- Email: [email protected]
Molecular cloning, characterization and expression analysis of cathepsin O in silkworm Bombyx mori related to bacterial response
Molecular Immunology 66 (2015) 409–417
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Molecular cloning, characterization and expression analysis of cathepsin O in silkworm Bombyx mori related to bacterial response Kui Zhang 1 , Jingjing Su 1 , Siyuan Chen, Shuang Yu, Juan Tan, Man Xu, Hanghua Liang, Yuzu Zhao, Huijuan Chao, Liqun Yang, Hongjuan Cui ∗ State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China
a r t i c l e
i n f o
Article history: Received 4 March 2015 Received in revised form 13 April 2015 Accepted 13 April 2015 Available online 18 May 2015 Keywords: Silkworm Molecular cloning Cathepsin O 20-Ecdysone Infection
a b s t r a c t Cathepsins are the main members of the cysteine family and play important roles in immune response in vertebrates. The Cathepsin O of Bombyx mori (BmCathepsin O) was cloned from the hemocytes by the rapid amplification of cDNA ends (RACE). The genomic DNA was 6131 bp long with a total of six exons and five introns. Its pre-mRNA was spliced to generate two spliceosomes. By comparisons with other reported cathepsins O, it was concluded that the identity between them ranged from 29 to 39%. Expression analysis indicated that BmCathepsin O was specific-expressed in hemocytes, and highly expressed at the 4th molting and metamorphosis stages. Immunofluorescence assay and qRT-PCR showed that BmCathepsin O was expressed in granulocytes and plasmatocytes. Interestingly, BmCathepsin O was significantly upregulated after stimulated by 20-hydroxyecdysone (20-E) in vivo, which suggested that BmCathepsin O may be regulated by 20E. Moreover, activation of BmCathepsin O was also observed in hemocytes challenged by Escherichia coli, indicating its potential involvement in the innate immune system of silkworm, B. mori. In summary, our studies provide a new insight into the functional features of Cathepsin O. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Cathepsins are a group of protease predominantly located in lysosomes (Turk and Stoka, 2007; Brix et al., 2008). Since the first cathepsin member was identified in 1940s (Barnes, 1940), more than 20 cathepsins have been discovered in living organisms. Most of the cathepsin members belong to cysteine protease, while a few of which are aspartic proteinase (cathepsin D, E) and serine protease (cathepsin A, G). In general, cathepsins can be divided into two major groups on the basis of their expression features. One group is consists of ubiquitously expressed members, including cathepsin B, C, F, H, L, O, and Z, whereas the other group is composed of cathepsin J, K, S, W, and X, which have been shown to be cell/tissue-specific (Rawlings and Barrett, 1994; Haeckel et al., 1999; Wex et al., 2001; Krueger et al., 2005). In mammals, there are at least eleven cathepsin members, which are closely related to many physiological and pathological processes including intra-
∗ Corresponding author at: State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, #2, Tiansheng Rd, Beibei District, Chongqing 400716, China. Tel.: +86 23 68251712; fax: +86 23 68251128. E-mail addresses: [email protected], [email protected] (H. Cui). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.molimm.2015.04.008 0161-5890/© 2015 Elsevier Ltd. All rights reserved.
cellular protein degradation/turn over (Bond and Butler, 1987), apoptosis (Turk and Stoka, 2007; Turk et al., 2000), osteolysis (Rousselle and Heymann, 2002; Berdowska, 2004), hormone maturation (Yasothornsrikul et al., 2003), antigen processing (Riese and Chapman, 2000; Lecaille et al., 2002), immune responses (Riese and Chapman, 2000; Lecaille et al., 2002; Hsing and Rudensky, 2005; Dixit et al., 2008), and tumorigenesis (Kos and Lah, 1998). In 1994, Gloria Velasco cloned a novel cysteine protease out of human breast cancer cDNA library, and named it cathepsin O (CTSO)(Velasco et al., 1994). CTSO, whose proteolytic activity can be inhibited by proteolytic enzyme inhibitor E-64, is able to degrade the synthetic peptides Z-Phe-Arg-AMC and Z-Arg-Arg-AMC, which are widely used as substrates for cysteine proteinase (Velasco et al., 1994). CTSO is located on chromosome 4q31–q32 (Santamarı´ıa et al., 1998) and has the endoprotease activity against fibrinogen at acid PH, which suggests that it may play an essential role in extracellular matrix degradation (Shi et al., 1995). However, studies upon cathepsin O are still in early days and remain to be elucidated. In recent years, cathepsin gene has also been reported in invertebrate, such as Schistosoma japonicum (Day et al., 1995), Meretrix meretrix (Wang et al., 2008a), Cristaria plicata (Li et al., 2010a), Eriocheir sinensis (Li et al., 2010b, 2011), Oplegnathus fasciatus (Whang et al., 2011), and Fenneropenaeus chinensis (Wang et al., 2012). In addition, various cathepsins are found in insects, among which B, D, and L are the most common ones. They are mainly distributed in
410
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
early embryos, oocytes, larval fat body and alimentary canal, and closely related to insect development (Ortego et al., 1998; Wang et al., 2008b), especially in germ cell development (Matsumoto et al., 1997; Uchida et al., 2001; Gui et al., 2006; Lee et al., 2009), embryogenesis (Fagotto and Maxfield, 1994), fat body (Takahashi et al., 1993; Rabossi et al., 2004; Zhang et al., 2013; Yang et al., 2006) and silk gland (Shiba et al., 2001) degradation and programmed cell death (PCD) during metamorphosis. Cathepsin synthesis in hemocytes plays a significant role in life processes of insects. Bombyx mori cathepsin B is mainly expressed in hemocytes from the day of wandering and the expression level reach the top at day 1 of pupa stage, which suggested that it may be involved in pupa formation (Xu and Kawasaki, 2001). Analogously in Sarcophaga peregrine, cathepsin B is highly expressed in hemocytes during metamorphosis, and participates in dissociation of the fat body in S. peregrina (Kurata et al., 1992). Moreover, the cathepsin L, which is also synthesized in hemocytes and integrated into the basement membranes, partakes in wing disc differentiation at the very end of embryonic development (Homma and Natori, 1996). Helicoverpa armigera cathepsin L is specifically expressed in hemocytes, and it is involved in larval molting and metamorphosis by participating in the functioning of hemocytes (Wang et al., 2010). The silkworm, B. mori is the most important commercial insects to the silk industry, moreover, it could be used as an excellent fundamental research model (Xia et al., 2004, 2009, 2014). Several homologs and cDNA sequences of cathepsin B and D have been identified from silkworm genome, studies showed that cathepsin B was not only critical for normal development of silkworm, especially in fat body and posterior silk gland (Wang et al., 2008b), but also involved in the programmed cell death of the fat body during silkworm metamorphosis (Lee et al., 2009). Cathepsin D expression could be induced by 20-hydroxyecdysone (20E) (Yu et al., 2012), high temperature and H2 O2 (Kim et al., 2011), which suggested that cathepsin D also contributed to silkworm metamorphosis (Lee et al., 2009). In this study, a full-length cDNA of cathepsin O from B. mori was first cloned and characterized, and its temporal and spatial expression profiles were evaluated. The response to the treatment of 20-ecdysone (20-E) and Escherichia coli were also analyzed with qRT-PCR. 2. Materials and methods 2.1. Biological materials The Dazao (P50) strain of B. mori used in our study is maintained in our laboratory. The silkworms were fed with fresh mulberry leaves under standard conditions (Tan et al., 2013; Zhang et al., 2014a,b). Different tissues were extracted in 1× DEPC-treated PBS and then they were flash-frozen and stored at −80 ◦ C until to use. Plasmatocytes and granulocytes are isolated according to the previous report (Nakahara et al., 2009). 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from the epidermis, head, silk gland, midgut, fat body, Malpighian tubules, testis, ovary, hemocytes, and wing disk with TRIzol reagent (Takara, Japan) referring to the protocol provided by the manufacturer. After being treated with RNase-free DNase I (Takara, Japan), First-strand cDNA was synthesized with M-MLV reverse transcriptase (Promega, USA). cDNA product was stored at −20 ◦ C. 2.3. Gene cloning and rapid amplification of cDNA ends (RACE) cDNA of BmCathepsin O was amplified by PCR using Primers CatO-F and CatO-R (Table 1). The PCR conditions included 2–4 min
Table 1 Primers used in this study. F, forward; R, reverse; GSP, gene specific primer; NGSP, nested primers. Name
Sequence (5 –3 )
Usage
BmCatO-F BmCatO-R GSP1 NGSP1 GSP2 NGSP2 BmCatO-qRT-F BmCatO-qRT-R BmGAPDH-qRT-F BmGAPDH-qRT-R BmCatO-RT-F
GCTTTACATAGCCCCCGA AATTTGTAGTGCCCCTGTCTT CCAGGGCTGAGCGTTCACCTTGAC CCGATCATTCCCTCTTCTCGCCAAT CGTCGAGGAGGCTCTGAATGAAAT AGCCCACCATGGACCCGTCATAGT CGGGAGCCGTTTATGGTCT CATTCCCTCTTCTCGCCAAT CATTCCGCGTCCCTGTTGCTAAT GCTGCCTCCTTGACCTTTTGC TGGCGAGAAGAGGGAATG
PCR
BmCatO-RT-R BmA3-F BmA3-R BmCatO-PE-F
AAGCATGCATTCAATTCCTC AACACCCCGTCCTGCTCACTG GGGCGAGACGTGTGATTTCCT AACAAGAGTTACACCGAAGC
BmCatO-PE-R
TTTATTACAGCCCTCACAGAC
5 RACE 3 RACE qRT-PCR
Semi-quantitative PCR
Prokaryotic expression
initial denaturation at 94 ◦ C, followed by 32 cycles of the following: 30 s denaturation at 94 ◦ C, 30 s annealing at 55 ◦ C, 1 min of extension at 72 ◦ C and a final 10 min extension at 72 ◦ C. Full-length cDNA sequence of BmCathpsin O was acquired using SMARTTM RACE cDNA Amplification Kit (Clontech, USA). The primers for 5 RACE and 3 RACE were designed on the basis of the PCR result above and listed in Table 1. All PCR products were purified with AxyPrepTM DNA Gel Extraction kit (Axygen, China) and cloned into PMD19-T Simple Vector (Takara, Japan) and sequenced at BGI company (China). 2.4. Bioinformatic and phylogeny analysis The ORFs were determined with the ORF Finder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The signal peptide was predicted by SignalP 4.0 (http://www.cbs.dtu.dk/services/ SignalP/). The domain was predicted by SMART (http://smart.emblheidelberg.de/). The deduced amino acid sequences of putative BmCathpsin O were aligned using the Clustal X program (Larkin et al., 2007), and a phylogenetic tree was constructed by the neighbor-joining method using MEGA 6 software (Tamura et al., 2007, 2013). The sequences applied in this study were downloaded from GeneBank (http://www.ncbi.nlm.nih.gov/) and listed in supplementary data Table S1. 2.5. Antibody preparation BmCathepsin O protein sequence from 56aa to 205aa was used for antibody preparation. The PET28a-Cathepsin O recombinant plasmid was transformed into competent E. coli rosseta (DE3) cells. The recombinant protein was induced by 1 mM IPTG for 4 h at 37 ◦ C, and subsequently purified with Ni-NTA His Bind Resin (Novagen, USA). Antibodies were obtained by injecting purified protein emulsified with Freund’s complete adjuvant into a New Zealand rabbit according to standard procedures (Harlow and Lane, 1988). The antiserum was collected after four injections, and purified by protein A/G. 2.6. Immunofluorescence assay Hemocytes were collected and treated as described previously (Tan et al., 2013; Zhang et al., 2014a,b). Briefly, collected hemocytes were cultured on coverslips for 15–30 min at room temperature, and subsequently fixed in 4% PFA for 15 min. After being incubated for 10 min with PBS containing 0.1–0.25% Triton X-100 (Sigma),
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
