- Email: [email protected]
Molecular cloning of bullfrog D2 dopamine receptor cDNA: Tissue distribution of three isoforms of D2 dopamine receptor mRNA
General and Comparative Endocrinology 168 (2010) 143–148
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Molecular cloning of bullfrog D2 dopamine receptor cDNA: Tissue distribution of three isoforms of D2 dopamine receptor mRNA Masaki Nakano a, Itaru Hasunuma b, Reiko Okada a,c, Kazutoshi Yamamoto b, Sakae Kikuyama b, Takeo Machida a, Tetsuya Kobayashi a,* a b c
Division of Life Science, Graduate School of Science and Engineering, Saitama University, Saitama 338-8570, Japan Department of Biology, Faculty of Education and Integrated Arts and Sciences, Waseda University, Tokyo 162-8480, Japan Integrated Bioscience Section, Graduate School of Science and Technology, Shizuoka University, Shizuoka 422-8529, Japan
a r t i c l e
i n f o
Article history: Received 8 February 2010 Revised 24 March 2010 Accepted 20 April 2010 Available online 22 April 2010 Keywords: Dopamine D2 receptor Isoform Bullfrog
a b s t r a c t The cDNA encoding D2 dopamine receptor was cloned from the distal lobe of the bullfrog pituitary. The deduced amino acid sequence of the bullfrog D2 dopamine receptor (bfD2A) spanned 444 amino acids and exhibited typical features of those of D2 dopamine receptors cloned in other animals to date. It showed a high similarity of 75–87% with rat, turkey, Xenopus and tilapia counterparts. Further analysis of nucleotide sequence of the cDNA revealed the presence of putative truncated D2 dopamine receptor isoforms, bfD2B and bfD2C, of which nucleotide sequences lacked 12 and 99 nucleotides of the coding region for bfD2A, respectively. The alignment analysis indicated that putative bfD2C isoform was close to D2S subtype cloned in mammals and birds, whereas bfD2A and putative bfD2B isoforms were close to mammalian and avian D2L subtype and homologous to two isoforms of Xenopus. This is the first report of the presence of mRNAs for two D2L-like isoforms and one D2S-like isoform in a single species. The amino acid sequence responsible for producing isoforms is present in the third intracellular loop, which has been shown to play an important role in the coupling with G protein. Accordingly, differences in the mode of coupling with G protein among three isoforms were suggested. The expression of three isoforms mRNA in organs and tissues was analyzed by RT-PCR. In the brain, pars distalis and pars neurointermedia, mRNAs for three isoforms were invariably expressed, whereas only putative bfD2C mRNA was expressed in peripheral organs and tissues. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Dopamine is a ubiquitous neurotransmitter found in both the central and peripheral nervous systems in various species of animals. It is involved in a wide variety of behavioral and physiological functions, and is known to regulate the hypothalamo-pituitary axis (Ben-Jonathan, 1985; Missale et al., 1998). The transduction of dopaminergic signals is mediated by several subtypes of G proteincoupled receptors. These receptors are divided into two major subclasses: the D1-like (D1 and D5) and the D2-like (D2, D3 and D4) receptors, and are further characterized by their ability to stimulate or inhibit adenylate cyclase activity (Civelli et al., 1991; Missale et al., 1998). In mammals, dopamine released from the hypothalamic tuberoinfundibular neurons serves as the physiological inhibitor of prolactin (PRL) secretion, and this function is mediated through D2 dopamine receptors residing on the pituitary lactotroph membranes (Ben-Jonathan, 1985). In amphibians, the distribution of * Corresponding author. Fax: +81 48 858 3419. E-mail address: [email protected] (T. Kobayashi). 0016-6480/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2010.04.016
dopaminergic neurons has been studied in the diencephalon of various species such as Rana temporaria (Prasada Rao and Hartwig, 1974), Bufo japonicus (Kikuyama et al., 1979; Kouki et al., 1998) and Xenopus laevis (González et al., 1993). All these studies revealed that dopamine-containing cells exist mainly in the preoptic recess organ (PRO), the paraventricular organ (PVO) and the dorsal infundibular nucleus (DIN). These neurons send their projections toward the median eminence (ME) terminate around the capillaries of ME or in the intermediate lobe of the pituitary. Dopaminergic cells in the suprachiasmatic nucleus in Xenopus (Tuinhof et al., 1994; Ubink et al., 1998) and in the rostral PRO in Bufo (Kouki et al., 1998) have been demonstrated to exert an inhibitory effect on the release of a-melanophore-stimulating hormone. Like in mammals, dopamine also inhibits the release of PRL from the distal lobe of pituitary in amphibians as examined with the bullfrog (R. catesbeiana) in vivo (Kikuyama and Seki, 1980) and in vitro (Seki and Kikuyama, 1982, 1986), although the hypothalamic center responsible for the inhibition of PRL secretion is not clear. We have recently demonstrated that in amphibians, like in mammals, the inhibitory effect of dopamine on the PRL release from the pituitary gland is mediated by D2 dopamine receptors (Nakano et al., 2007).
144
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
As a step to investigate further the physiological functions of D2 dopamine receptors in amphibians, an attempt was made to obtain D2 dopamine receptor cDNAs from the bullfrog. Here we report the sequences for bullfrog D2 dopamine receptor and its two predicted isoforms, and the distribution of these isoform mRNAs in several organs and tissues of adult bullfrogs. 2. Materials and methods 2.1. Animals Bullfrogs ( R. catesbeiana) of both sexes were purchased from Ohuchi Aquatic Animal Supply (Saitama, Japan), and kept in a tank maintained at 23 °C under a 12/12-h (light/dark) photo-cycle. All experimental procedures were conducted in accordance with the ‘‘Institutional Guidelines for Animal Care and Use” of Saitama University (Saitama, Japan). 2.2. Cloning of bullfrog D2 dopamine receptor cDNA D2 dopamine receptor cDNA fragments of the bullfrog were obtained by the use of reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was extracted from the distal lobes of the bullfrog pituitary using RNAiso (Takara, Shiga, Japan), in accordance with the manufacturer’s instructions. Genomic DNA contaminating the total RNA sample was digested with DNase I (Takara). Five micrograms of total RNA was reverse-transcribed using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA) and random primers (Takara). Degenerated primers for RT-PCR were designed on the basis of alignment with the mouse, Xenopus and carp D2 dopamine receptor mRNA sequences (Table 1). PCR amplifications were performed with Ex Taq DNA polymerase (Takara). PCR was performed with D2-S1 primer and D2-A1 primer. The PCR cycling conditions consisted of denaturation at 94 °C for 5 min, followed by 40 cycles at 94 °C for 30 s (denaturation), 56 °C for 30 s (annealing), and 72 °C for 1 min (elongation). The sequences of the PCR products of the expected size were analyzed by Takara Dragon Genomics Center (Mie, Japan). Furthermore, the PCR products were excised, purified using Quantum prep freeze’N squeeze DNA gel extraction spin columns (Bio-Rad, Hercules, CA), and subcloned into the pT7 blue T-vector (Novagen, Darmstadt, Germany). In order to confirm the nucleotide sequences validity, the sequences of the nucleotides derived from at least five independent clones were repeatedly analyzed on an ABI Prism 3100/3100-Avant genetic analyzer (Applied Biosystems, Tokyo, Japan). The unknown sequences including 50 - and 30 -untranslated regions were analyzed by 50 -, 30 -rapid amplification of cDNA ends (RACE). 50 RACE was performed using the 50 -RACE System for Rapid Amplification of cDNA Ends Reagent Assembly, version 2.0 (Gibco BRL, CarlsTable 1 Oligonucleotide sequences of primers used for RT-PCR and RACE. Name
