Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus

Results in Immunology 2 (2012) 35–43

Contents lists available at SciVerse ScienceDirect

Results in Immunology journal homepage: www.elsevier.com/locate/rinim

Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus ˜ eira c Baskaralingam Vaseeharan a,n, Sathappan Shanthi a, Jiann-Chu Chen b, Montserrat Espin a

Department of Animal Health and Management, Alagappa University, Karaikudi 630 003, Tamil Nadu, India Department of Aquaculture, College of Life Sciences, National Taiwan Ocean University, 202, Keelung, Taiwan, ROC c Department of Area of Molecular Biology and Biotechnology, ANFACO-CECOPESCA, Vigo, 36310 Pontevedra, Spain b

a r t i c l e i n f o

abstract

Article history: Received 28 December 2011 Received in revised form 7 February 2012 Accepted 7 February 2012 Available online 14 February 2012

Penaeidins are members of a special family of antimicrobial peptide existing in penaeid shrimp and play an important role in the immunological defense of shrimp. Here, we report a penaeidin sequence cloned from the Indian white shrimp Fenneropenaus indicus (Fein-Penaeidin). The Fein-Penaeidin open reading frame encodes a 77 amino acid peptide including a 19 amino acid signal peptide. The deduced amino acid sequences of Fein-Penaeidin include a proline rich N-terminal domain and a carboxyldomain that contains six cysteine residues. Structural analysis revealed an alpha-helix in its secondary structure and the predicted 3D structure indicated two-disulphide bridges in the alpha-helix. Phylogenetic analysis and sequence comparison with other known peaneidin suggest the gene shows high similarity to that of penaeidin from Peneaus monodon (95%), F. indicus (80%) and Fenneropenaeus chinensis (74%). Fein-Penaeidin was examined in normal and microbial challenged shrimp and was found to be constitutively expressed in haemocytes, Heart, gills, muscles, intestine, hepatopancreas and eyestalk. Bacterial challenge resulted in mRNA up-regulation, inducing expression at 6 h post injection indicating the penaeidin involved in the innate immunity. & 2012 Elsevier B.V. All rights reserved.

Keywords: Penaeidin Antimicrobial peptide Vibrio parahaemolyticus Gene expression Immunity

1. Introduction Global production of commercially important shrimp species such as the Indian white shrimp Fenneropenaeus indicus, and the tiger shrimp Penaeus monodon has increased exponentially and are extensively farmed along the east coast of India. The industrial culture of F. indicus has recently experienced serious problems linked to the outbreak of microbial diseases caused by viruses and bacteria. Diseases which occur at all stages of shrimp culture and in capture fisheries in India are responsible for the declined production and vast economic losses. Studying anti-microbial peptides/proteins (AMPs), which are effector molecules of the host defense, is particularly attractive not only for progressing basic knowledge on shrimps immunity but also because they offer various possible applications for disease management in aquaculture [1]. AMPs are widespread throughout the animal and plant kingdoms and play an important role in the innate immunity of living organisms, especially in those organisms that lack adaptive immunity. AMPs provide an early and localized first line of defense against pathogens [2–4]. Moreover, their small size

n Corresponding author. Tel.: þ91 4565 225682, þ 91 4565 228079  96; fax: þ 91 4565 225202. E-mail address: [email protected] (B. Vaseeharan).

2211-2839/$ - see front matter & 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.rinim.2012.02.001

amphipathic structure and cationic character makes them easy to synthesize without dedicated cells or tissues, and they rapidly diffuse to the point of infection. The first antimicrobial peptide characterized was a 6.5 kDa proline peptide from the haemocytes of the shore crab Carcinus maenas [5]. Besides providing an immediate and broad spectrum of microbial activity, AMPs can kill bacteria in micro molar range, are promptly synthesized at low metabolic cost, easily stored in large amounts and are readily available shortly after an infection [6,7]. Penaeidins are members of a family of AMPs, originally isolated from the shrimp Litopenaeus vannamei, which posses both Grampositive antibacterial and antifungal activities [8]. It appears to be a family of AMPs ubiquitous among penaeid shrimp where they are major components of the immune response synthesized and stored in granulocytes and released after stimulation [5,9,10]. They are highly cationic molecules composed of a N-terminal proline-rich domain (PRD), followed by a C-terminal domain containing 6 conserved cysteine residues that form three disulfide bonds in a cysteine-rich domain (CRD) [11]. Recent studies report elucidates that thirty-nine penaeidins have been identified from eight different species of shrimp. These penaeidins are divided into five categories (penaeidin 1–5) based on the amino acid sequence similarities. Penaeidin-4, which is the most powerful bactericide among the penaeidins [12–14]. Modern research approaches are needed to compare the importance of penaeidin of the Indian white