the cells were blocked with 10% goat serum in PBS for 1–1.5 h at 37 ◦ C. Samples were stained with anti-BmCathepsin O antibody (1:1000). Followed by staining with Alexa Fluor® 488 goat antirabbit IgG (H + L) (1:1000, Invitrogen). Nuclei were stained with DAPI and examined by fluorescence microscopy (Nikon 80i). 2.7. Injection of 20E and hemocyte isolation 1.5 g 20E (Sigma, USA) was injected into each larva on the second day of the 5th instar larvae as described in our previous study (Zhang et al., 2014a,b). Ten silkworms were randomly selected 6, 12, 18, 24, and 48 h post-injection from experimental and control groups for hemolymph collection with a dissecting scissors to cut a leg. 400 mL 1× DEPC-treated PBS was then added to each hemolymph sample, and the sample were centrifuged at 3000 × g at 4 ◦ C to isolate hemocytes. Hemocytes were flash-frozen and stored at −80 ◦ C until to use. 2.8. Immune challenge To evaluate the immune response of BmCathepsin O, Pathogenic bacteria E. coli was applied to immune challenge experiment. The E. coli was cultured in LB at 37 ◦ C overnight. Then the bacterial culture was centrifuged at 1000 × g at 4 ◦ C for 10 min. The bacterial pellets were re-suspended in 1× PBS. Each larva on the second day of the 5th instar was injected with 10 L of E. coli (107 CFU/larva). The same volume of PBS was used as a control. Ten silkworms were randomly selected 3, 6, 12, 24, and 48 h post-injection from experimental and control groups for hemolymph collection as described above. 2.9. Semi-quantitative PCR (RT-PCR) To examine whether the amounts of the two variants were different, the semi-quantitative PCR amplification was performed under the below condition: 94 ◦ C for 2 min, followed by 25 cycles of 94 ◦ C for 40 s, 55 ◦ C for 30 s and 72 ◦ C for 90 s, and 72 ◦ C extension for 10 min. Primers used in this experiment are listed in Table 1, and BmActin3 was used as an internal control. 2.10. Quantitative real-time PCR (qRT-PCR) The expression level of BmCathepsin O was detected using qRTPCR method. qRT-PCR was performed with GoTaq® Probe qPCR Master Mix (Promega, USA) with a CFX96 Touch System (Bio-Rad, USA). The PCR was carried out in a total volume of 20 L reaction system, which contain 10 L of 2× GoTaq® Probe qPCR Master Mix, 0.4 L of each primers (10 M), 2 L of the diluted cDNA template, and 7.2 L of distilled water. The conditions for the PCR
411
were 95 ◦ C for 10 min, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 30 s. The primers used in this experiment was listed in Table 1. It is difficult to design different qRT-PCR primers to distinguish two variants, so qRT-PCR primers designed in our study could detect the expression of BmCathepsin OL and OS at the same time. The housekeeping gene BmGAPDH was used as an internal control. The expression level of BmCathepsin O was calculated by 2−Ct method (Livak and Schmittgen, 2001). All data were given in terms of relative mRNA expression as means ± SE. Online t-test software GraphPad Software (http://www.graphpad.com/quickcalcs/ttest1. cfm) was used to analysis the statistical significance, and the P value < 0.05 was considered to indicate statistical significance. 3. Results 3.1. Cloning and characterization of Cathepsin O cDNA in silkworm BmCathepsin O was clustered on nscaf2943 which was located on chromosome 14 in silkworm genome (data not shown). There were two trans-spliced variants, BmCathepsin OL (Fig. 1A) and BmCathepsin OS (Fig. 1B). The full-length BmCathepsin OL cDNA sequence was 2075 bp long, with a 1071 bp ORF that encoded a 356 amino acid protein, a 76 bp 5 UTR, and a 928 bp 3 UTR (Fig. 1A). The full-length BmCathepsin OS cDNA sequence was 1170 bp long, with a 942 bp ORF that encoded a 313 amino acid protein, a 76 bp 5 UTR, and a 152 bp 3 UTR (Fig. 1B). The genomic DNA of BmCathepsin O was 6132 bp long, and both two spliced variants were comprised of six exons and five introns, the difference was only found in the 6th exon (Fig. 1). All exon/intron boundary sites were consistent with the GT/AG rule (Breathnach and Chambon, 1981). 3.2. Phylogenetic analysis and amino acid sequence alignment Phylogenetic analysis of cathepsin A, B, C, D, E, F, H, K, L, O, and S from several species using MEGA6 software generated an NJ-phylogenetic tree (Fig. 2). The Cathepsin O from mammals formed one cluster, and the Cathepsin O from insecta formed the second one (Fig. 2). Within Cathepsin O, Cathepsin members can be classified into two groups: vertebrates (including mammals, aves, amphibia, and pisces) and invertebrates (mollusc, and insecta). Insecta appear to be clustered into a separate subgroup in invertebrates, and BmCathepsin O was most closely related to Cathepsin O from Chilo suppressalis (Fig. 2). The homology of BmCathepsin O from silkworm and other species Cathepsin O sequences was explored via multiple sequence alignment using clustal X (Fig. 3). BmCathepsin O was share 37%, 35%, 35%, and 34% with Cathepsin O from C. suppressalis, Danaus
Fig. 1. The gene structure of BmCathepsinO in silkworm. Exons and introns are represented by color box and black solid lines, respectively. 5 and 3 UTRs are represented by blue box. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
412
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 2. The phylogenetic tree of the Cathepsin family based on the full-length amino acid by the neighbor-joining method. The number closed to individual branches represents the percentage of 1000 bootstrap iterations supporting the branch, and values below 60% were omitted. The BmCatO is labeled with red diamond. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
plexippus, Tribolium castaneum, and Apis mellifera, respectively (Fig. 3).
3.3. Expression analysis of BmCathepsin O in silkworm The expression of BmCathpsin O in epidermis, head, silk gland, midgut, fat body, Malpighian tubules, testis, ovary, hemocytes, and wing disc were detected by qRT-PCR. And part of tissues also prepared and subjected to an immunoblot analysis with their corresponding antibodies (Fig. 4B). Those results made it clear that the BmCathepsin O was specifically expressed in hemocytes (Fig. 4A). To examine whether the amounts of the two variants are different or same, specific primers could amplified two variants (BmCathpsin OL, 1406 bp, BmCathpsin OS, 501 bp) were designed. As shown in Fig. 4C, the expression level of BmCathpsin OL was significantly higher than BmCathpsin OS’, but it seems to have the same change tendency from L4D3 to PP2 in hemocytes. Moreover, we also investigated the temporal expression patterns of BmCathepsin O in hemocytes using qRT-PCR (Fig. 4D). The expression level
of the BmCathepsin O reached the top on L4M stage, followed by a rapid decline, after that, the rapid growth arised again during metamorphosis stage. To detect the expression of BmCathepsin O in hemocytes, immunofluorescence assay was conducted in our study. A strong signal was observed in the plasmatocytes and granulocytes (Fig. 5). Plasmatocytes and granulocytes were also isolated as described in Section 2. As showed in Fig. 5B, BmCathpsin O expressed in those two types sub-hemocytes, qRT-PCR analysis showed that the expression level of BmCathepsin O in plasmatocytes was higher than in granulocytes (Fig. 5C).
3.4. Regulation of the BmCathepsin O’ expression by 20E 20E was injected into the larval hemocytes to test whether ecdysone regulates the expression of BmCathepsin O. The result showed that the transcript level of BmCathepsin O in the hemocytes added 20E was significantly up-regulated to about 2.3-, 2.7-, and 4.0-fold higher than control, respectively, and 24 h after injection, the expression levels returned to normal (Fig. 6).
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
413
Fig. 3. Multiple alignment of Cathepsin O amino acid sequences from A. mellifera (XP 623690.3), T. castaneum (EFA02812.1), D. plexippus (EHJ66323.1), and C. suppressalis (AFQ01135.1).
3.5. Temporal expression of BmCathepsin O during E. coli challenged in hemocytes To evaluate the potential role of BmCathepsin O play in hemocytes innate immunity, E. coli was used to inject the larval silkworm. The expression profile of BmCathepsin O in the hemocytes of the infected silkworm showed that its expression level was upregulated to approximately 1.8-, 1.7-, 2.4-, and 3.7-fold higher than control, respectively, but the transcriptional level decreased at 48 h post-injection (Fig. 7). 4. Discussion Affiliated to papain family, cathepsins are ubiquitously present in almost all organisms including viruses, bacteria, plants, invertebrates and vertebrates. Cathepsins have functions in
intracellular protein degradation/turnover via catalyzation of protein hydrolysis (Lecaille et al., 2002; Berti and Storer, 1995; Barrett and Rawlings, 2001) and play crucial roles in various life processes (McGrath, 1999). So far, the vast majorities of cathepsins have been well understood, cathepsin O as well, which is found in various organisms but the previous studies are still stuck in gene clone and enzyme activity analysis (Velasco et al., 1994; Santamarı´ıa et al., 1998; Shi et al., 1995). The expression pattern of BmCathepsin O in different tissues were investigated carefully at L5D3 with qRT-PCR (Fig. 4A) and Western blotting (Fig. 4B). In our previous study, the promoter sequence of BmCathepsin O was cloned and exhibited hemocytespecific activity in silkworm (Zhang et al., 2015). Those results showed that BmCathepsin O was specific-expressed in hemocytes, which implied that it could participate in the functioning of hemocytes. In fact, cathepsins synthesis in hemocytes is essential for
414
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 4. Expression profiles of BmCathepsin O. (A) Tissue-specific expression of BmCathepsin O in silkworm larvae. cDNAs from the epidermis (Ep), head (He), silk gland (Si), midgut (Mi), fat body (Fa), Malpighian tubules (Mi), testis (Te), ovary (Ov), hemocytes (Ha), and wing disc (Wd) of L5D3 larvae were used for qRT-PCR. (B) Different tissues of L5D3 larvae were prepared and subjected to an immunoblot analysis with their corresponding antibodies. Tubulin was used as an internal control. (C) The temporal expression of BmCathepsin OL and OS in larval hemocytes from L4D2 to the wandering stage were detected with semi-quantitive PCR. BmActin3 (A3) was used as an internal control. (D) The temporal expression of BmCathepsin O in larval hemocytes was monitored from L4D2 to the wandering stage. BmGAPDH was used as an internal control.
insect physiological process. Cathepsin B is highly expressed in hemocytes during metamorphosis, and participates in dissociation of the fat body in S. peregrina (Kurata et al., 1992), what is more, cathepsin L is also synthesized in hemocytes and integrated into the basement membranes and participated in wing disk differentiation
at the very end of embryonic development (Homma and Natori, 1996). H. armigera cathepsin L is specifically expressed in hemocytes, which is involved in larval molting and metamorphosis by participating in the functioning of hemocytes (Wang et al., 2010). In addition to those results, Drosophila melanogaster hemocytes
Fig. 5. BmCathepsin O expressed in larval granulocytes and plasmatocytes. (A) distribution of BmCathepsin O after immunofluorescence in the circulating hemocytes of larval silkworms. GR = granulocytes, and PL = plasmatocytes. Scale bar = 10 m. B, and C, semi-quantitive PCR (RT-PCR) and qRT-PCR were used to detect the mRNA expression of BmCathepsin O in larval granulocytes (GR) and plasmatocytes (PL), respectively. BmGAPDH was used as an internal control. The differences between the different groups were analyzed by the Student’s t test, *P < 0.05.