Oligonucleotide sequence (50 -30 )
D2-S1 D2-A1 sD2-A1 sD2-A2 sD2-S1 sD2-S2 50 -RACE abridged anchor primer Abridged universal amplification primer Adaptor-dT primer 30 -RACE adaptor primer sD2-S3 sD2-A3
CATCAGCATYGACAGGTACA AGCCAHGTGAMGGCRYTGTA ACAGTCACTCTTCGCTTGGAACTG GGCATTGCCACTGCTGTATACCTG GCTTCTCCAGACCACCAACA CATCTGGCAGTGCCAGCAAC GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG GGCCACGCGTCGACTAGTAC GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT GGCCACGCGTCGACTAGTAC ATAGTTCTGCGAAAGCGAAG GACATCATCTCCATCTCCAT
bad, CA). Total RNA was extracted from the distal lobes of the pituitary using RNAiso (Takara) according to the manufacturer’s instructions. Total RNA (1.5 lg) was reverse-transcribed with the gene-specific primer (sD2-A1), and single-strand cDNA was subsequently obtained by the application of RNase H (Takara). Poly(C) was added to the 30 terminal of the single-strand cDNA by terminal deoxynucleotidyl transferase (Takara), followed by the first-round PCR with the adaptor sequence-added poly(G) (50 -RACE abridged anchor primer) and sD2-A1 primer using the poly(C)-bound (tailed) single-strand cDNA as the template. The second-round PCR was performed with the adaptor primer (abridged universal amplification primer) and the gene-specific primer (sD2-A2), using the diluted firstround PCR product as the template. The conditions for the first- and second-round PCR consisted of 30 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min. The first-strand cDNA for 30 -RACE was synthesized using the adaptor-(dT)17 primer, and first-round PCR was performed with the gene-specific primer (sD2-S1) and 30 -RACE adaptor primer. The second-round PCR was performed with the gene-specific primer (sD2-S2) and 30 -RACE adaptor primer, using the diluted first-round PCR product as the template. The conditions for the firstand second-round PCR consisted of 30 cycles at 94 °C for 30 s, 55 °C (for first-round) or 60 °C (for second-round) for 30 s, and 72 °C for 2 min. RACE products of the expected sizes were subcloned into the pT7 blue T-vector. Nucleotide sequences of the products obtained by RACE were analyzed by the same procedure described above. 2.3. Sequence analysis The CLUSTAL X program (version 1.83) (Thompson et al., 1997) was used with the default settings adjusted to align the deduced amino acid sequences of the vertebrate D2 dopamine receptors. Putative transmembrane domains and N-linked glycosylation sites were predicted using the CBS prediction servers (http://www.cbs. dtu.dk/services/). 2.4. Phylogenetic analysis The full-length amino acid sequences of bullfrog D2A dopamine receptor and those of other vertebrates were aligned using CLUSTAL X with the default settings. The alignment of the amino acid sequences were used to generate a phylogenetic tree, which was then constructed using the neighbor-joining method using the default settings in CLUSTAL X. The data were re-sampled by 1000 bootstrap replicates to determine the confidence indices within the phylogenetic tree. 2.5. Organ and tissue distribution of bullfrog D2 dopamine receptor mRNAs The distribution of the D2 dopamine receptor mRNA in various organs and tissues of adult bullfrogs was analyzed by RT-PCR. Five micrograms of total RNA from each organ or tissue was reversetranscribed as described above. The cDNA thus obtained was then used as a template for PCR, which was carried out using bullfrog D2 dopamine receptor-specific primers (sD2-S3/sD2-A3 see Table 1). The PCR conditions consisted of 32 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min. 3. Results 3.1. Cloning and sequence analysis of three isoforms of the bullfrog D2 dopamine receptor A cDNA fragment spanning about 880 bp (D2-S1/D2-A1) was obtained by RT-PCR. The bullfrog D2 dopamine receptor cDNA
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
containing the complete open reading frame was then obtained by 50 - and 30 -RACE. The cDNA was 1806 bp-long, and the deduced amino acid sequence spanned 444 amino acids (bfD2A: GenBank Accession No. AB440160) (Fig. 1). The deduced amino acid sequence of the bfD2A was aligned with the sequence of X. laevis, rat, turkey and tilapia D2 dopamine receptors for comparison (Fig. 2). The bfD2A amino acid sequence exhibited a high similarity with the D2 dopamine receptor of Xenopus (86.9%), rat (75.5%), turkey (75.0%) and tilapia (75.0%) counterparts. On the other hand, 50.7% and 33.6% similarities were observed with the rat D3 and D4 dopamine receptors, respectively, and approximately about 25% similarity with the rat D1 and D5 dopamine receptors. Hydrophobicity analysis of the bfD2A amino acid sequence revealed the existence of seven hydrophobic domains that most likely correspond to putative membrane-spanning regions (Figs. 1 and 2). The bullfrog D2A dopamine receptor
145
contained 4 potential N-linked glycosylation sites in the extracellular domain (Fig. 1). RT-PCR and subsequent nucleotide sequence analysis of the bullfrog pituitary showed the presence of two predicted D2 dopamine receptor isoforms. These isoforms lacked 12 and 99 nucleotides of the coding region for bfD2A, resulting in deletion of 4 and 33 amino acids residues from those of bfD2A, and putative formation of truncated bfD2B (440 amino acids: GenBank Accession No. AB539814) and bfD2C (411 amino acids: GenBank Accession No. AB539815), respectively (Fig. 1). Results of the repeated analyses of at least five independent clones were consistent. 3.2. Phylogenetic tree Based on the amino acid sequences of the vertebrate dopamine receptors, an unrooted phylogenetic tree was constructed using
Fig. 1. Nucleotide and deduced amino acid sequences of bullfrog D2 dopamine receptor. The cDNA of bfD2A is 1806-bp long and its deduced amino acid sequence spans 444 amino acids. Deletions in the putative bfD2B and bfD2C receptor sequences are underlined with a dotted line and a dashed line, respectively. The numbering of the deduced amino acid sequence begins with the first methionine of the open reading frame, and is shown to the right of each line. The nucleotide numbers are shown to the left of each line. The putative transmembrane domains are underlined with solid lines, and the potential N-linked glycosylation sites appear as in white letters. The sequence has been deposited in the GenBank nucleotide database, under Accession Nos. AB440160 (bfD2A), AB539814 (bfD2B) and AB539815 (bfD2C). The gene-specific primers used in the analysis of the bullfrog D2 dopamine receptor mRNA distribution are indicated by boxes.
