g a l a ala v a l a r g t y r a s p p r o g l u ser g l u thr T .....................................................................
•730 ,740 .750 .960 GAG ATG GCG GTG ACG AGG GGC CAG CTG AAA AAT GGG GGT CTT GGC GTA g l u m e t a l a v a l t h r a r g g l y g l n leu lys a s h g l y g l y l e u g l y val .............. A ...................................
.450
AAG CAA AAA lys g l n lys G ---
.53Q
,610
ACA AAA ATT ATC ACA CCA GCG ATT ACA AGA GTG GTG GAT TTT GCC AAA AAG TTG CCT ATG TTT TGT GAG t h r lys i l e i l e t h r p r o ala ile t h r a r g v a l val a s p p h e a l a lys lys leu p r o m e t p h e c y s g l u ..........................................................................................
• 1ooo
duck
TGT cys
n
AGG AAA TTT CTG :CA GAA GAC ATT GGT CAA GCG CCA ATA GTT AAT GCC CCA GAA GGT GGG AAA GTG GAT TTA GAA GCC TTC ACC a r g lys p h e l e u pro g l u a s p ile g l y q l n a l a p r o i l e v a l a s n a l a p r o g l u g l y g l y lys val a s p leu g l u a l a p h e set .......................... G ..... A ....................... G .................................
.550
duck
.320
.170 GAA GGA AAA g l u g l y lys
CCA ACA CAT GAG GAG TGG GAG CTG ATe AAA ATT GTC ACT GAA GCA CAC GTG GCC ACC AAT GCA CAA GGA AGC CAC p r o t h r a s p g l u g l u t r p g l u l e u ile lys ile val t h r g l u a l a his val ala t h r a s n ala g l n g l y s e t h i s ............... A ................................ T ...................................
.460
duck
D~
A G C A A G C C G T T G (;CA A A G A G G A A G C T G A T A G A A G A A A A T C G A G A G A A G A G A C G T C G G G A A G A G C T G C A G A A A A C A A T T G G G C A C A A A C C G ser lys a r g l e u a l a lys a r g lys leu ile g l u g l u a s n a r g g l u lys a r g a r g a r g g l u g l u l e u q l n lys t h r ile g l y h i s lys p r o ...... A-- C ......................................... G ....................... G --G --T ........ A met ,370
duck
t .......
.80
.120 .130 .140 .150 ,I$0 TTT AGA AGA ACC ATT CAG AAA AAC CTC CAT CCA ACC TAT TCC TGT AAA TAT p h e a r q a r q t h r lle g i n lys a s n leu h i s p r o t h r t y r s e t c y s lys t y r C ...............................................................
ATA GAC AAA GTA ACA AGA AAT CAG TGC CAG GAA TGT CGC TTC AAA AAA TGT ATC TTT G ile a s p iys v a l t h r a r g a s n g i n c y s g i n g l u c y s a r g p h e lys lys cys ile p h e val g l y m e t ...........................................................................................
.250
duck
g ......
A~ TCA GGG TAT ATA CCC AGT TAC TTA GAC AAG GAT GAG CTAITGTGTA GTA TGT GGG GAC AAA GCC ACC GGA TAT CAT TAT CGC TGC ATC M e t s e t g l y t y r ile p r o set t y r leu a s p lys a s p g l u leu c y s val val c y s g l y a s p lys a l a t h r g l y t y r h i s t y r a r g c y s ile ..........................................................................................
D~4duck
g .....
.890 .900 TGT GTC GAG AGG ATA c y s v a l g l u a r g ile C ........ A ---
.970 ,950 .990 CAC TTT TGG CCA AAA CTC CTC his p h e t r p p r o lys leu leu T ..................
,1o6o
GAG TGC g l u cys
. ;070
CCC ACA p r o thr
GAA CTC TTC q l u leu p h e
. ;OaO
CCT pro
~ ! 110
. 1120
. 1130
duck
CCG pro
TTG TTC leu p h e
chicken
--A
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. ! 140
. 1150
CTG GAG GTG TTT GAG GAT TAG aqagactggagcggtcctctgcacccctatcocactactaactat leu g l u val p h e g l u a s p s t o p
Fig. 2. Comparison of the duckling TR/3 cDNA nucleotide sequence and deduced amino acid sequence with the chicken TR/30 sequence [26]. Nucleotide sequence is numbered sequentially from the translation initiating codon. Oligonucleotides used for amplification and sequencing are underlined• This duckling sequence was submitted to the EMBL nucleotide sequence database under accession number Z49151 CMBTHR. Nucleotide and amino acid substitutions deduced by comparison of the TR/3 duckling sequence with the TR/30 chicken sequence are indicated. ' - ' signifies homology.
130
J. Lachuer et al. / Biochimica et Biophysica Acta 1310 (1996) 127-130
References
9.49 kb
kb
7.46 kb 4.40 kb
2.37 kb 1.35 kb
• kb
Fig. 3. Northern blot analysis of TR/3 mRNA in duckling liver. Poly(A) + RNA (10 /xg) isolated from liver of 5-week-old muscovy duckling was separated by electrophoresis on a 1.5% agarose gel containing 1 M formaldehyde and then transferred to a nitrocellulose membrane filter (Amersham). The blot was prehybridized at 42°C in a solution consisting of 5×SSPE (0.75M NaC1, 50 mM NaH2PO 4, 5 mM EDTA, pH 7.4), 0.5% sodium dodecyl sulfate, 50% deionised formamide, 5 × Denhardt's and 0.2 mg/ml salmon sperm DNA for 12 h and then hybridized with radiolabelled DNA probe at 42°C for 24 h. The hybridized filter was washed at room temperature with I×SSC (0,15 M NaCI/0.015 M sodium citrate, pH 7), 0.1% SDS (30 min) and with 0.1 ×SSC, 0.1% SDS at 65°C (30 min). The probe used for hybridization was the 992-bp PCR product. This DNA was labelled with [a-32p]dCTP using a random labelling kit (Boehringer Mannheim). Small horizontal bars indicate RNA size markers (Gibco BRL) and the arrowheads indicate the transcripts of 8 kb and 1.8 and 1.9 kb, respectively.