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 6. Relative transcript levels of BmCathepsin O in response to 20-E treated. The corresponding amount of alcohol was used as a control. The differences between the experimental and the control groups were analyzed by the Student’s t test, **P < 0.01, ***P < 0.001. All experiments were repeated at least three times.
Fig. 7. Transcriptional regulation of BmCathepsin O in hemocytes following E. coli challenge. Transcriptional analysis was carried out by qRT-PCR. The relative level of expression at each time point was compared to that of PBS-injected control. The differences between the experimental and the control groups were analyzed by the Student’s t test, *P < 0.05, **P < 0.001. All experiments were repeated at least three times.
was observed to accumulated around fat body and take part in fat body degradation and remodeling (Nelliot et al., 2006; Dolezal et al., 2005). Hemocytes could also attach themselves to the fat body and midgut epithelium during metamorphosis in B. mori (Xu et al., 1998; Adachi et al., 2005). These results indicated the possibility of a function of BmCathepsin O in larval tissues degradation and/or remodeling, especially in fat body and midgut. In Lepidoptera, plasmatocytes and granulocytes usually add up to more than 50% of the hemocytes in larval circulation (Lavine and Strand, 2002). Here, we observed that BmCathepsin O was distributed in both plasmatocytes and granulocytes (Fig. 5), which were the major component cells involved in phagocytosis and encapsulation, respectively (Lavine and Strand, 2002; Liu et al., 2013). Silkworm Cathepsin B mRNA was observed to be highly expressed in plasmatocytes and granulocytes, not in other hemocytes types (Xu and Kawasaki, 2001). These results indicated that Cathepsin O might participate in cellular immunity and/or give assistance in performing normal physiological function of plasmatocytes and granulocytes. Onchocerca volvulus larval molting is seriously inhibited in the presence of specific inhibitors of cathepsin L and Z (Lustigman et al., 1996). Furthermore, cathepsin L and Z are closely related to molting and tissue remodeling in Caenorhabditis elegans and Brugia pahangi (Guiliano et al., 2004). In the present study, the expression
415
of BmCathepsin O reached a peak at the 4th molting stage and maintains a high level during metamorphosis (Fig. 4B), we speculate that it may be involved in the molting and metamorphosis process in silkworm. Additionally, 20-hydroxyecdysone (20E) signal is important regulator of insect molts and metamorphosis (Riddiford et al., 2000; Thummel and Chory, 2002), and our results showed that the expression pattern of BmCathepsin O have similar trends with hormone ecdysone level. Those facts implied that the expression of the BmCathepsin O could be affected by ecdysone. It has been reported that there is a functional connection between hormones and cathepsins. For example, cathepsin L is a proteolytic processing enzyme for the production of active enkephalin (Yasothornsrikul et al., 2003). In silkworm, 20E was found to up-regulated transcript level of cathepsin D in the larval fat body (Gui et al., 2006), and the ecdysone response element (EcREs) was characterized and identified in the promoter region (Yu et al., 2012, 2014). In the present study, BmCathepsin O was remarkably induced by 20E (Fig. 6). It is not clear whether BmCathepsin was regulated by 20E directly or indirectly acting on the promoter region. The innate immune system, also called nonspecific immune system, is the first line of defense (Grasso, 2003). Insect hemocyte is considered as an important immune organ which is mainly involved in cellular immunity, such as phagocytosis, encapsulation, and nodule (Liu et al., 2013; Kanost et al., 2004; Oliver et al., 2011; Satyavathi et al., 2014). In our previous study, we pointed out that silkworm hemocytes participated in eliminating an E. coli infection quickly (Zhang et al., 2014a,b). In order to figure out the response of BmCathepsin exposed to the pathogen, the expression profiles after E. coli stimulation in hemocytes at different time points was tested carefully by qRT-PCR. We observed that BmCathepsin O transcript level was induced significantly in hemocytes at 12 and 24 h post-injection (2.4-, and 3.7-fold increase relative to the control, respectively) (Fig. 7). The result indicated that BmCathepsin O might be involved in immune response against bacterial infection. In the present study, a full-length cDNA of BmCathepsin O was first cloned from silkworm, and sequence feature, tissue-specific distribution were investigated thoroughly. More importantly, our results showed that BmCathepsin O could be induced by ecdysone and involved in defense against bacterial infection. In summary, we expect that our work can to provide new idea for the study of cathepsin O. Acknowledgements This work was supported by the National Basic Research Program of China (2012cb114603), the Research Fund for the Doctoral Program of Higher Education of China (20130182110003), the Natural Science Foundation of Chongqing (cstc2013jcyjys0007), and the Fundamental Research Funds for the Central Universities (XDJK2015D021, XDJK2013B020, SWU111014). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2015. 04.008 References Adachi, T., Tomita, M., Yoshizato, K., 2005. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: involvement of type IV collagen in self-defense reaction and metamorphosis. Matrix Biol. 24, 136–154. Barnes, J., 1940. The enzymes of lymphocytes and polymorphonuclear leucocytes. Br. J. Exp. Pathol. 21, 264. Barrett, A.J., Rawlings, N.D., 2001. Evolutionary lines of cysteine peptidases. Biol. Chem. 382, 727–733.
416
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Berdowska, I., 2004. Cysteine proteases as disease markers. Clin. Chim. Acta 342, 41–69. Berti, P.J., Storer, A.C., 1995. Alignment/phylogeny of the papain superfamily of cysteine proteases. J. Mol. Biol. 246, 273–283. Bond, J.S., Butler, P.E., 1987. Intracellular proteases. Annu. Rev. Biochem. 56, 333–364. Breathnach, R., Chambon, P., 1981. Organization and expression of eucaryotic split genes coding for proteins. Annu. Rev. Biochem. 50, 349–383. Brix, K., Dunkhorst, A., Mayer, K., Jordans, S., 2008. Cysteine cathepsins: cellular roadmap to different functions. Biochimie 90, 194–207. Day, S.R., Dalton, J.P., Clough, K.A., Leonardo, L., Tiu, W.U., Brindley, P., 1995. Characterization and cloning of the cathepsin L proteinases of Schistosoma japonicum. Biochem. Biophys. Res. Commun. 217, 1–9. Dixit, A., Dixit, P., Sharma, R., 2008. Immunodiagnostic/protective role of Cathepsin L cysteine proteinases secreted by Fasciola species. Vet. Parasitol. 154, 177–184. Dolezal, T., Dolezelova, E., Zurovec, M., Bryant, P.J., 2005. A role for adenosine deaminase in drosophila larval development. PLoS Biol. 3, e201. Fagotto, F., Maxfield, F.R., 1994. Yolk platelets in Xenopus oocytes maintain an acidic internal pH which may be essential for sodium accumulation. J. Cell Biol. 125, 1047–1056. Grasso, P., 2003. Essentials of Pathology for Toxicologists. CRC Press. Gui, Z.Z., Lee, K.S., Kim, B.Y., Choi, Y.S., Wei, Y.D., Choo, Y.M., Kang, P.D., Yoon, H.J., Kim, I., Yeon, H.J., 2006. Functional role of aspartic proteinase cathepsin D in insect metamorphosis. BMC Dev. Biol. 6, 49. Guiliano, D.B., Hong, X., McKerrow, J.H., Blaxter, M.L., Oksov, Y., Liu, J., Ghedin, E., Lustigman, S., 2004. A gene family of cathepsin L-like proteases of filarial nematodes are associated with larval molting and cuticle and eggshell remodeling. Mol. Biochem. Parasitol. 136, 227–242. Haeckel, C., Krueger, S., Buehling, F., Broemme, D., Franke, K., Schuetze, A., Roese, I., Roessner, A., 1999. Expression of cathepsin K in the human embryo and fetus. Dev. Dyn. 216, 89–95. Harlow, E., Lane, D., 1988. Antibodies: A Laboratory Manual Cold, vol. 117. Spring Harbor Press, New York, pp. 33. Homma, K.I., Natori, S., 1996. Identification of substrate proteins for cathepsin L that are selectively hydrolyzed during the differentiation of imaginal discs of Sarcophaga peregrina. Eur. J. Biochem. 240, 443–447. Hsing, L.C., Rudensky, A.Y., 2005. The lysosomal cysteine proteases in MHC class II antigen presentation. Immunol. Rev. 207, 229–241. Kanost, M.R., Jiang, H., Yu, X.Q., 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198, 97–105. Kim, B.Y., Lee, K.S., Sohn, M.R., Kim, K.Y., Choi, K.H., Kang, P.D., Jin, B.R., 2011. Bombyx mori cathepsin D expression is induced by high temperature and H2 O2 exposure. J. Asia-Pacific Entomol. 14, 285–288. Kos, J., Lah, T., 1998. Cysteine proteinases and their endogenous inhibitors: target proteins for prognosis, diagnosis and therapy in cancer (review). Oncol. Rep. 5, 1349–1410. Krueger, S., Kalinski, T., Hundertmark, T., Wex, T., Küster, D., Peitz, U., Ebert, M., Nägler, D.K., Kellner, U., Malfertheiner, P., 2005. Up-regulation of cathepsin X in Helicobacter pylori gastritis and gastric cancer. J. Pathol. 207, 32–42. Kurata, S., Saito, H., Natori, S., 1992. The 29-kDa hemocyte proteinase dissociates fat body at metamorphosis of Sarcophaga. Dev. Biol. 153, 115–121. Larkin, M.A., Blackshields, G., Brown, N., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., 2007. Clustal W and clustal X version 2.0. Bioinformatics 23, 2947–2948. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295–1309. Lecaille, F., Kaleta, J., Brömme, D., 2002. Human and parasitic papain-like cysteine proteases: their role in physiology and pathology and recent developments in inhibitor design. Chem. Rev. 102, 4459–4488. Lee, K.S., Kim, B.Y., Choo, Y.M., Yoon, H.J., Kang, P.D., Woo, S.D., Sohn, H.D., Roh, J.Y., Gui, Z.Z., Je, Y.H., 2009. Expression profile of cathepsin B in the fat body of Bombyx mori during metamorphosis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 154, 188–194. Li, W.-W., Jin, X.-K., He, L., Jiang, H., Gong, Y.-N., Xie, Y.-N., Wang, Q., 2010a. Molecular cloning, characterization, expression and activity analysis of cathepsin L in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol. 29, 1010–1018. Li, W.-W., Jin, X.-K., He, L., Jiang, H., Xie, Y.-n., Wang, Q., 2010b. Molecular cloning, characterization and expression analysis of cathepsin C gene involved in the antibacterial response in Chinese mitten crab, Eriocheir sinensis. Dev. Comp. Immunol. 34, 1170–1174. Li, W.-W., He, L., Jin, X.-K., Jiang, H., Chen, L.-L., Wang, Y., Wang, Q., 2011. Molecular cloning, characterization and expression analysis of cathepsin A gene in Chinese mitten crab, Eriocheir sinensis. Peptides 32, 518–525. Liu, F., Xu, Q., Zhang, Q., Lu, A., Beerntsen, B., Ling, E., 2013. Hemocytes and hematopoiesis in the silkworm, Bombyx mori. ISJ 10, 102–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Lustigman, S., McKerrow, J.H., Shah, K., Lui, J., Huima, T., Hough, M., Brotman, B., 1996. Cloning of a cysteine protease required for the molting of Onchocerca volvulus third stage larvae. J. Biol. Chem. 271, 30181–30189. Matsumoto, I., Emori, Y., Abe, K., Arai, S., 1997. Characterization of a gene family encoding cysteine proteinases of Sitophilus zeamais (maize weevil), and analysis of the protein distribution in various tissues including alimentary tract and germ cells. J. Biochem. 121, 464–476. McGrath, M.E., 1999. The lysosomal cysteine proteases. Annu. Rev. Biophys. Biomol. Struct. 28, 181–204.