146
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Fig. 2. Amino acid alignment of bullfrog D2A dopamine receptor with those from other vertebrates. Dashed amino acids represent residues that are conserved in all the compared sequences, and gaps introduced for optimal alignment are indicated by dots. The putative transmembrane domains are indicated by boxes and numbered (TM I– TM VII). The accession numbers: Xenopus D2R, NM_001101742; Rat D2R, NM_012547; Turkey D2R, AF056201; Tilapia D2R, AY673985.
the neighbor-joining method (Fig. 3). The constructed tree showed the existence of two major dopamine receptor subclasses: the D1like (D1 and D5) and the D2-like (D2, D3 and D4) receptors. This phylogenetic tree revealed that the bullfrog D2A dopamine receptor was clearly aligned with the sequence of the vertebrate D2 dopamine receptor cloned until date (Fig. 3). 3.3. Organ and tissue distribution of bullfrog D2 dopamine receptor mRNAs In order to gain some insights into the functions of the three D2 dopamine receptor isoforms, the mRNA expression patterns of the three isoforms in various organs and tissues were analyzed by RTPCR using gene-specific primers (see Table 1 and Fig. 1). All the three cloned isoform mRNAs were expressed in the brain as well as the distal and neurointermediate lobes of the pituitary. However, bfD2A and putative bfD2B mRNAs were scarcely expressed in the peripheral organs and tissues such as heart, lung, liver, kidney, stomach, intestine, urinary bladder, testis, dorsal skin, ventral skin and ovary, whereas putative bfD2C mRNA was invariably expressed in these organs and tissues (Fig. 4).
4. Discussion In this experiment, the bullfrog D2 dopamine receptor cDNA containing open reading frame and its additional two isoform cDNAs were cloned. This is the first report of the presence of mRNAs for two D2L-like isoforms and one D2S-like isoform in a single species. The deduced amino acid sequence of bullfrog D2 dopamine receptor exhibited properties of the rhodopsin family of G protein-coupled receptor. It has been reported that the rhodopsin family has several characteristics such as NSxxNPxxY motif in seventh transmembrane domain (TM VII), the DRY motif at the border between TM III and second intracellular loop (IL2) (Fredriksson et al., 2003). In the bullfrog D2 dopamine receptor cloned in this study, we could recognize NSAVNPIIY sequence in TM VII and DRY sequence at the border between TM III and IL2. On the putative second and the third extracellular loops, the receptor possesses two conserved cysteine residues, which have been suggested to form an intramolecular disulfide bond to stabilize the receptor conformation (Missale et al., 1998). Four amino acid residues (Asp74, Asp108, Ser188 and Ser191) that correspond to those identified on the transmembrane domain of human D2 dopamine
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Fig. 3. Unrooted phylogenetic tree of dopamine receptors. The neighbor-joining method was used to construct the phylogenetic tree. Data were re-sampled by 1000 bootstrap replicates to determine the confidence indices within the phylogenetic tree. The scale bar refers to a phylogenetic distance of 0.1 amino acid substitution per site. The position of the bullfrog D2A dopamine receptor is indicated by box.
Fig. 4. Distribution of mRNAs of three isoforms of bullfrog D2 dopamine receptor in various organs and tissues. PCR products were analyzed by electrophoresis on a 3% TBE agarose gel with ethidium bromide staining. Putative bfD2C mRNA was widely expressed in all of the organs and tissues examined, whereas bfD2A and putative bfD2B mRNAs were predominantly expressed in the brain and the pituitary gland.
receptor were conserved in the bullfrog D2 dopamine receptor. This domain has been presumed to be involved in binding to dopamine (Javitch et al., 1994). In mammals and birds, it is known that two isoforms (D2L and D2S) of dopamine receptors exist and that D2S subtype is generated by alternative splicing (Giros et al., 1989; Monsma et al., 1989; Schnell et al., 1999). In the D2S subtype, exon 5 is spliced out, whereas this exon is retained in the D2L subtype. The alignment analysis indicated that putative bfD2C isoform is homologous to D2S receptor subtype. Although there is no evidence that putative bfD2C isoform is produced as a result of alternative splicing, it is reasonable to consider this isoform as a homologue of mammalian and avian D2S subtype. On the other hand, both bfD2A and bfD2B isoforms seem to be close to D2L subtype. In Xenopus and some species of teleosts, D2 dopamine receptor has been cloned, but the isoform homologous to D2S subtype has never been identified (Martens et al., 1991, 1993; Boehmler et al., 2004; Levavi-Sivan
147
et al., 2005). Instead, two isoforms of D2 dopamine receptor that are very similar to bfD2A and putative bfD2B have been isolated in Xenopus (Martens et al., 1993). Considering that the terrestrial animals possess both D2L and D2S subtypes and the aquatic animals possess only the isoforms homologous to D2L subtype, it is of interest to note that the bullfrog, which spends both terrestrial and aquatic lives, has D2S-like isoform in addition to two D2L-like isoforms. Further analysis of expression pattern of D2 receptor subtypes in terrestrial, aquatic and terrestrial/aquatic types of amphibians is awaited. The importance of alternative splicing of GPCRs in terms of the tissue- or cell-specific expression pattern has been well established. In mammals, D2S subtype exhibits a predominant presynaptic localization and functions as an autoreceptor, which regulates dopamine release, whereas D2L subtype is postsynaptically situated and considered to mediate some physiological functions (Montmayeur et al., 1991; Khan et al., 1998; Usiello et al., 2000). In vitro study using the NG108–15 cells illustrated that exon 5, which is spliced out in the D2S subtype, is involved in the differential subcellular distribution of the D2L and D2S subtype (Takeuchi and Fukunaga, 2003). However, the existence of D2S subtype has not been observed in Xenopus and teleosts, the role of exon 5 in trafficking of D2 dopamine receptor is unclear in lower vertebrates. The sequence responsible for generating isoforms of bullfrog D2 dopamine receptor is present in the third intracellular loop between TM V and TM VI. This third intracellular loop has been shown to play an important role in the coupling with G protein (Giros et al., 1989; Monsma et al., 1989; O’Dowd et al., 1990). Although, the physiological significance of difference between D2L and D2S subtypes has not been elucidated, the disparity in the selectivity for the Gia subtype coupling with each of these receptor subtypes has been reported (Montmayeur et al., 1993; Guiramand et al., 1995). Therefore, the possibility of differences in the selectivity for Gia subtype among the three isoforms of bullfrog D2 dopamine receptor cloned by the present experiment is inferred. In the present study, the expression of the bullfrog D2 dopamine receptor mRNAs in organs and tissues was analyzed by RTPCR. In the brain and the distal and neurointermediate lobes of the pituitary, the expression of the three isoform mRNAs was observed. On the other hand, in the peripheral organs and tissues, putative bfD2C mRNA was predominantly expressed and was scarcely observed for bfD2A and putative bfD2B. From the marked difference in the distribution of the D2 dopamine receptor isoform mRNAs between the central and peripheral organs and tissues, it is suggested that the coupling to G protein and subsequent intracellular signal transduction will be different among the isoforms of bullfrog D2 dopamine receptor. In this study, we cloned three distinct cDNAs for isoforms of D2 dopamine receptor from the bullfrog. Comparison of the amino acid sequences of these isoforms with those of other vertebrates revealed that bfD2A and putative bfD2B are very similar to two isoforms of Xenopus D2 dopamine receptor and homologous to mammalian and avian D2L subtype, whereas putative bfD2C is close to D2S subtype cloned in mammals and birds. The finding in the bullfrog indicates that this species possesses three isoforms, namely, two D2L-like isoforms and one D2S-like isoform. We also showed that the distribution of these isoform mRNAs is different between the central and peripheral organs and tissues. At present, it is not clear, however, whether these isoform mRNAs are invariably translated into receptor proteins. The differences in selectivity for Gia subtype or subsequent intracellular signal transduction and eventual physiological functions of each D2 dopamine receptor isoform are remained to be investigated. We consider that bullfrog is a good model for studying the functional differences among the D2 dopamine receptor isoforms and their molecular evolution.