36

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

shrimp F. indicus with other molecular data available in the GenBank. Thus, the solution structure of Litvan PEN3-1 and Litvan PEN4-1 has been determined revealing the overall organization of the two domains and the arrangement of the disulfide bonds [15]. Amino acid sequence analysis of penaeidin indicates that the amphipathic structure is a part of the CRD and has more positively charged amino acids than PRD, suggesting that CRD may be the pathogen-recognition domain [5]. The PRD exhibits a cytokine function that regulates the granulocytes and semi-granulocytes adhesion by regulating the extracellular matrix (ECM) and cell adhesion molecules (CAMs) in the tiger shrimp. Based on this, it has been proposed that penaeidin is involved in the wound healing process in shrimp [16]. Shrimp are constantly exposed to a variety of bacteria and viruses in the aquatic environment. Vibriosis, commonly caused by Vibrio harveyi, Vibrio parahaemolyticus and Vibrio alginolyticus is the most predominant bacterial disease causing mass mortalities of cultured shrimp worldwide [17–19]. High shrimp mortality due to vibriosis is recognized as the key constraint to the sustained production of shrimp aquaculture, consequently the study of the immune defense and of the genes that control immune competence become important. Previous studies have reported that penaeidin was found to be highly upregulated following a challenge with Vibrio harveyi in giant tiger shrimp [9,20] indicating that penaeidins have immune modulatory functions against both pathogens via an unknown mechanism [16]. Penaeidins were constitutively expressed in their mature and active form in granular haemocytes of naive shrimps and were stored within cytoplasmic granules of granular hemocyte populations [21,22]. Recently penaeidin like antimicrobial peptide from F. indicus (Fi-Penaeidin) was reported by Antony et al. [44] and the sequence similarity were different from the present study; hence we named the present penaeidin sequence as Fein-Penaeidin. Accordingly, in the present study, (i) the cDNA of the Fein-Penaeidin gene from F. indicus was cloned and sequenced. (ii) The sequence and homology modeling of Fein-Penaeidin from F. indicus was analyzed using bioinformatics tools. (iii) The tissue distribution and variation of expression profiles of Fein-Penaeidin in peptidoglycan and V. parahaemolyticus challenged shrimp were quantified by real-time PCR.

2. Materials and methods 2.1. Animals Indian white shrimp F. indicus of approximately 15–20 g were obtained from the coastal area of Nagapattinam to Chennai, Tamil Nadu, India. They were stocked under natural photoperiod in a recirculating tank system with water salinity and temperature maintained at 30% salinity at 30 1C, respectively. The shrimp were fed with a commercial shrimp pellet feed.

2.2. Micro-organism preparation A marine pathogenic bacterium from F. indicus was cultured in Thio sulphate citrate bile salt agar (TCBS) for 2 days at 37 1C. Identification of the strain was confirmed by 16s rRNA sequence and the sequence (V. parahemolyticus DAHV1) were submitted to the Gene Bank with accession no: HQ693275. For experiments, fresh culture was prepared by inoculation of an overnight culture (1:100) into fresh medium for further culturing until it reach a density of 0.5–0.6 at OD 600 nm.