Nakahara, Y., Shimura, S., Ueno, C., Kanamori, Y., Mita, K., Kiuchi, M., Kamimura, M., 2009. Purification and characterization of silkworm hemocytes by flow cytometry. Dev. Comp. Immunol. 33, 439–448. Nelliot, A., Bond, N., Hoshizaki, D.K., 2006. Fat-body remodeling in Drosophila melanogaster, vol. 44. Genesis (New York, N.Y.: 2000), New York, N.Y., pp. 396–400. Oliver, J.D., Dusty Loy, J., Parikh, G., Bartholomay, L., 2011. Comparative analysis of hemocyte phagocytosis between six species of arthropods as measured by flow cytometry. J. Invertebr. Pathol. 108, 126–130. ˜ Ortego, F., Farinos, G., Ruiz, M., Marco, V., Castanera, P., 1998. Characterization of digestive proteases in the weevil Aubeonymus mariaefranciscae and effects of proteinase inhibitors on larval development and survival. Entomol. Exp. Appl. 88, 265–274. Rabossi, A., Stoka, V., Puizdar, V., Turk, V., Quesada-Allué, L.A., 2004. Novel aspartyl proteinase associated to fat body histolysis during Ceratitis capitata early metamorphosis. Arch. Insect Biochem. Physiol. 57, 51–67. Rawlings, N.D., Barrett, A.J., 1994. Families of cysteine peptidases. Methods Enzymol. 244, 461–486. Riddiford, L.M., Cherbas, P., Truman, J.W., 2000. Ecdysone receptors and their biological actions. Vitam. Horm. 60, 1–73. Riese, R.J., Chapman, H.A., 2000. Cathepsins and compartmentalization in antigen presentation. Curr. Opin. Immunol. 12, 107–113. Rousselle, A.-V., Heymann, D., 2002. Osteoclastic acidification pathways during bone resorption. Bone 30, 533–540. Santamarı´ıa, I., Pendás, A.M., Velasco, G., López-Otı´ın, C., 1998. Genomic structure and chromosomal localization of the human cathepsin O gene (CTSO). Genomics 53, 231–234. Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects. Cell. Signal. 26, 1753–1763. Shi, G.-P., Chapman, H.A., Bhairi, S.M., DeLeeuw, C., Reddy, V.Y., Weiss, S.J., 1995. Molecular cloning of human cathepsin O, a novel endoproteinase and homologue of rabbit OC2. FEBS Lett. 357, 129–134. Shiba, H., Uchida, D., Kobayashi, H., Natori, M., 2001. Involvement of cathepsin B-and L-like proteinases in silk gland histolysis during metamorphosis of Bombyx mori. Arch. Biochem. Biophys. 390, 28–34. Takahashi, N., Kurata, S., Natori, S., 1993. Molecular cloning of cDNA for the 29 kDa proteinase participating in decomposition of the larval fat body during metamorphosis of Sarcophaga peregrina (flesh fly). FEBS Lett. 334, 153–157. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tan, J., Xu, M., Zhang, K., Wang, X., Chen, S., Li, T., Xiang, Z., Cui, H., 2013. Characterization of hemocytes proliferation in larval silkworm, Bombyx mori. J. Insect Physiol. 59, 595–603. Thummel, C.S., Chory, J., 2002. Steroid signaling in plants and insects—common themes, different pathways. Genes Dev. 16, 3113–3129. Turk, B., Stoka, V., 2007. Protease signalling in cell death: caspases versus cysteine cathepsins. FEBS Lett. 581, 2761–2767. Turk, B., Turk, D., Turk, V., 2000. Lysosomal cysteine proteases: more than scavengers. Biochim. Biophys. Acta (BBA) Protein Struct. Mol. Enzymol. 1477, 98–111. Uchida, K., Ohmori, D., Ueno, T., Nishizuka, M., Eshita, Y., Fukunaga, A., Kominami, E., 2001. Preoviposition activation of cathepsin-like proteinases in degenerating ovarian follicles of the mosquito Culex pipiens pallens. Dev. Biol. 237, 68–78. Velasco, G., Ferrando, A.A., Puente, X.S., Sánchez, L.M., López-Otín, C., 1994. Human cathepsin O. Molecular cloning from a breast carcinoma, production of the active enzyme in Escherichia coli, and expression analysis in human tissues. J. Biol. Chem. 269, 27136–27142. Wang, X., Liu, B., Wang, G., Tang, B., Xiang, J., 2008a. Molecular cloning and functional analysis of cathepsin B in nutrient metabolism during larval development in Meretrix meretrix. Aquaculture 282, 41–46. Wang, G.H., Liu, C., Xia, Q.Y., Zha, X.F., Chen, J., Jiangv, L., 2008b. Cathepsin B protease is required for metamorphism in silkworm, Bombyx mori. Insect Sci. 15, 201–208. Wang, L.F., Chai, L.Q., He, H.J., Wang, Q., Wang, J.X., Zhao, X.F., 2010. A cathepsin L-like proteinase is involved in moulting and metamorphosis in Helicoverpa armigera. Insect Mol. Biol. 19, 99–111. Wang, S., Shi, L.-J., Liu, N., Chen, A.-J., Zhao, X.-F., Wang, J.-X., 2012. Involvement of Fenneropenaeus chinensis Cathepsin C in antiviral immunity. Fish Shellfish Immunol. 33, 821–828. Wex, T., Bühling, F., Wex, H., Günther, D., Malfertheiner, P., Weber, E., Brömme, D., 2001. Human cathepsin W, a cysteine protease predominantly expressed in NK cells, is mainly localized in the endoplasmic reticulum. J. Immunol. 167, 2172–2178. Whang, I., De Zoysa, M., Nikapitiya, C., Lee, Y., Kim, Y., Lee, S., Oh, C., Jung, S.-J., Oh, M.-J., Choi, C.Y., 2011. Molecular characterization and expression analysis of Cathepsin B and L cysteine proteases from rock bream (Oplegnathus fasciatus). Fish Shellfish Immunol. 30, 763–772. Xia, Q., Zhou, Z., Lu, C., Cheng, D., Dai, F., Li, B., Zhao, P., Zha, X., Cheng, T., Chai, C., 2004. A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 306, 1937–1940. Xia, Q., Guo, Y., Zhang, Z., Li, D., Xuan, Z., Li, Z., Dai, F., Li, Y., Cheng, D., Li, R., 2009. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx). Science 326, 433–436. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536.
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417 Xu, Y.-S., Kawasaki, H., 2001. Isolation and expression of cathepsin B cDNA in hemocytes during metamorphosis of Bombyx mori. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 130, 393–399. Xu, Y., Kanke, E., Kawasaki, H., 1998. Changes in protein synthesis and cellular morphology in the fat body of the silkworm, Bombyx mori during larval–pupal metamorphosis. J. Seric. Sci. Jpn (Japan) 67 (3), 223–230. Yang, X.M., Hou, L.J., Dong, D.J., Shao, H.L., Wang, J.X., Zhao, X.F., 2006. Cathepsin B-like proteinase is involved in the decomposition of the adult fat body of Helicoverpa armigera. Arch. Insect Biochem. Physiol. 62, 1–10. Yasothornsrikul, S., Greenbaum, D., Medzihradszky, K.F., Toneff, T., Bundey, R., Miller, R., Schilling, B., Petermann, I., Dehnert, J., Logvinova, A., 2003. Cathepsin L in secretory vesicles functions as a prohormone-processing enzyme for production of the enkephalin peptide neurotransmitter. Proc. Natl. Acad. Sci. U. S. A. 100, 9590–9595. Yu, J., Wu, F.-Y., Zou, F.-M., Jia, J.-Q., Wang, S.-P., Zhang, G.-Z., Guo, X.-J., Gui, Z.-Z., 2012. Identification of ecdysone response elements (EcREs) in the Bombyx mori cathepsin D promoter. Biochem. Biophys. Res. Commun. 425, 113–118.
417
Yu, J., Wu, F.Y., Zou, F.M., Cai, X.Y., Yu, H.Y., Liu, Y.W., Fang, Y., Ren, Z.X., Jia, J.Q., Zhang, G.Z., Guo, X.J., Jin, B.R., Gui, Z.Z., 2014. Identification and functional analysis of the cathepsin D gene promoter of Bombyx mori. Mol. Biol. Rep. 41, 1623–1630. Zhang, Y., Lu, Y.-X., Liu, J., Yang, C., Feng, Q.-L., Xu, W.-H., 2013. A regulatory pathway, ecdysone-transcription factor relish-cathepsin L, is involved in insect fat body dissociation. PLoS Genet. 9, e1003273. Zhang, K., Tan, J., Xu, M., Su, J., Hu, R., Chen, Y., Xuan, F., Yang, R., Cui, H., 2014a. A novel granulocyte-specific ␣ integrin is essential for cellular immunity in the silkworm Bombyx mori. J. Insect Physiol. 71, 61–67. Zhang, K., Xu, M., Su, J., Yu, S., Sun, Z., Li, Y., Zhang, W., Hou, J., Shang, L., Cui, H., 2014b. Characterization and identification of the integrin family in silkworm, Bombyx mori. Gene 549 (1), 149–155. Zhang, K., Yu, S., Su, J., Xu, M., Tan, P., Zhang, Y., Xiang, Z., Cui, H., 2015. Identification and characterization of three novel hemocyte-specific promoters in silkworm Bombyx mori. Biochem. Biophys. Res. Commun., http://dx.doi.org/10. 1016/j.bbrc.2015.03.176.