148
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Acknowledgments This study was supported by research grants from Saitama University to T.K. and T.M. and from JSPS (21570071) to S.K. References Ben-Jonathan, N., 1985. Dopamine: a prolactin-inhibiting hormone. Endocr. Rev. 6, 564–589. Boehmler, W., Obrecht-Pflumio, S., Canfield, V., Thisse, C., Thisse, B., Levenson, R., 2004. Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish. Dev. Dyn. 230, 481–493. Civelli, O., Bunzow, J.R., Grandy, D.K., Zhou, Q.Y., Van Tol, H.H., 1991. Molecular biology of the dopamine receptors. Eur. J. Pharmacol. 207, 277–286. Fredriksson, R., Lagerström, M.C., Lundin, L.G., Schiöth, H.B., 2003. The G-proteincoupled receptors in the human genome form five main families phylogenetic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256–1272. Giros, B., Sokoloff, P., Martres, M.P., Riou, J.F., Emorine, L.J., Schwartz, J.C., 1989. Alternative splicing directs the expression of two D2 dopamine receptor isoforms. Nature 342, 923–926. González, A., Tuinhof, R., Smeets, W.J., 1993. Distribution of tyrosine hydroxylase and dopamine immunoreactivities in the brain of the South African clawed frog Xenopus laevis. Anat. Embryol. (Berl). 187, 193–201. Guiramand, J., Montmayeur, J.P., Ceraline, J., Bhatia, M., Borrelli, E., 1995. Alternative splicing of the dopamine D2 receptor directs specificity of coupling to Gproteins. J. Biol. Chem. 270, 7354–7358. Javitch, J.A., Li, X., Kaback, J., Karlin, A., 1994. A cysteine residue in the third membrane-spanning segment of the human D2 dopamine receptor is exposed in the binding-site crevice. Proc. Natl. Acad. Sci. USA 91, 10355–10359. Khan, Z.U., Mrzljak, L., Gutierrez, A., de la Calle, A., Goldman-Rakic, P.S., 1998. Prominence of the dopamine D2 short isoform in dopaminergic pathways. Proc. Natl. Acad. Sci. USA 95, 7731–7736. Kikuyama, S., Miyakawa, M., Arai, Y., 1979. Influence of thyroid hormone on the development of peoptic-hypothalamic monoaminergic neurons in tadpoles of Bufo bufo japonicus. Cell. Tissue Res. 198, 27–33. Kikuyama, S., Seki, T., 1980. Possible involvement of dopamine in the release of prolactin-like hormone from bullfrog pituitary gland. Gen. Comp. Endocrinol. 41, 173–179. Kouki, T., Kawamura, K., Kikuyama, S., 1998. Developmental studies for identification of the inhibitory center of melanotropes in the toad, Bufo japonicus. Dev. Growth Differ. 40, 651–658. Levavi-Sivan, B., Aizen, J., Avitan, A., 2005. Cloning, characterization and expression of the D2 dopamine receptor from the tilapia pituitary. Mol. Cell Endocrinol. 236, 17–30. Martens, G.J., Molhuizen, H.O., Gröneveld, D., Roubos, E.W., 1991. Cloning and sequence analysis of brain cDNA encoding a Xenopus D2 dopamine receptor. FEBS. Lett. 281, 85–89.
Martens, G.J., Groenen, P.M., Gröneveld, D., Van Riel, M.C., 1993. Expression of the Xenopus D2 dopamine receptor tissue-specific regulation and two transcriptionally active genes but no evidence for alternative splicing. Eur. J. Biochem. 213, 1349–1354. Missale, C., Nash, S.R., Robinson, S.W., Jaber, M., Caron, M.G., 1998. Dopamine receptors: from structure to function. Physiol. Rev. 78, 189–225. Monsma, F.J.Jr., McVittie, L.D., Gerfen, C.R., Mahan, L.C., Sibley, D.R., 1989. Multiple D2 dopamine receptors produced by alternative RNA splicing. Nature 342, 926– 929. Montmayeur, J.P., Bausero, P., Amlaiky, N., Maroteaux, L., Hen, R., Borrelli, E., 1991. Differential expression of the mouse D2 dopamine receptor isoforms. FEBS. Lett. 278, 239–243. Montmayeur, J.P., Guiramand, J., Borrelli, E., 1993. Preferential coupling between dopamine D2 receptors and G-proteins. Mol. Endocrinol. 7, 161–170. Nakano, M., Hasunuma, I., Okada, R., Yamamoto, K., Kikuyama, S., Kobayashi, T., Machida, T., 2007. Involvement of D2 dopamine receptor subtype in inhibition of prolactin release from the bullfrog pituitary gland. Proc. Jpn. Soc. Comp. Endocrinol. 22, 79. O’Dowd, B.F., Nguyen, T., Tirpak, A., Jarvie, K.R., Israel, Y., Seeman, P., Niznik, H.B., 1990. Cloning of two additional catecholamine receptors from rat brain. FEBS. Lett. 262, 8–12. Prasada Rao, P.D., Hartwig, H.G., 1974. Monoaminergic tracts of the diencephalon and innervation of the pars intermedia in Rana temporaria a fluorescence and microspectrofluorimetric study. Cell. Tissue. Res. 151, 1–26. Schnell, S.A., You, S., Foster, D.N., El Halawani, M.E., 1999. Molecular cloning and tissue distribution of an avian D2 dopamine receptor mRNA from the domestic turkey (Maleagris gallopavo). J. Comp. Neurol. 407, 543–554. Seki, T., Kikuyama, S., 1982. In vitro studies on the regulation of prolactin secretion in the bullfrog pituitary gland. Gen. Comp. Endocrinol. 46, 473–479. Seki, T., Kikuyama, S., 1986. Effect of thyrotropin-releasing hormone and dopamine on the in vitro secretion of prolactin by the bullfrog pituitary gland. Gen. Comp. Endocrinol. 61, 197–202. Takeuchi, Y., Fukunaga, K., 2003. Differential subcellular localization of two dopamine D2 receptor isoforms in transfected NG108–15 cells. J. Neurochem. 85, 1064–1074. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface. flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Tuinhof, R., Artero, C., Fasolo, A., Franzoni, M.F., Ten Donkelaar, H.J., Wismans, P.G., Roubos, E.W., 1994. Involvement of retinohypothalamic input, suprachiasmatic nucleus, magnocellular nucleus and locus coeruleus in control of melanotrope cells of Xenopus laevis: a retrograde and anterograde tracing study. Neuroscience 61, 411–420. Ubink, R., Tuinhof, R., Roubos, E.W., 1998. Identification of suprachiasmatic melanotrope-inhibiting neurons in Xenopus laevis: a confocal laser-scanning microscopy study. J. Comp. Neurol. 397, 60–68. Usiello, A., Baik, J.H., Rougé-Pont, F., Picetti, R., Dierich, A., LeMeur, M., Piazza, P.V., Borrelli, E., 2000. Distinct functions of the two isoforms of dopamine D2 receptors. Nature 408, 199–203.