Acknowledgements T h i s w o r k w a s s u p p o r t e d b y the U n i v e r s i t ~ C l a u d e B e r n a r d L Y O N - l , the Institut N a t i o n a l de la R e c h e r c h e A g r o n o m i q u e ( I N R A ) , the C e n t r e N a t i o n a l de la R e c h e r c h e S c i e n t i f i q u e ( C N R S ) a n d the A s s o c i a t i o n F r a n ~ a i s e c o n t r e les M y o p a t h i e s ( A F M ) . T h e a u t h o r s t h a n k P e t e r W h i t e for his a s s i s t a n c e in c o r r e c t i n g the E n g l i s h m a n u s c r i p t .
[1] Chatterjee, V.K.K. and Tata, J.R. (1992) Cancer Surveys in Growth Regulation by Nuclear Hormone Receptors 14, 147-167. [2] Samuels, H.H., Forman, B.M., Horowitz, Z.D. and Ye, Z.-S. (1988) J. Clin. Invest. 81,957-967. [3] Duchamp, C. and Barr6, H. (1993) Am. J. Physiol. 265, RI076R1083. [4] Duchamp, C., Cohen-Adad, F., Rouanet, J.L. and Barr6, H. (1992) J. Physiol. 457, 27-45. [5] Evans, R.M. (1988) Science 240, 889-895. [6] Green, S. and Chambon, P. (1988) TIG 4, 309-314. [7] Lazar, M. (1993) Endocr. Rev 14, 184-193. [8] Weinberger, C., Thompson, C.C., Ong, E.S., Lebo, R., Gruol, D.J. and Evans, R.M. (1986) Nature 324, 641-646. [9] Laudet, V. Begue, A., Henry-Duthoit, C., Joubel, A., Martin, P., Stehelin, D. and Saule, S. (1991) Nucleic Acids Res. 19, 1005-1112. [10] Pfahl, M. and Benbrook, D, (1987) Nucleic Acids Res. 15, 9613. [11] Nakai, A., Sakurai, A., Bell, G.I., De Groot, L.J. (1988) Mol. Endocrinol. 2, 1087-1092. [12] Nakai, A., Seino, S., Sakurai, A., Szilak, I., Bell, G.I. and De Groot, L.J. (1988) Proc. Natl. Acad. Sci. USA 85, 2781-2785. [13] Thompson, C.C., Weinberger, C., Lebo, R. and Evans, R. (1987) Science 237, 1610-1614. [14] Murray, M.B., Zitz, N.D., McCreary, N.L., McDonald, M.J. and Towle, H.C. (1988). J. Biol. Chem. 263, 12770-12777. [15] Koenig, R., Warne, R.L., Brent, G.A., Harney, J.W., Larsen, P.R. and Moore, D.D. (1988) Proc. Natl. Acad. Sci. USA 85, 5031-5035. [16] Mitsuhashi, T., Tennyson, G. and Nikodem, V. (1988) Nucleic Acids Res. 16, 5697. [17] Mitsuhashi, T., Tennyson, G. and Nikodem, V. (1988) Proc. Natl. Acad. Sci. USA 85, 5804-5808. [18] Hodin, R.A., Lazar, M.A., Wintman, B.I., Darling, D.S., Koenig, R.J., Larsen, P.R., Moore, D.D. and Chin, W.W. (1989) Science 244, 76-79. [19] Prost, E., Koenig, R.J., Moore, D.D., Larsen, P.R. and Whalen, R.G. (1988) Nucleic Acids Res. 16, 6248. [20] Masuda, M., Yasuhara, S., Yamashita, M., Shibuya, M and Odaka, T. (1990) Nucleic Acids Res. 18, 3055. [21] Wood, W.M., Ocran, K.W., Gordon, D.F. and Ridgway, E.C. (1991) Mol. Endocrinol. 5, 1049-1061. [22] Moeller, M., Rapoport, B. and Gavin, L.A. (1989) J. Neuroendocrinol. 1,351-356. [23] Brooks, A.R., Sweeney, G. and Old, R.W. (1989) Nucleic Acids Res. 17, 9395-9405. [24] Yaiota, Y., Shi, Y.B. and Brown, D.D. (1990) Proc. Natl. Acad. Sci. USA 87, 7090-7094. [25] Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H. and VennstrSm, B. (1986) Nature 324, 635-640. [26] Forrest, D., Sjtiberg, M. and Vennstr~m, B. (1990) EMBO J. 9, 1519-1528. [27] Showers, M., Darling, D., Kieffer, G. and Chin, W.W. (1991) DNA and Cell Biol. 10, 211-221. [28] Sji3berg, M., Vennstr~Sm, B. and Forrest, D. (1992) Development 114, 39-47.