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Molecular cloning, characterization and expression analysis of cathepsin O in silkworm Bombyx mori related to bacterial response Kui Zhang 1 , Jingjing Su 1 , Siyuan Chen, Shuang Yu, Juan Tan, Man Xu, Hanghua Liang, Yuzu Zhao, Huijuan Chao, Liqun Yang, Hongjuan Cui ∗ State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China
a r t i c l e
i n f o
Article history: Received 4 March 2015 Received in revised form 13 April 2015 Accepted 13 April 2015 Available online 18 May 2015 Keywords: Silkworm Molecular cloning Cathepsin O 20-Ecdysone Infection
a b s t r a c t Cathepsins are the main members of the cysteine family and play important roles in immune response in vertebrates. The Cathepsin O of Bombyx mori (BmCathepsin O) was cloned from the hemocytes by the rapid amplification of cDNA ends (RACE). The genomic DNA was 6131 bp long with a total of six exons and five introns. Its pre-mRNA was spliced to generate two spliceosomes. By comparisons with other reported cathepsins O, it was concluded that the identity between them ranged from 29 to 39%. Expression analysis indicated that BmCathepsin O was specific-expressed in hemocytes, and highly expressed at the 4th molting and metamorphosis stages. Immunofluorescence assay and qRT-PCR showed that BmCathepsin O was expressed in granulocytes and plasmatocytes. Interestingly, BmCathepsin O was significantly upregulated after stimulated by 20-hydroxyecdysone (20-E) in vivo, which suggested that BmCathepsin O may be regulated by 20E. Moreover, activation of BmCathepsin O was also observed in hemocytes challenged by Escherichia coli, indicating its potential involvement in the innate immune system of silkworm, B. mori. In summary, our studies provide a new insight into the functional features of Cathepsin O. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Cathepsins are a group of protease predominantly located in lysosomes (Turk and Stoka, 2007; Brix et al., 2008). Since the first cathepsin member was identified in 1940s (Barnes, 1940), more than 20 cathepsins have been discovered in living organisms. Most of the cathepsin members belong to cysteine protease, while a few of which are aspartic proteinase (cathepsin D, E) and serine protease (cathepsin A, G). In general, cathepsins can be divided into two major groups on the basis of their expression features. One group is consists of ubiquitously expressed members, including cathepsin B, C, F, H, L, O, and Z, whereas the other group is composed of cathepsin J, K, S, W, and X, which have been shown to be cell/tissue-specific (Rawlings and Barrett, 1994; Haeckel et al., 1999; Wex et al., 2001; Krueger et al., 2005). In mammals, there are at least eleven cathepsin members, which are closely related to many physiological and pathological processes including intra-
∗ Corresponding author at: State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, #2, Tiansheng Rd, Beibei District, Chongqing 400716, China. Tel.: +86 23 68251712; fax: +86 23 68251128. E-mail addresses: [email protected], [email protected] (H. Cui). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.molimm.2015.04.008 0161-5890/© 2015 Elsevier Ltd. All rights reserved.
cellular protein degradation/turn over (Bond and Butler, 1987), apoptosis (Turk and Stoka, 2007; Turk et al., 2000), osteolysis (Rousselle and Heymann, 2002; Berdowska, 2004), hormone maturation (Yasothornsrikul et al., 2003), antigen processing (Riese and Chapman, 2000; Lecaille et al., 2002), immune responses (Riese and Chapman, 2000; Lecaille et al., 2002; Hsing and Rudensky, 2005; Dixit et al., 2008), and tumorigenesis (Kos and Lah, 1998). In 1994, Gloria Velasco cloned a novel cysteine protease out of human breast cancer cDNA library, and named it cathepsin O (CTSO)(Velasco et al., 1994). CTSO, whose proteolytic activity can be inhibited by proteolytic enzyme inhibitor E-64, is able to degrade the synthetic peptides Z-Phe-Arg-AMC and Z-Arg-Arg-AMC, which are widely used as substrates for cysteine proteinase (Velasco et al., 1994). CTSO is located on chromosome 4q31–q32 (Santamarı´ıa et al., 1998) and has the endoprotease activity against fibrinogen at acid PH, which suggests that it may play an essential role in extracellular matrix degradation (Shi et al., 1995). However, studies upon cathepsin O are still in early days and remain to be elucidated. In recent years, cathepsin gene has also been reported in invertebrate, such as Schistosoma japonicum (Day et al., 1995), Meretrix meretrix (Wang et al., 2008a), Cristaria plicata (Li et al., 2010a), Eriocheir sinensis (Li et al., 2010b, 2011), Oplegnathus fasciatus (Whang et al., 2011), and Fenneropenaeus chinensis (Wang et al., 2012). In addition, various cathepsins are found in insects, among which B, D, and L are the most common ones. They are mainly distributed in
410
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
early embryos, oocytes, larval fat body and alimentary canal, and closely related to insect development (Ortego et al., 1998; Wang et al., 2008b), especially in germ cell development (Matsumoto et al., 1997; Uchida et al., 2001; Gui et al., 2006; Lee et al., 2009), embryogenesis (Fagotto and Maxfield, 1994), fat body (Takahashi et al., 1993; Rabossi et al., 2004; Zhang et al., 2013; Yang et al., 2006) and silk gland (Shiba et al., 2001) degradation and programmed cell death (PCD) during metamorphosis. Cathepsin synthesis in hemocytes plays a significant role in life processes of insects. Bombyx mori cathepsin B is mainly expressed in hemocytes from the day of wandering and the expression level reach the top at day 1 of pupa stage, which suggested that it may be involved in pupa formation (Xu and Kawasaki, 2001). Analogously in Sarcophaga peregrine, cathepsin B is highly expressed in hemocytes during metamorphosis, and participates in dissociation of the fat body in S. peregrina (Kurata et al., 1992). Moreover, the cathepsin L, which is also synthesized in hemocytes and integrated into the basement membranes, partakes in wing disc differentiation at the very end of embryonic development (Homma and Natori, 1996). Helicoverpa armigera cathepsin L is specifically expressed in hemocytes, and it is involved in larval molting and metamorphosis by participating in the functioning of hemocytes (Wang et al., 2010). The silkworm, B. mori is the most important commercial insects to the silk industry, moreover, it could be used as an excellent fundamental research model (Xia et al., 2004, 2009, 2014). Several homologs and cDNA sequences of cathepsin B and D have been identified from silkworm genome, studies showed that cathepsin B was not only critical for normal development of silkworm, especially in fat body and posterior silk gland (Wang et al., 2008b), but also involved in the programmed cell death of the fat body during silkworm metamorphosis (Lee et al., 2009). Cathepsin D expression could be induced by 20-hydroxyecdysone (20E) (Yu et al., 2012), high temperature and H2 O2 (Kim et al., 2011), which suggested that cathepsin D also contributed to silkworm metamorphosis (Lee et al., 2009). In this study, a full-length cDNA of cathepsin O from B. mori was first cloned and characterized, and its temporal and spatial expression profiles were evaluated. The response to the treatment of 20-ecdysone (20-E) and Escherichia coli were also analyzed with qRT-PCR. 2. Materials and methods 2.1. Biological materials The Dazao (P50) strain of B. mori used in our study is maintained in our laboratory. The silkworms were fed with fresh mulberry leaves under standard conditions (Tan et al., 2013; Zhang et al., 2014a,b). Different tissues were extracted in 1× DEPC-treated PBS and then they were flash-frozen and stored at −80 ◦ C until to use. Plasmatocytes and granulocytes are isolated according to the previous report (Nakahara et al., 2009). 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from the epidermis, head, silk gland, midgut, fat body, Malpighian tubules, testis, ovary, hemocytes, and wing disk with TRIzol reagent (Takara, Japan) referring to the protocol provided by the manufacturer. After being treated with RNase-free DNase I (Takara, Japan), First-strand cDNA was synthesized with M-MLV reverse transcriptase (Promega, USA). cDNA product was stored at −20 ◦ C. 2.3. Gene cloning and rapid amplification of cDNA ends (RACE) cDNA of BmCathepsin O was amplified by PCR using Primers CatO-F and CatO-R (Table 1). The PCR conditions included 2–4 min
Table 1 Primers used in this study. F, forward; R, reverse; GSP, gene specific primer; NGSP, nested primers. Name
Sequence (5 –3 )
Usage
BmCatO-F BmCatO-R GSP1 NGSP1 GSP2 NGSP2 BmCatO-qRT-F BmCatO-qRT-R BmGAPDH-qRT-F BmGAPDH-qRT-R BmCatO-RT-F
GCTTTACATAGCCCCCGA AATTTGTAGTGCCCCTGTCTT CCAGGGCTGAGCGTTCACCTTGAC CCGATCATTCCCTCTTCTCGCCAAT CGTCGAGGAGGCTCTGAATGAAAT AGCCCACCATGGACCCGTCATAGT CGGGAGCCGTTTATGGTCT CATTCCCTCTTCTCGCCAAT CATTCCGCGTCCCTGTTGCTAAT GCTGCCTCCTTGACCTTTTGC TGGCGAGAAGAGGGAATG
PCR
BmCatO-RT-R BmA3-F BmA3-R BmCatO-PE-F
AAGCATGCATTCAATTCCTC AACACCCCGTCCTGCTCACTG GGGCGAGACGTGTGATTTCCT AACAAGAGTTACACCGAAGC
BmCatO-PE-R
TTTATTACAGCCCTCACAGAC
5 RACE 3 RACE qRT-PCR
Semi-quantitative PCR
Prokaryotic expression
initial denaturation at 94 ◦ C, followed by 32 cycles of the following: 30 s denaturation at 94 ◦ C, 30 s annealing at 55 ◦ C, 1 min of extension at 72 ◦ C and a final 10 min extension at 72 ◦ C. Full-length cDNA sequence of BmCathpsin O was acquired using SMARTTM RACE cDNA Amplification Kit (Clontech, USA). The primers for 5 RACE and 3 RACE were designed on the basis of the PCR result above and listed in Table 1. All PCR products were purified with AxyPrepTM DNA Gel Extraction kit (Axygen, China) and cloned into PMD19-T Simple Vector (Takara, Japan) and sequenced at BGI company (China). 2.4. Bioinformatic and phylogeny analysis The ORFs were determined with the ORF Finder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The signal peptide was predicted by SignalP 4.0 (http://www.cbs.dtu.dk/services/ SignalP/). The domain was predicted by SMART (http://smart.emblheidelberg.de/). The deduced amino acid sequences of putative BmCathpsin O were aligned using the Clustal X program (Larkin et al., 2007), and a phylogenetic tree was constructed by the neighbor-joining method using MEGA 6 software (Tamura et al., 2007, 2013). The sequences applied in this study were downloaded from GeneBank (http://www.ncbi.nlm.nih.gov/) and listed in supplementary data Table S1. 2.5. Antibody preparation BmCathepsin O protein sequence from 56aa to 205aa was used for antibody preparation. The PET28a-Cathepsin O recombinant plasmid was transformed into competent E. coli rosseta (DE3) cells. The recombinant protein was induced by 1 mM IPTG for 4 h at 37 ◦ C, and subsequently purified with Ni-NTA His Bind Resin (Novagen, USA). Antibodies were obtained by injecting purified protein emulsified with Freund’s complete adjuvant into a New Zealand rabbit according to standard procedures (Harlow and Lane, 1988). The antiserum was collected after four injections, and purified by protein A/G. 2.6. Immunofluorescence assay Hemocytes were collected and treated as described previously (Tan et al., 2013; Zhang et al., 2014a,b). Briefly, collected hemocytes were cultured on coverslips for 15–30 min at room temperature, and subsequently fixed in 4% PFA for 15 min. After being incubated for 10 min with PBS containing 0.1–0.25% Triton X-100 (Sigma),
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