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Molecular cloning of bullfrog D2 dopamine receptor cDNA: Tissue distribution of three isoforms of D2 dopamine receptor mRNA Masaki Nakano a, Itaru Hasunuma b, Reiko Okada a,c, Kazutoshi Yamamoto b, Sakae Kikuyama b, Takeo Machida a, Tetsuya Kobayashi a,* a b c
Division of Life Science, Graduate School of Science and Engineering, Saitama University, Saitama 338-8570, Japan Department of Biology, Faculty of Education and Integrated Arts and Sciences, Waseda University, Tokyo 162-8480, Japan Integrated Bioscience Section, Graduate School of Science and Technology, Shizuoka University, Shizuoka 422-8529, Japan
a r t i c l e
i n f o
Article history: Received 8 February 2010 Revised 24 March 2010 Accepted 20 April 2010 Available online 22 April 2010 Keywords: Dopamine D2 receptor Isoform Bullfrog
a b s t r a c t The cDNA encoding D2 dopamine receptor was cloned from the distal lobe of the bullfrog pituitary. The deduced amino acid sequence of the bullfrog D2 dopamine receptor (bfD2A) spanned 444 amino acids and exhibited typical features of those of D2 dopamine receptors cloned in other animals to date. It showed a high similarity of 75–87% with rat, turkey, Xenopus and tilapia counterparts. Further analysis of nucleotide sequence of the cDNA revealed the presence of putative truncated D2 dopamine receptor isoforms, bfD2B and bfD2C, of which nucleotide sequences lacked 12 and 99 nucleotides of the coding region for bfD2A, respectively. The alignment analysis indicated that putative bfD2C isoform was close to D2S subtype cloned in mammals and birds, whereas bfD2A and putative bfD2B isoforms were close to mammalian and avian D2L subtype and homologous to two isoforms of Xenopus. This is the first report of the presence of mRNAs for two D2L-like isoforms and one D2S-like isoform in a single species. The amino acid sequence responsible for producing isoforms is present in the third intracellular loop, which has been shown to play an important role in the coupling with G protein. Accordingly, differences in the mode of coupling with G protein among three isoforms were suggested. The expression of three isoforms mRNA in organs and tissues was analyzed by RT-PCR. In the brain, pars distalis and pars neurointermedia, mRNAs for three isoforms were invariably expressed, whereas only putative bfD2C mRNA was expressed in peripheral organs and tissues. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Dopamine is a ubiquitous neurotransmitter found in both the central and peripheral nervous systems in various species of animals. It is involved in a wide variety of behavioral and physiological functions, and is known to regulate the hypothalamo-pituitary axis (Ben-Jonathan, 1985; Missale et al., 1998). The transduction of dopaminergic signals is mediated by several subtypes of G proteincoupled receptors. These receptors are divided into two major subclasses: the D1-like (D1 and D5) and the D2-like (D2, D3 and D4) receptors, and are further characterized by their ability to stimulate or inhibit adenylate cyclase activity (Civelli et al., 1991; Missale et al., 1998). In mammals, dopamine released from the hypothalamic tuberoinfundibular neurons serves as the physiological inhibitor of prolactin (PRL) secretion, and this function is mediated through D2 dopamine receptors residing on the pituitary lactotroph membranes (Ben-Jonathan, 1985). In amphibians, the distribution of * Corresponding author. Fax: +81 48 858 3419. E-mail address: [email protected] (T. Kobayashi). 0016-6480/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2010.04.016
dopaminergic neurons has been studied in the diencephalon of various species such as Rana temporaria (Prasada Rao and Hartwig, 1974), Bufo japonicus (Kikuyama et al., 1979; Kouki et al., 1998) and Xenopus laevis (González et al., 1993). All these studies revealed that dopamine-containing cells exist mainly in the preoptic recess organ (PRO), the paraventricular organ (PVO) and the dorsal infundibular nucleus (DIN). These neurons send their projections toward the median eminence (ME) terminate around the capillaries of ME or in the intermediate lobe of the pituitary. Dopaminergic cells in the suprachiasmatic nucleus in Xenopus (Tuinhof et al., 1994; Ubink et al., 1998) and in the rostral PRO in Bufo (Kouki et al., 1998) have been demonstrated to exert an inhibitory effect on the release of a-melanophore-stimulating hormone. Like in mammals, dopamine also inhibits the release of PRL from the distal lobe of pituitary in amphibians as examined with the bullfrog (R. catesbeiana) in vivo (Kikuyama and Seki, 1980) and in vitro (Seki and Kikuyama, 1982, 1986), although the hypothalamic center responsible for the inhibition of PRL secretion is not clear. We have recently demonstrated that in amphibians, like in mammals, the inhibitory effect of dopamine on the PRL release from the pituitary gland is mediated by D2 dopamine receptors (Nakano et al., 2007).
144
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
As a step to investigate further the physiological functions of D2 dopamine receptors in amphibians, an attempt was made to obtain D2 dopamine receptor cDNAs from the bullfrog. Here we report the sequences for bullfrog D2 dopamine receptor and its two predicted isoforms, and the distribution of these isoform mRNAs in several organs and tissues of adult bullfrogs. 2. Materials and methods 2.1. Animals Bullfrogs ( R. catesbeiana) of both sexes were purchased from Ohuchi Aquatic Animal Supply (Saitama, Japan), and kept in a tank maintained at 23 °C under a 12/12-h (light/dark) photo-cycle. All experimental procedures were conducted in accordance with the ‘‘Institutional Guidelines for Animal Care and Use” of Saitama University (Saitama, Japan). 2.2. Cloning of bullfrog D2 dopamine receptor cDNA D2 dopamine receptor cDNA fragments of the bullfrog were obtained by the use of reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was extracted from the distal lobes of the bullfrog pituitary using RNAiso (Takara, Shiga, Japan), in accordance with the manufacturer’s instructions. Genomic DNA contaminating the total RNA sample was digested with DNase I (Takara). Five micrograms of total RNA was reverse-transcribed using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA) and random primers (Takara). Degenerated primers for RT-PCR were designed on the basis of alignment with the mouse, Xenopus and carp D2 dopamine receptor mRNA sequences (Table 1). PCR amplifications were performed with Ex Taq DNA polymerase (Takara). PCR was performed with D2-S1 primer and D2-A1 primer. The PCR cycling conditions consisted of denaturation at 94 °C for 5 min, followed by 40 cycles at 94 °C for 30 s (denaturation), 56 °C for 30 s (annealing), and 72 °C for 1 min (elongation). The sequences of the PCR products of the expected size were analyzed by Takara Dragon Genomics Center (Mie, Japan). Furthermore, the PCR products were excised, purified using Quantum prep freeze’N squeeze DNA gel extraction spin columns (Bio-Rad, Hercules, CA), and subcloned into the pT7 blue T-vector (Novagen, Darmstadt, Germany). In order to confirm the nucleotide sequences validity, the sequences of the nucleotides derived from at least five independent clones were repeatedly analyzed on an ABI Prism 3100/3100-Avant genetic analyzer (Applied Biosystems, Tokyo, Japan). The unknown sequences including 50 - and 30 -untranslated regions were analyzed by 50 -, 30 -rapid amplification of cDNA ends (RACE). 50 RACE was performed using the 50 -RACE System for Rapid Amplification of cDNA Ends Reagent Assembly, version 2.0 (Gibco BRL, CarlsTable 1 Oligonucleotide sequences of primers used for RT-PCR and RACE. Name