the cells were blocked with 10% goat serum in PBS for 1–1.5 h at 37 ◦ C. Samples were stained with anti-BmCathepsin O antibody (1:1000). Followed by staining with Alexa Fluor® 488 goat antirabbit IgG (H + L) (1:1000, Invitrogen). Nuclei were stained with DAPI and examined by fluorescence microscopy (Nikon 80i). 2.7. Injection of 20E and hemocyte isolation 1.5 g 20E (Sigma, USA) was injected into each larva on the second day of the 5th instar larvae as described in our previous study (Zhang et al., 2014a,b). Ten silkworms were randomly selected 6, 12, 18, 24, and 48 h post-injection from experimental and control groups for hemolymph collection with a dissecting scissors to cut a leg. 400 mL 1× DEPC-treated PBS was then added to each hemolymph sample, and the sample were centrifuged at 3000 × g at 4 ◦ C to isolate hemocytes. Hemocytes were flash-frozen and stored at −80 ◦ C until to use. 2.8. Immune challenge To evaluate the immune response of BmCathepsin O, Pathogenic bacteria E. coli was applied to immune challenge experiment. The E. coli was cultured in LB at 37 ◦ C overnight. Then the bacterial culture was centrifuged at 1000 × g at 4 ◦ C for 10 min. The bacterial pellets were re-suspended in 1× PBS. Each larva on the second day of the 5th instar was injected with 10 L of E. coli (107 CFU/larva). The same volume of PBS was used as a control. Ten silkworms were randomly selected 3, 6, 12, 24, and 48 h post-injection from experimental and control groups for hemolymph collection as described above. 2.9. Semi-quantitative PCR (RT-PCR) To examine whether the amounts of the two variants were different, the semi-quantitative PCR amplification was performed under the below condition: 94 ◦ C for 2 min, followed by 25 cycles of 94 ◦ C for 40 s, 55 ◦ C for 30 s and 72 ◦ C for 90 s, and 72 ◦ C extension for 10 min. Primers used in this experiment are listed in Table 1, and BmActin3 was used as an internal control. 2.10. Quantitative real-time PCR (qRT-PCR) The expression level of BmCathepsin O was detected using qRTPCR method. qRT-PCR was performed with GoTaq® Probe qPCR Master Mix (Promega, USA) with a CFX96 Touch System (Bio-Rad, USA). The PCR was carried out in a total volume of 20 L reaction system, which contain 10 L of 2× GoTaq® Probe qPCR Master Mix, 0.4 L of each primers (10 M), 2 L of the diluted cDNA template, and 7.2 L of distilled water. The conditions for the PCR
411
were 95 ◦ C for 10 min, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 30 s. The primers used in this experiment was listed in Table 1. It is difficult to design different qRT-PCR primers to distinguish two variants, so qRT-PCR primers designed in our study could detect the expression of BmCathepsin OL and OS at the same time. The housekeeping gene BmGAPDH was used as an internal control. The expression level of BmCathepsin O was calculated by 2−Ct method (Livak and Schmittgen, 2001). All data were given in terms of relative mRNA expression as means ± SE. Online t-test software GraphPad Software (http://www.graphpad.com/quickcalcs/ttest1. cfm) was used to analysis the statistical significance, and the P value < 0.05 was considered to indicate statistical significance. 3. Results 3.1. Cloning and characterization of Cathepsin O cDNA in silkworm BmCathepsin O was clustered on nscaf2943 which was located on chromosome 14 in silkworm genome (data not shown). There were two trans-spliced variants, BmCathepsin OL (Fig. 1A) and BmCathepsin OS (Fig. 1B). The full-length BmCathepsin OL cDNA sequence was 2075 bp long, with a 1071 bp ORF that encoded a 356 amino acid protein, a 76 bp 5 UTR, and a 928 bp 3 UTR (Fig. 1A). The full-length BmCathepsin OS cDNA sequence was 1170 bp long, with a 942 bp ORF that encoded a 313 amino acid protein, a 76 bp 5 UTR, and a 152 bp 3 UTR (Fig. 1B). The genomic DNA of BmCathepsin O was 6132 bp long, and both two spliced variants were comprised of six exons and five introns, the difference was only found in the 6th exon (Fig. 1). All exon/intron boundary sites were consistent with the GT/AG rule (Breathnach and Chambon, 1981). 3.2. Phylogenetic analysis and amino acid sequence alignment Phylogenetic analysis of cathepsin A, B, C, D, E, F, H, K, L, O, and S from several species using MEGA6 software generated an NJ-phylogenetic tree (Fig. 2). The Cathepsin O from mammals formed one cluster, and the Cathepsin O from insecta formed the second one (Fig. 2). Within Cathepsin O, Cathepsin members can be classified into two groups: vertebrates (including mammals, aves, amphibia, and pisces) and invertebrates (mollusc, and insecta). Insecta appear to be clustered into a separate subgroup in invertebrates, and BmCathepsin O was most closely related to Cathepsin O from Chilo suppressalis (Fig. 2). The homology of BmCathepsin O from silkworm and other species Cathepsin O sequences was explored via multiple sequence alignment using clustal X (Fig. 3). BmCathepsin O was share 37%, 35%, 35%, and 34% with Cathepsin O from C. suppressalis, Danaus
Fig. 1. The gene structure of BmCathepsinO in silkworm. Exons and introns are represented by color box and black solid lines, respectively. 5 and 3 UTRs are represented by blue box. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
412
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 2. The phylogenetic tree of the Cathepsin family based on the full-length amino acid by the neighbor-joining method. The number closed to individual branches represents the percentage of 1000 bootstrap iterations supporting the branch, and values below 60% were omitted. The BmCatO is labeled with red diamond. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
plexippus, Tribolium castaneum, and Apis mellifera, respectively (Fig. 3).
3.3. Expression analysis of BmCathepsin O in silkworm The expression of BmCathpsin O in epidermis, head, silk gland, midgut, fat body, Malpighian tubules, testis, ovary, hemocytes, and wing disc were detected by qRT-PCR. And part of tissues also prepared and subjected to an immunoblot analysis with their corresponding antibodies (Fig. 4B). Those results made it clear that the BmCathepsin O was specifically expressed in hemocytes (Fig. 4A). To examine whether the amounts of the two variants are different or same, specific primers could amplified two variants (BmCathpsin OL, 1406 bp, BmCathpsin OS, 501 bp) were designed. As shown in Fig. 4C, the expression level of BmCathpsin OL was significantly higher than BmCathpsin OS’, but it seems to have the same change tendency from L4D3 to PP2 in hemocytes. Moreover, we also investigated the temporal expression patterns of BmCathepsin O in hemocytes using qRT-PCR (Fig. 4D). The expression level
of the BmCathepsin O reached the top on L4M stage, followed by a rapid decline, after that, the rapid growth arised again during metamorphosis stage. To detect the expression of BmCathepsin O in hemocytes, immunofluorescence assay was conducted in our study. A strong signal was observed in the plasmatocytes and granulocytes (Fig. 5). Plasmatocytes and granulocytes were also isolated as described in Section 2. As showed in Fig. 5B, BmCathpsin O expressed in those two types sub-hemocytes, qRT-PCR analysis showed that the expression level of BmCathepsin O in plasmatocytes was higher than in granulocytes (Fig. 5C).
3.4. Regulation of the BmCathepsin O’ expression by 20E 20E was injected into the larval hemocytes to test whether ecdysone regulates the expression of BmCathepsin O. The result showed that the transcript level of BmCathepsin O in the hemocytes added 20E was significantly up-regulated to about 2.3-, 2.7-, and 4.0-fold higher than control, respectively, and 24 h after injection, the expression levels returned to normal (Fig. 6).
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
413
Fig. 3. Multiple alignment of Cathepsin O amino acid sequences from A. mellifera (XP 623690.3), T. castaneum (EFA02812.1), D. plexippus (EHJ66323.1), and C. suppressalis (AFQ01135.1).
3.5. Temporal expression of BmCathepsin O during E. coli challenged in hemocytes To evaluate the potential role of BmCathepsin O play in hemocytes innate immunity, E. coli was used to inject the larval silkworm. The expression profile of BmCathepsin O in the hemocytes of the infected silkworm showed that its expression level was upregulated to approximately 1.8-, 1.7-, 2.4-, and 3.7-fold higher than control, respectively, but the transcriptional level decreased at 48 h post-injection (Fig. 7). 4. Discussion Affiliated to papain family, cathepsins are ubiquitously present in almost all organisms including viruses, bacteria, plants, invertebrates and vertebrates. Cathepsins have functions in
intracellular protein degradation/turnover via catalyzation of protein hydrolysis (Lecaille et al., 2002; Berti and Storer, 1995; Barrett and Rawlings, 2001) and play crucial roles in various life processes (McGrath, 1999). So far, the vast majorities of cathepsins have been well understood, cathepsin O as well, which is found in various organisms but the previous studies are still stuck in gene clone and enzyme activity analysis (Velasco et al., 1994; Santamarı´ıa et al., 1998; Shi et al., 1995). The expression pattern of BmCathepsin O in different tissues were investigated carefully at L5D3 with qRT-PCR (Fig. 4A) and Western blotting (Fig. 4B). In our previous study, the promoter sequence of BmCathepsin O was cloned and exhibited hemocytespecific activity in silkworm (Zhang et al., 2015). Those results showed that BmCathepsin O was specific-expressed in hemocytes, which implied that it could participate in the functioning of hemocytes. In fact, cathepsins synthesis in hemocytes is essential for
414
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 4. Expression profiles of BmCathepsin O. (A) Tissue-specific expression of BmCathepsin O in silkworm larvae. cDNAs from the epidermis (Ep), head (He), silk gland (Si), midgut (Mi), fat body (Fa), Malpighian tubules (Mi), testis (Te), ovary (Ov), hemocytes (Ha), and wing disc (Wd) of L5D3 larvae were used for qRT-PCR. (B) Different tissues of L5D3 larvae were prepared and subjected to an immunoblot analysis with their corresponding antibodies. Tubulin was used as an internal control. (C) The temporal expression of BmCathepsin OL and OS in larval hemocytes from L4D2 to the wandering stage were detected with semi-quantitive PCR. BmActin3 (A3) was used as an internal control. (D) The temporal expression of BmCathepsin O in larval hemocytes was monitored from L4D2 to the wandering stage. BmGAPDH was used as an internal control.
insect physiological process. Cathepsin B is highly expressed in hemocytes during metamorphosis, and participates in dissociation of the fat body in S. peregrina (Kurata et al., 1992), what is more, cathepsin L is also synthesized in hemocytes and integrated into the basement membranes and participated in wing disk differentiation
at the very end of embryonic development (Homma and Natori, 1996). H. armigera cathepsin L is specifically expressed in hemocytes, which is involved in larval molting and metamorphosis by participating in the functioning of hemocytes (Wang et al., 2010). In addition to those results, Drosophila melanogaster hemocytes
Fig. 5. BmCathepsin O expressed in larval granulocytes and plasmatocytes. (A) distribution of BmCathepsin O after immunofluorescence in the circulating hemocytes of larval silkworms. GR = granulocytes, and PL = plasmatocytes. Scale bar = 10 m. B, and C, semi-quantitive PCR (RT-PCR) and qRT-PCR were used to detect the mRNA expression of BmCathepsin O in larval granulocytes (GR) and plasmatocytes (PL), respectively. BmGAPDH was used as an internal control. The differences between the different groups were analyzed by the Student’s t test, *P < 0.05.
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Fig. 6. Relative transcript levels of BmCathepsin O in response to 20-E treated. The corresponding amount of alcohol was used as a control. The differences between the experimental and the control groups were analyzed by the Student’s t test, **P < 0.01, ***P < 0.001. All experiments were repeated at least three times.
Fig. 7. Transcriptional regulation of BmCathepsin O in hemocytes following E. coli challenge. Transcriptional analysis was carried out by qRT-PCR. The relative level of expression at each time point was compared to that of PBS-injected control. The differences between the experimental and the control groups were analyzed by the Student’s t test, *P < 0.05, **P < 0.001. All experiments were repeated at least three times.
was observed to accumulated around fat body and take part in fat body degradation and remodeling (Nelliot et al., 2006; Dolezal et al., 2005). Hemocytes could also attach themselves to the fat body and midgut epithelium during metamorphosis in B. mori (Xu et al., 1998; Adachi et al., 2005). These results indicated the possibility of a function of BmCathepsin O in larval tissues degradation and/or remodeling, especially in fat body and midgut. In Lepidoptera, plasmatocytes and granulocytes usually add up to more than 50% of the hemocytes in larval circulation (Lavine and Strand, 2002). Here, we observed that BmCathepsin O was distributed in both plasmatocytes and granulocytes (Fig. 5), which were the major component cells involved in phagocytosis and encapsulation, respectively (Lavine and Strand, 2002; Liu et al., 2013). Silkworm Cathepsin B mRNA was observed to be highly expressed in plasmatocytes and granulocytes, not in other hemocytes types (Xu and Kawasaki, 2001). These results indicated that Cathepsin O might participate in cellular immunity and/or give assistance in performing normal physiological function of plasmatocytes and granulocytes. Onchocerca volvulus larval molting is seriously inhibited in the presence of specific inhibitors of cathepsin L and Z (Lustigman et al., 1996). Furthermore, cathepsin L and Z are closely related to molting and tissue remodeling in Caenorhabditis elegans and Brugia pahangi (Guiliano et al., 2004). In the present study, the expression
415
of BmCathepsin O reached a peak at the 4th molting stage and maintains a high level during metamorphosis (Fig. 4B), we speculate that it may be involved in the molting and metamorphosis process in silkworm. Additionally, 20-hydroxyecdysone (20E) signal is important regulator of insect molts and metamorphosis (Riddiford et al., 2000; Thummel and Chory, 2002), and our results showed that the expression pattern of BmCathepsin O have similar trends with hormone ecdysone level. Those facts implied that the expression of the BmCathepsin O could be affected by ecdysone. It has been reported that there is a functional connection between hormones and cathepsins. For example, cathepsin L is a proteolytic processing enzyme for the production of active enkephalin (Yasothornsrikul et al., 2003). In silkworm, 20E was found to up-regulated transcript level of cathepsin D in the larval fat body (Gui et al., 2006), and the ecdysone response element (EcREs) was characterized and identified in the promoter region (Yu et al., 2012, 2014). In the present study, BmCathepsin O was remarkably induced by 20E (Fig. 6). It is not clear whether BmCathepsin was regulated by 20E directly or indirectly acting on the promoter region. The innate immune system, also called nonspecific immune system, is the first line of defense (Grasso, 2003). Insect hemocyte is considered as an important immune organ which is mainly involved in cellular immunity, such as phagocytosis, encapsulation, and nodule (Liu et al., 2013; Kanost et al., 2004; Oliver et al., 2011; Satyavathi et al., 2014). In our previous study, we pointed out that silkworm hemocytes participated in eliminating an E. coli infection quickly (Zhang et al., 2014a,b). In order to figure out the response of BmCathepsin exposed to the pathogen, the expression profiles after E. coli stimulation in hemocytes at different time points was tested carefully by qRT-PCR. We observed that BmCathepsin O transcript level was induced significantly in hemocytes at 12 and 24 h post-injection (2.4-, and 3.7-fold increase relative to the control, respectively) (Fig. 7). The result indicated that BmCathepsin O might be involved in immune response against bacterial infection. In the present study, a full-length cDNA of BmCathepsin O was first cloned from silkworm, and sequence feature, tissue-specific distribution were investigated thoroughly. More importantly, our results showed that BmCathepsin O could be induced by ecdysone and involved in defense against bacterial infection. In summary, we expect that our work can to provide new idea for the study of cathepsin O. Acknowledgements This work was supported by the National Basic Research Program of China (2012cb114603), the Research Fund for the Doctoral Program of Higher Education of China (20130182110003), the Natural Science Foundation of Chongqing (cstc2013jcyjys0007), and the Fundamental Research Funds for the Central Universities (XDJK2015D021, XDJK2013B020, SWU111014). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2015. 04.008 References Adachi, T., Tomita, M., Yoshizato, K., 2005. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: involvement of type IV collagen in self-defense reaction and metamorphosis. Matrix Biol. 24, 136–154. Barnes, J., 1940. The enzymes of lymphocytes and polymorphonuclear leucocytes. Br. J. Exp. Pathol. 21, 264. Barrett, A.J., Rawlings, N.D., 2001. Evolutionary lines of cysteine peptidases. Biol. Chem. 382, 727–733.
416
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417
Berdowska, I., 2004. Cysteine proteases as disease markers. Clin. Chim. Acta 342, 41–69. Berti, P.J., Storer, A.C., 1995. Alignment/phylogeny of the papain superfamily of cysteine proteases. J. Mol. Biol. 246, 273–283. Bond, J.S., Butler, P.E., 1987. Intracellular proteases. Annu. Rev. Biochem. 56, 333–364. Breathnach, R., Chambon, P., 1981. Organization and expression of eucaryotic split genes coding for proteins. Annu. Rev. Biochem. 50, 349–383. Brix, K., Dunkhorst, A., Mayer, K., Jordans, S., 2008. Cysteine cathepsins: cellular roadmap to different functions. Biochimie 90, 194–207. Day, S.R., Dalton, J.P., Clough, K.A., Leonardo, L., Tiu, W.U., Brindley, P., 1995. Characterization and cloning of the cathepsin L proteinases of Schistosoma japonicum. Biochem. Biophys. Res. Commun. 217, 1–9. Dixit, A., Dixit, P., Sharma, R., 2008. Immunodiagnostic/protective role of Cathepsin L cysteine proteinases secreted by Fasciola species. Vet. Parasitol. 154, 177–184. Dolezal, T., Dolezelova, E., Zurovec, M., Bryant, P.J., 2005. A role for adenosine deaminase in drosophila larval development. PLoS Biol. 3, e201. Fagotto, F., Maxfield, F.R., 1994. Yolk platelets in Xenopus oocytes maintain an acidic internal pH which may be essential for sodium accumulation. J. Cell Biol. 125, 1047–1056. Grasso, P., 2003. Essentials of Pathology for Toxicologists. CRC Press. Gui, Z.Z., Lee, K.S., Kim, B.Y., Choi, Y.S., Wei, Y.D., Choo, Y.M., Kang, P.D., Yoon, H.J., Kim, I., Yeon, H.J., 2006. Functional role of aspartic proteinase cathepsin D in insect metamorphosis. BMC Dev. Biol. 6, 49. Guiliano, D.B., Hong, X., McKerrow, J.H., Blaxter, M.L., Oksov, Y., Liu, J., Ghedin, E., Lustigman, S., 2004. A gene family of cathepsin L-like proteases of filarial nematodes are associated with larval molting and cuticle and eggshell remodeling. Mol. Biochem. Parasitol. 136, 227–242. Haeckel, C., Krueger, S., Buehling, F., Broemme, D., Franke, K., Schuetze, A., Roese, I., Roessner, A., 1999. Expression of cathepsin K in the human embryo and fetus. Dev. Dyn. 216, 89–95. Harlow, E., Lane, D., 1988. Antibodies: A Laboratory Manual Cold, vol. 117. Spring Harbor Press, New York, pp. 33. Homma, K.I., Natori, S., 1996. Identification of substrate proteins for cathepsin L that are selectively hydrolyzed during the differentiation of imaginal discs of Sarcophaga peregrina. Eur. J. Biochem. 240, 443–447. Hsing, L.C., Rudensky, A.Y., 2005. The lysosomal cysteine proteases in MHC class II antigen presentation. Immunol. Rev. 207, 229–241. Kanost, M.R., Jiang, H., Yu, X.Q., 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198, 97–105. Kim, B.Y., Lee, K.S., Sohn, M.R., Kim, K.Y., Choi, K.H., Kang, P.D., Jin, B.R., 2011. Bombyx mori cathepsin D expression is induced by high temperature and H2 O2 exposure. J. Asia-Pacific Entomol. 14, 285–288. Kos, J., Lah, T., 1998. Cysteine proteinases and their endogenous inhibitors: target proteins for prognosis, diagnosis and therapy in cancer (review). Oncol. Rep. 5, 1349–1410. Krueger, S., Kalinski, T., Hundertmark, T., Wex, T., Küster, D., Peitz, U., Ebert, M., Nägler, D.K., Kellner, U., Malfertheiner, P., 2005. Up-regulation of cathepsin X in Helicobacter pylori gastritis and gastric cancer. J. Pathol. 207, 32–42. Kurata, S., Saito, H., Natori, S., 1992. The 29-kDa hemocyte proteinase dissociates fat body at metamorphosis of Sarcophaga. Dev. Biol. 153, 115–121. Larkin, M.A., Blackshields, G., Brown, N., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., 2007. Clustal W and clustal X version 2.0. Bioinformatics 23, 2947–2948. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295–1309. Lecaille, F., Kaleta, J., Brömme, D., 2002. Human and parasitic papain-like cysteine proteases: their role in physiology and pathology and recent developments in inhibitor design. Chem. Rev. 102, 4459–4488. Lee, K.S., Kim, B.Y., Choo, Y.M., Yoon, H.J., Kang, P.D., Woo, S.D., Sohn, H.D., Roh, J.Y., Gui, Z.Z., Je, Y.H., 2009. Expression profile of cathepsin B in the fat body of Bombyx mori during metamorphosis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 154, 188–194. Li, W.-W., Jin, X.-K., He, L., Jiang, H., Gong, Y.-N., Xie, Y.-N., Wang, Q., 2010a. Molecular cloning, characterization, expression and activity analysis of cathepsin L in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol. 29, 1010–1018. Li, W.-W., Jin, X.-K., He, L., Jiang, H., Xie, Y.-n., Wang, Q., 2010b. Molecular cloning, characterization and expression analysis of cathepsin C gene involved in the antibacterial response in Chinese mitten crab, Eriocheir sinensis. Dev. Comp. Immunol. 34, 1170–1174. Li, W.-W., He, L., Jin, X.-K., Jiang, H., Chen, L.-L., Wang, Y., Wang, Q., 2011. Molecular cloning, characterization and expression analysis of cathepsin A gene in Chinese mitten crab, Eriocheir sinensis. Peptides 32, 518–525. Liu, F., Xu, Q., Zhang, Q., Lu, A., Beerntsen, B., Ling, E., 2013. Hemocytes and hematopoiesis in the silkworm, Bombyx mori. ISJ 10, 102–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Lustigman, S., McKerrow, J.H., Shah, K., Lui, J., Huima, T., Hough, M., Brotman, B., 1996. Cloning of a cysteine protease required for the molting of Onchocerca volvulus third stage larvae. J. Biol. Chem. 271, 30181–30189. Matsumoto, I., Emori, Y., Abe, K., Arai, S., 1997. Characterization of a gene family encoding cysteine proteinases of Sitophilus zeamais (maize weevil), and analysis of the protein distribution in various tissues including alimentary tract and germ cells. J. Biochem. 121, 464–476. McGrath, M.E., 1999. The lysosomal cysteine proteases. Annu. Rev. Biophys. Biomol. Struct. 28, 181–204.