Oligonucleotide sequence (50 -30 )
D2-S1 D2-A1 sD2-A1 sD2-A2 sD2-S1 sD2-S2 50 -RACE abridged anchor primer Abridged universal amplification primer Adaptor-dT primer 30 -RACE adaptor primer sD2-S3 sD2-A3
CATCAGCATYGACAGGTACA AGCCAHGTGAMGGCRYTGTA ACAGTCACTCTTCGCTTGGAACTG GGCATTGCCACTGCTGTATACCTG GCTTCTCCAGACCACCAACA CATCTGGCAGTGCCAGCAAC GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG GGCCACGCGTCGACTAGTAC GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT GGCCACGCGTCGACTAGTAC ATAGTTCTGCGAAAGCGAAG GACATCATCTCCATCTCCAT
bad, CA). Total RNA was extracted from the distal lobes of the pituitary using RNAiso (Takara) according to the manufacturer’s instructions. Total RNA (1.5 lg) was reverse-transcribed with the gene-specific primer (sD2-A1), and single-strand cDNA was subsequently obtained by the application of RNase H (Takara). Poly(C) was added to the 30 terminal of the single-strand cDNA by terminal deoxynucleotidyl transferase (Takara), followed by the first-round PCR with the adaptor sequence-added poly(G) (50 -RACE abridged anchor primer) and sD2-A1 primer using the poly(C)-bound (tailed) single-strand cDNA as the template. The second-round PCR was performed with the adaptor primer (abridged universal amplification primer) and the gene-specific primer (sD2-A2), using the diluted firstround PCR product as the template. The conditions for the first- and second-round PCR consisted of 30 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min. The first-strand cDNA for 30 -RACE was synthesized using the adaptor-(dT)17 primer, and first-round PCR was performed with the gene-specific primer (sD2-S1) and 30 -RACE adaptor primer. The second-round PCR was performed with the gene-specific primer (sD2-S2) and 30 -RACE adaptor primer, using the diluted first-round PCR product as the template. The conditions for the firstand second-round PCR consisted of 30 cycles at 94 °C for 30 s, 55 °C (for first-round) or 60 °C (for second-round) for 30 s, and 72 °C for 2 min. RACE products of the expected sizes were subcloned into the pT7 blue T-vector. Nucleotide sequences of the products obtained by RACE were analyzed by the same procedure described above. 2.3. Sequence analysis The CLUSTAL X program (version 1.83) (Thompson et al., 1997) was used with the default settings adjusted to align the deduced amino acid sequences of the vertebrate D2 dopamine receptors. Putative transmembrane domains and N-linked glycosylation sites were predicted using the CBS prediction servers (http://www.cbs. dtu.dk/services/). 2.4. Phylogenetic analysis The full-length amino acid sequences of bullfrog D2A dopamine receptor and those of other vertebrates were aligned using CLUSTAL X with the default settings. The alignment of the amino acid sequences were used to generate a phylogenetic tree, which was then constructed using the neighbor-joining method using the default settings in CLUSTAL X. The data were re-sampled by 1000 bootstrap replicates to determine the confidence indices within the phylogenetic tree. 2.5. Organ and tissue distribution of bullfrog D2 dopamine receptor mRNAs The distribution of the D2 dopamine receptor mRNA in various organs and tissues of adult bullfrogs was analyzed by RT-PCR. Five micrograms of total RNA from each organ or tissue was reversetranscribed as described above. The cDNA thus obtained was then used as a template for PCR, which was carried out using bullfrog D2 dopamine receptor-specific primers (sD2-S3/sD2-A3 see Table 1). The PCR conditions consisted of 32 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min. 3. Results 3.1. Cloning and sequence analysis of three isoforms of the bullfrog D2 dopamine receptor A cDNA fragment spanning about 880 bp (D2-S1/D2-A1) was obtained by RT-PCR. The bullfrog D2 dopamine receptor cDNA
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
containing the complete open reading frame was then obtained by 50 - and 30 -RACE. The cDNA was 1806 bp-long, and the deduced amino acid sequence spanned 444 amino acids (bfD2A: GenBank Accession No. AB440160) (Fig. 1). The deduced amino acid sequence of the bfD2A was aligned with the sequence of X. laevis, rat, turkey and tilapia D2 dopamine receptors for comparison (Fig. 2). The bfD2A amino acid sequence exhibited a high similarity with the D2 dopamine receptor of Xenopus (86.9%), rat (75.5%), turkey (75.0%) and tilapia (75.0%) counterparts. On the other hand, 50.7% and 33.6% similarities were observed with the rat D3 and D4 dopamine receptors, respectively, and approximately about 25% similarity with the rat D1 and D5 dopamine receptors. Hydrophobicity analysis of the bfD2A amino acid sequence revealed the existence of seven hydrophobic domains that most likely correspond to putative membrane-spanning regions (Figs. 1 and 2). The bullfrog D2A dopamine receptor
145
contained 4 potential N-linked glycosylation sites in the extracellular domain (Fig. 1). RT-PCR and subsequent nucleotide sequence analysis of the bullfrog pituitary showed the presence of two predicted D2 dopamine receptor isoforms. These isoforms lacked 12 and 99 nucleotides of the coding region for bfD2A, resulting in deletion of 4 and 33 amino acids residues from those of bfD2A, and putative formation of truncated bfD2B (440 amino acids: GenBank Accession No. AB539814) and bfD2C (411 amino acids: GenBank Accession No. AB539815), respectively (Fig. 1). Results of the repeated analyses of at least five independent clones were consistent. 3.2. Phylogenetic tree Based on the amino acid sequences of the vertebrate dopamine receptors, an unrooted phylogenetic tree was constructed using
Fig. 1. Nucleotide and deduced amino acid sequences of bullfrog D2 dopamine receptor. The cDNA of bfD2A is 1806-bp long and its deduced amino acid sequence spans 444 amino acids. Deletions in the putative bfD2B and bfD2C receptor sequences are underlined with a dotted line and a dashed line, respectively. The numbering of the deduced amino acid sequence begins with the first methionine of the open reading frame, and is shown to the right of each line. The nucleotide numbers are shown to the left of each line. The putative transmembrane domains are underlined with solid lines, and the potential N-linked glycosylation sites appear as in white letters. The sequence has been deposited in the GenBank nucleotide database, under Accession Nos. AB440160 (bfD2A), AB539814 (bfD2B) and AB539815 (bfD2C). The gene-specific primers used in the analysis of the bullfrog D2 dopamine receptor mRNA distribution are indicated by boxes.
146
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Fig. 2. Amino acid alignment of bullfrog D2A dopamine receptor with those from other vertebrates. Dashed amino acids represent residues that are conserved in all the compared sequences, and gaps introduced for optimal alignment are indicated by dots. The putative transmembrane domains are indicated by boxes and numbered (TM I– TM VII). The accession numbers: Xenopus D2R, NM_001101742; Rat D2R, NM_012547; Turkey D2R, AF056201; Tilapia D2R, AY673985.
the neighbor-joining method (Fig. 3). The constructed tree showed the existence of two major dopamine receptor subclasses: the D1like (D1 and D5) and the D2-like (D2, D3 and D4) receptors. This phylogenetic tree revealed that the bullfrog D2A dopamine receptor was clearly aligned with the sequence of the vertebrate D2 dopamine receptor cloned until date (Fig. 3). 3.3. Organ and tissue distribution of bullfrog D2 dopamine receptor mRNAs In order to gain some insights into the functions of the three D2 dopamine receptor isoforms, the mRNA expression patterns of the three isoforms in various organs and tissues were analyzed by RTPCR using gene-specific primers (see Table 1 and Fig. 1). All the three cloned isoform mRNAs were expressed in the brain as well as the distal and neurointermediate lobes of the pituitary. However, bfD2A and putative bfD2B mRNAs were scarcely expressed in the peripheral organs and tissues such as heart, lung, liver, kidney, stomach, intestine, urinary bladder, testis, dorsal skin, ventral skin and ovary, whereas putative bfD2C mRNA was invariably expressed in these organs and tissues (Fig. 4).
4. Discussion In this experiment, the bullfrog D2 dopamine receptor cDNA containing open reading frame and its additional two isoform cDNAs were cloned. This is the first report of the presence of mRNAs for two D2L-like isoforms and one D2S-like isoform in a single species. The deduced amino acid sequence of bullfrog D2 dopamine receptor exhibited properties of the rhodopsin family of G protein-coupled receptor. It has been reported that the rhodopsin family has several characteristics such as NSxxNPxxY motif in seventh transmembrane domain (TM VII), the DRY motif at the border between TM III and second intracellular loop (IL2) (Fredriksson et al., 2003). In the bullfrog D2 dopamine receptor cloned in this study, we could recognize NSAVNPIIY sequence in TM VII and DRY sequence at the border between TM III and IL2. On the putative second and the third extracellular loops, the receptor possesses two conserved cysteine residues, which have been suggested to form an intramolecular disulfide bond to stabilize the receptor conformation (Missale et al., 1998). Four amino acid residues (Asp74, Asp108, Ser188 and Ser191) that correspond to those identified on the transmembrane domain of human D2 dopamine
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Fig. 3. Unrooted phylogenetic tree of dopamine receptors. The neighbor-joining method was used to construct the phylogenetic tree. Data were re-sampled by 1000 bootstrap replicates to determine the confidence indices within the phylogenetic tree. The scale bar refers to a phylogenetic distance of 0.1 amino acid substitution per site. The position of the bullfrog D2A dopamine receptor is indicated by box.
Fig. 4. Distribution of mRNAs of three isoforms of bullfrog D2 dopamine receptor in various organs and tissues. PCR products were analyzed by electrophoresis on a 3% TBE agarose gel with ethidium bromide staining. Putative bfD2C mRNA was widely expressed in all of the organs and tissues examined, whereas bfD2A and putative bfD2B mRNAs were predominantly expressed in the brain and the pituitary gland.
receptor were conserved in the bullfrog D2 dopamine receptor. This domain has been presumed to be involved in binding to dopamine (Javitch et al., 1994). In mammals and birds, it is known that two isoforms (D2L and D2S) of dopamine receptors exist and that D2S subtype is generated by alternative splicing (Giros et al., 1989; Monsma et al., 1989; Schnell et al., 1999). In the D2S subtype, exon 5 is spliced out, whereas this exon is retained in the D2L subtype. The alignment analysis indicated that putative bfD2C isoform is homologous to D2S receptor subtype. Although there is no evidence that putative bfD2C isoform is produced as a result of alternative splicing, it is reasonable to consider this isoform as a homologue of mammalian and avian D2S subtype. On the other hand, both bfD2A and bfD2B isoforms seem to be close to D2L subtype. In Xenopus and some species of teleosts, D2 dopamine receptor has been cloned, but the isoform homologous to D2S subtype has never been identified (Martens et al., 1991, 1993; Boehmler et al., 2004; Levavi-Sivan
147
et al., 2005). Instead, two isoforms of D2 dopamine receptor that are very similar to bfD2A and putative bfD2B have been isolated in Xenopus (Martens et al., 1993). Considering that the terrestrial animals possess both D2L and D2S subtypes and the aquatic animals possess only the isoforms homologous to D2L subtype, it is of interest to note that the bullfrog, which spends both terrestrial and aquatic lives, has D2S-like isoform in addition to two D2L-like isoforms. Further analysis of expression pattern of D2 receptor subtypes in terrestrial, aquatic and terrestrial/aquatic types of amphibians is awaited. The importance of alternative splicing of GPCRs in terms of the tissue- or cell-specific expression pattern has been well established. In mammals, D2S subtype exhibits a predominant presynaptic localization and functions as an autoreceptor, which regulates dopamine release, whereas D2L subtype is postsynaptically situated and considered to mediate some physiological functions (Montmayeur et al., 1991; Khan et al., 1998; Usiello et al., 2000). In vitro study using the NG108–15 cells illustrated that exon 5, which is spliced out in the D2S subtype, is involved in the differential subcellular distribution of the D2L and D2S subtype (Takeuchi and Fukunaga, 2003). However, the existence of D2S subtype has not been observed in Xenopus and teleosts, the role of exon 5 in trafficking of D2 dopamine receptor is unclear in lower vertebrates. The sequence responsible for generating isoforms of bullfrog D2 dopamine receptor is present in the third intracellular loop between TM V and TM VI. This third intracellular loop has been shown to play an important role in the coupling with G protein (Giros et al., 1989; Monsma et al., 1989; O’Dowd et al., 1990). Although, the physiological significance of difference between D2L and D2S subtypes has not been elucidated, the disparity in the selectivity for the Gia subtype coupling with each of these receptor subtypes has been reported (Montmayeur et al., 1993; Guiramand et al., 1995). Therefore, the possibility of differences in the selectivity for Gia subtype among the three isoforms of bullfrog D2 dopamine receptor cloned by the present experiment is inferred. In the present study, the expression of the bullfrog D2 dopamine receptor mRNAs in organs and tissues was analyzed by RTPCR. In the brain and the distal and neurointermediate lobes of the pituitary, the expression of the three isoform mRNAs was observed. On the other hand, in the peripheral organs and tissues, putative bfD2C mRNA was predominantly expressed and was scarcely observed for bfD2A and putative bfD2B. From the marked difference in the distribution of the D2 dopamine receptor isoform mRNAs between the central and peripheral organs and tissues, it is suggested that the coupling to G protein and subsequent intracellular signal transduction will be different among the isoforms of bullfrog D2 dopamine receptor. In this study, we cloned three distinct cDNAs for isoforms of D2 dopamine receptor from the bullfrog. Comparison of the amino acid sequences of these isoforms with those of other vertebrates revealed that bfD2A and putative bfD2B are very similar to two isoforms of Xenopus D2 dopamine receptor and homologous to mammalian and avian D2L subtype, whereas putative bfD2C is close to D2S subtype cloned in mammals and birds. The finding in the bullfrog indicates that this species possesses three isoforms, namely, two D2L-like isoforms and one D2S-like isoform. We also showed that the distribution of these isoform mRNAs is different between the central and peripheral organs and tissues. At present, it is not clear, however, whether these isoform mRNAs are invariably translated into receptor proteins. The differences in selectivity for Gia subtype or subsequent intracellular signal transduction and eventual physiological functions of each D2 dopamine receptor isoform are remained to be investigated. We consider that bullfrog is a good model for studying the functional differences among the D2 dopamine receptor isoforms and their molecular evolution.