Nakahara, Y., Shimura, S., Ueno, C., Kanamori, Y., Mita, K., Kiuchi, M., Kamimura, M., 2009. Purification and characterization of silkworm hemocytes by flow cytometry. Dev. Comp. Immunol. 33, 439–448. Nelliot, A., Bond, N., Hoshizaki, D.K., 2006. Fat-body remodeling in Drosophila melanogaster, vol. 44. Genesis (New York, N.Y.: 2000), New York, N.Y., pp. 396–400. Oliver, J.D., Dusty Loy, J., Parikh, G., Bartholomay, L., 2011. Comparative analysis of hemocyte phagocytosis between six species of arthropods as measured by flow cytometry. J. Invertebr. Pathol. 108, 126–130. ˜ Ortego, F., Farinos, G., Ruiz, M., Marco, V., Castanera, P., 1998. Characterization of digestive proteases in the weevil Aubeonymus mariaefranciscae and effects of proteinase inhibitors on larval development and survival. Entomol. Exp. Appl. 88, 265–274. Rabossi, A., Stoka, V., Puizdar, V., Turk, V., Quesada-Allué, L.A., 2004. Novel aspartyl proteinase associated to fat body histolysis during Ceratitis capitata early metamorphosis. Arch. Insect Biochem. Physiol. 57, 51–67. Rawlings, N.D., Barrett, A.J., 1994. Families of cysteine peptidases. Methods Enzymol. 244, 461–486. Riddiford, L.M., Cherbas, P., Truman, J.W., 2000. Ecdysone receptors and their biological actions. Vitam. Horm. 60, 1–73. Riese, R.J., Chapman, H.A., 2000. Cathepsins and compartmentalization in antigen presentation. Curr. Opin. Immunol. 12, 107–113. Rousselle, A.-V., Heymann, D., 2002. Osteoclastic acidification pathways during bone resorption. Bone 30, 533–540. Santamarı´ıa, I., Pendás, A.M., Velasco, G., López-Otı´ın, C., 1998. Genomic structure and chromosomal localization of the human cathepsin O gene (CTSO). Genomics 53, 231–234. Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects. Cell. Signal. 26, 1753–1763. Shi, G.-P., Chapman, H.A., Bhairi, S.M., DeLeeuw, C., Reddy, V.Y., Weiss, S.J., 1995. Molecular cloning of human cathepsin O, a novel endoproteinase and homologue of rabbit OC2. FEBS Lett. 357, 129–134. Shiba, H., Uchida, D., Kobayashi, H., Natori, M., 2001. Involvement of cathepsin B-and L-like proteinases in silk gland histolysis during metamorphosis of Bombyx mori. Arch. Biochem. Biophys. 390, 28–34. Takahashi, N., Kurata, S., Natori, S., 1993. Molecular cloning of cDNA for the 29 kDa proteinase participating in decomposition of the larval fat body during metamorphosis of Sarcophaga peregrina (flesh fly). FEBS Lett. 334, 153–157. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tan, J., Xu, M., Zhang, K., Wang, X., Chen, S., Li, T., Xiang, Z., Cui, H., 2013. Characterization of hemocytes proliferation in larval silkworm, Bombyx mori. J. Insect Physiol. 59, 595–603. Thummel, C.S., Chory, J., 2002. Steroid signaling in plants and insects—common themes, different pathways. Genes Dev. 16, 3113–3129. Turk, B., Stoka, V., 2007. Protease signalling in cell death: caspases versus cysteine cathepsins. FEBS Lett. 581, 2761–2767. Turk, B., Turk, D., Turk, V., 2000. Lysosomal cysteine proteases: more than scavengers. Biochim. Biophys. Acta (BBA) Protein Struct. Mol. Enzymol. 1477, 98–111. Uchida, K., Ohmori, D., Ueno, T., Nishizuka, M., Eshita, Y., Fukunaga, A., Kominami, E., 2001. Preoviposition activation of cathepsin-like proteinases in degenerating ovarian follicles of the mosquito Culex pipiens pallens. Dev. Biol. 237, 68–78. Velasco, G., Ferrando, A.A., Puente, X.S., Sánchez, L.M., López-Otín, C., 1994. Human cathepsin O. Molecular cloning from a breast carcinoma, production of the active enzyme in Escherichia coli, and expression analysis in human tissues. J. Biol. Chem. 269, 27136–27142. Wang, X., Liu, B., Wang, G., Tang, B., Xiang, J., 2008a. Molecular cloning and functional analysis of cathepsin B in nutrient metabolism during larval development in Meretrix meretrix. Aquaculture 282, 41–46. Wang, G.H., Liu, C., Xia, Q.Y., Zha, X.F., Chen, J., Jiangv, L., 2008b. Cathepsin B protease is required for metamorphism in silkworm, Bombyx mori. Insect Sci. 15, 201–208. Wang, L.F., Chai, L.Q., He, H.J., Wang, Q., Wang, J.X., Zhao, X.F., 2010. A cathepsin L-like proteinase is involved in moulting and metamorphosis in Helicoverpa armigera. Insect Mol. Biol. 19, 99–111. Wang, S., Shi, L.-J., Liu, N., Chen, A.-J., Zhao, X.-F., Wang, J.-X., 2012. Involvement of Fenneropenaeus chinensis Cathepsin C in antiviral immunity. Fish Shellfish Immunol. 33, 821–828. Wex, T., Bühling, F., Wex, H., Günther, D., Malfertheiner, P., Weber, E., Brömme, D., 2001. Human cathepsin W, a cysteine protease predominantly expressed in NK cells, is mainly localized in the endoplasmic reticulum. J. Immunol. 167, 2172–2178. Whang, I., De Zoysa, M., Nikapitiya, C., Lee, Y., Kim, Y., Lee, S., Oh, C., Jung, S.-J., Oh, M.-J., Choi, C.Y., 2011. Molecular characterization and expression analysis of Cathepsin B and L cysteine proteases from rock bream (Oplegnathus fasciatus). Fish Shellfish Immunol. 30, 763–772. Xia, Q., Zhou, Z., Lu, C., Cheng, D., Dai, F., Li, B., Zhao, P., Zha, X., Cheng, T., Chai, C., 2004. A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 306, 1937–1940. Xia, Q., Guo, Y., Zhang, Z., Li, D., Xuan, Z., Li, Z., Dai, F., Li, Y., Cheng, D., Li, R., 2009. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx). Science 326, 433–436. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536.
K. Zhang et al. / Molecular Immunology 66 (2015) 409–417 Xu, Y.-S., Kawasaki, H., 2001. Isolation and expression of cathepsin B cDNA in hemocytes during metamorphosis of Bombyx mori. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 130, 393–399. Xu, Y., Kanke, E., Kawasaki, H., 1998. Changes in protein synthesis and cellular morphology in the fat body of the silkworm, Bombyx mori during larval–pupal metamorphosis. J. Seric. Sci. Jpn (Japan) 67 (3), 223–230. Yang, X.M., Hou, L.J., Dong, D.J., Shao, H.L., Wang, J.X., Zhao, X.F., 2006. Cathepsin B-like proteinase is involved in the decomposition of the adult fat body of Helicoverpa armigera. Arch. Insect Biochem. Physiol. 62, 1–10. Yasothornsrikul, S., Greenbaum, D., Medzihradszky, K.F., Toneff, T., Bundey, R., Miller, R., Schilling, B., Petermann, I., Dehnert, J., Logvinova, A., 2003. Cathepsin L in secretory vesicles functions as a prohormone-processing enzyme for production of the enkephalin peptide neurotransmitter. Proc. Natl. Acad. Sci. U. S. A. 100, 9590–9595. Yu, J., Wu, F.-Y., Zou, F.-M., Jia, J.-Q., Wang, S.-P., Zhang, G.-Z., Guo, X.-J., Gui, Z.-Z., 2012. Identification of ecdysone response elements (EcREs) in the Bombyx mori cathepsin D promoter. Biochem. Biophys. Res. Commun. 425, 113–118.
417
Yu, J., Wu, F.Y., Zou, F.M., Cai, X.Y., Yu, H.Y., Liu, Y.W., Fang, Y., Ren, Z.X., Jia, J.Q., Zhang, G.Z., Guo, X.J., Jin, B.R., Gui, Z.Z., 2014. Identification and functional analysis of the cathepsin D gene promoter of Bombyx mori. Mol. Biol. Rep. 41, 1623–1630. Zhang, Y., Lu, Y.-X., Liu, J., Yang, C., Feng, Q.-L., Xu, W.-H., 2013. A regulatory pathway, ecdysone-transcription factor relish-cathepsin L, is involved in insect fat body dissociation. PLoS Genet. 9, e1003273. Zhang, K., Tan, J., Xu, M., Su, J., Hu, R., Chen, Y., Xuan, F., Yang, R., Cui, H., 2014a. A novel granulocyte-specific ␣ integrin is essential for cellular immunity in the silkworm Bombyx mori. J. Insect Physiol. 71, 61–67. Zhang, K., Xu, M., Su, J., Yu, S., Sun, Z., Li, Y., Zhang, W., Hou, J., Shang, L., Cui, H., 2014b. Characterization and identification of the integrin family in silkworm, Bombyx mori. Gene 549 (1), 149–155. Zhang, K., Yu, S., Su, J., Xu, M., Tan, P., Zhang, Y., Xiang, Z., Cui, H., 2015. Identification and characterization of three novel hemocyte-specific promoters in silkworm Bombyx mori. Biochem. Biophys. Res. Commun., http://dx.doi.org/10. 1016/j.bbrc.2015.03.176.