148
M. Nakano et al. / General and Comparative Endocrinology 168 (2010) 143–148
Acknowledgments This study was supported by research grants from Saitama University to T.K. and T.M. and from JSPS (21570071) to S.K. References Ben-Jonathan, N., 1985. Dopamine: a prolactin-inhibiting hormone. Endocr. Rev. 6, 564–589. Boehmler, W., Obrecht-Pflumio, S., Canfield, V., Thisse, C., Thisse, B., Levenson, R., 2004. Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish. Dev. Dyn. 230, 481–493. Civelli, O., Bunzow, J.R., Grandy, D.K., Zhou, Q.Y., Van Tol, H.H., 1991. Molecular biology of the dopamine receptors. Eur. J. Pharmacol. 207, 277–286. Fredriksson, R., Lagerström, M.C., Lundin, L.G., Schiöth, H.B., 2003. The G-proteincoupled receptors in the human genome form five main families phylogenetic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256–1272. Giros, B., Sokoloff, P., Martres, M.P., Riou, J.F., Emorine, L.J., Schwartz, J.C., 1989. Alternative splicing directs the expression of two D2 dopamine receptor isoforms. Nature 342, 923–926. González, A., Tuinhof, R., Smeets, W.J., 1993. Distribution of tyrosine hydroxylase and dopamine immunoreactivities in the brain of the South African clawed frog Xenopus laevis. Anat. Embryol. (Berl). 187, 193–201. Guiramand, J., Montmayeur, J.P., Ceraline, J., Bhatia, M., Borrelli, E., 1995. Alternative splicing of the dopamine D2 receptor directs specificity of coupling to Gproteins. J. Biol. Chem. 270, 7354–7358. Javitch, J.A., Li, X., Kaback, J., Karlin, A., 1994. A cysteine residue in the third membrane-spanning segment of the human D2 dopamine receptor is exposed in the binding-site crevice. Proc. Natl. Acad. Sci. USA 91, 10355–10359. Khan, Z.U., Mrzljak, L., Gutierrez, A., de la Calle, A., Goldman-Rakic, P.S., 1998. Prominence of the dopamine D2 short isoform in dopaminergic pathways. Proc. Natl. Acad. Sci. USA 95, 7731–7736. Kikuyama, S., Miyakawa, M., Arai, Y., 1979. Influence of thyroid hormone on the development of peoptic-hypothalamic monoaminergic neurons in tadpoles of Bufo bufo japonicus. Cell. Tissue Res. 198, 27–33. Kikuyama, S., Seki, T., 1980. Possible involvement of dopamine in the release of prolactin-like hormone from bullfrog pituitary gland. Gen. Comp. Endocrinol. 41, 173–179. Kouki, T., Kawamura, K., Kikuyama, S., 1998. Developmental studies for identification of the inhibitory center of melanotropes in the toad, Bufo japonicus. Dev. Growth Differ. 40, 651–658. Levavi-Sivan, B., Aizen, J., Avitan, A., 2005. Cloning, characterization and expression of the D2 dopamine receptor from the tilapia pituitary. Mol. Cell Endocrinol. 236, 17–30. Martens, G.J., Molhuizen, H.O., Gröneveld, D., Roubos, E.W., 1991. Cloning and sequence analysis of brain cDNA encoding a Xenopus D2 dopamine receptor. FEBS. Lett. 281, 85–89.
Martens, G.J., Groenen, P.M., Gröneveld, D., Van Riel, M.C., 1993. Expression of the Xenopus D2 dopamine receptor tissue-specific regulation and two transcriptionally active genes but no evidence for alternative splicing. Eur. J. Biochem. 213, 1349–1354. Missale, C., Nash, S.R., Robinson, S.W., Jaber, M., Caron, M.G., 1998. Dopamine receptors: from structure to function. Physiol. Rev. 78, 189–225. Monsma, F.J.Jr., McVittie, L.D., Gerfen, C.R., Mahan, L.C., Sibley, D.R., 1989. Multiple D2 dopamine receptors produced by alternative RNA splicing. Nature 342, 926– 929. Montmayeur, J.P., Bausero, P., Amlaiky, N., Maroteaux, L., Hen, R., Borrelli, E., 1991. Differential expression of the mouse D2 dopamine receptor isoforms. FEBS. Lett. 278, 239–243. Montmayeur, J.P., Guiramand, J., Borrelli, E., 1993. Preferential coupling between dopamine D2 receptors and G-proteins. Mol. Endocrinol. 7, 161–170. Nakano, M., Hasunuma, I., Okada, R., Yamamoto, K., Kikuyama, S., Kobayashi, T., Machida, T., 2007. Involvement of D2 dopamine receptor subtype in inhibition of prolactin release from the bullfrog pituitary gland. Proc. Jpn. Soc. Comp. Endocrinol. 22, 79. O’Dowd, B.F., Nguyen, T., Tirpak, A., Jarvie, K.R., Israel, Y., Seeman, P., Niznik, H.B., 1990. Cloning of two additional catecholamine receptors from rat brain. FEBS. Lett. 262, 8–12. Prasada Rao, P.D., Hartwig, H.G., 1974. Monoaminergic tracts of the diencephalon and innervation of the pars intermedia in Rana temporaria a fluorescence and microspectrofluorimetric study. Cell. Tissue. Res. 151, 1–26. Schnell, S.A., You, S., Foster, D.N., El Halawani, M.E., 1999. Molecular cloning and tissue distribution of an avian D2 dopamine receptor mRNA from the domestic turkey (Maleagris gallopavo). J. Comp. Neurol. 407, 543–554. Seki, T., Kikuyama, S., 1982. In vitro studies on the regulation of prolactin secretion in the bullfrog pituitary gland. Gen. Comp. Endocrinol. 46, 473–479. Seki, T., Kikuyama, S., 1986. Effect of thyrotropin-releasing hormone and dopamine on the in vitro secretion of prolactin by the bullfrog pituitary gland. Gen. Comp. Endocrinol. 61, 197–202. Takeuchi, Y., Fukunaga, K., 2003. Differential subcellular localization of two dopamine D2 receptor isoforms in transfected NG108–15 cells. J. Neurochem. 85, 1064–1074. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface. flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Tuinhof, R., Artero, C., Fasolo, A., Franzoni, M.F., Ten Donkelaar, H.J., Wismans, P.G., Roubos, E.W., 1994. Involvement of retinohypothalamic input, suprachiasmatic nucleus, magnocellular nucleus and locus coeruleus in control of melanotrope cells of Xenopus laevis: a retrograde and anterograde tracing study. Neuroscience 61, 411–420. Ubink, R., Tuinhof, R., Roubos, E.W., 1998. Identification of suprachiasmatic melanotrope-inhibiting neurons in Xenopus laevis: a confocal laser-scanning microscopy study. J. Comp. Neurol. 397, 60–68. Usiello, A., Baik, J.H., Rougé-Pont, F., Picetti, R., Dierich, A., LeMeur, M., Piazza, P.V., Borrelli, E., 2000. Distinct functions of the two isoforms of dopamine D2 receptors. Nature 408, 199–203.