2.3. Hemolymph and other tissue collection Hemolymph was collected from the Indian white shrimp F. indicus from the ventral sinus cavity of the first abdominal segment using 1 ml syringe containing 0.5ml anticoagulant solution (0.45 M NaCl, 0.1 M glucose, 30 mM sodium citrate, 26 mM citric acid, 10 mM EDTA, pH 7.5, 780 mOsm kg  1) and immediately centrifuged at 500 g at 4 1C for 20 min to separate the haemocytes from the plasma. The resulting hemocyte pellet was used for total RNA isolation. After hemolymph collection, shrimp tissues were harvested by dissection and were immediately frozen in liquid nitrogen and stored at  80 1C. Haemocytes and tissues were further treated according to the various experimental procedures. 2.4. cDNA synthesis, cloning and sequencing Total RNA was extracted from the haemocytes of F. indicus using TRIzol reagent and quantified by Bio photometric plus (Eppendorf, Germany) at 260 and 280 nm. Only RNAs with absorbance ratios (A260:A280) greater than 1.8 were used for cDNA synthesis. First strand cDNA was generated in a 20 ml reaction volume containing 5 mg of total RNA, 5  RT buffer, 10 mM dNTP, 100 mm Oligo-dT, 20U of RNase inhibitor and 100U of M-MLV reverse transcriptase (Applied Biosystems, Forster, CA, USA). The reaction was conducted at 42 1C for 60 min followed by an inactivation step at 70 1C for 15 min. PCR amplification of 1 ml cDNA was performed in a 25 ml reaction volume containing 1X Standard Taq buffer (50 mM Tris–HCl buffer (pH 9), containing 50 mM KCl, 1% Triton X-100 and 2.5 mM MgCl2) 5 U Taq polymerase and 0.25 mM dNTPs. Based on the previous publications, degenerate primers FIPE F1 (50 -ATG CGC CTC GTG GTC TG30 ), FIPE R1 (50 -TCC TTT TAC TAA ITG ICA ICA-30 ) were used for the partial amplification of F. indicus penaeidin [23]. Based on the partial sequence obtained, the complete sequence of Fein-Penaeidin cDNA was generated using RACE PCR. PCR reactions were performed as follows: 35 cycles of denaturation at 94 1C for 1 min, annealing at 50 1C for 1 min, and elongation at 72 1C for 2 min, followed by a 10 min extension at 72 1C. The PCR product was analyzed by electrophoresis in 1.5% agarose gels in TBE buffer, stained with 10 mg/ml ethidium bromide and visualized under UV transilluminator. Further amplified cDNA fragments were cloned into the pGEM-T Easy vector as per the instructions of the manufacturer (Promega Corporation, Madison, WI, USA). Recombinant bacteria were identified by blue/white screening and confirmed by PCR. Plasmids containing the insert were purified (HiYieldTM Gel/PCR DNA Mini Kit-Real genomicsTM, Taiwan) and used as a template for DNA sequencing. Nucleotide sequencing was performed using the dideoxynucleotide chain termination method on an ABI DNA sequencer (Applied Biosystems, Forster, CA, USA). 2.5. Sequence analysis of Fein-Penaeidin The sequence homology and the translated amino acid sequences comparisons were carried out using the BLAST program at the National Center of Biotechnology Information (NCBI) (http:// www.ncbi.nlm.nih.gov/blast). Gene translation and prediction of deduced protein were performed with EXPASY (http://www.au. expasy.org/). Elementary domain analysis was carried out on ‘‘InterPro Domain Scan’’ [24]. The signal peptide was predicted by the Signal P server (http://www.cbs.dtu.dk/services/SignalP/). The Multiple sequence alignments were performed on amino acid sequences of known penaeidins or penaeidins-like peptides from shrimps with MAFFT version 6 (http://mafft.cbrc.jp/alignment/ server/) and the same were used to construct the phylogenetic

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

tree by the Neighbor-Joining method and the UPGMA method with MEGA 3.0 (http://www.megasoftware.com). Bootstraps (1000) were performed for the UPGMA and NJ trees to confirm the repeatability of the results.

37

diluted F. indicus pooled RNA. Ct values were calculated for experimental samples and compared to the standard curve to determine the amount of RNA for each gene. After amplification, data acquisition and analysis were performed using the Sequence Detection Software (SDS vers. 2.1, Applied Bio systems).

2.6. Computation of physical and chemical parameters For physico-chemical characterization, molecular weight, theoretical isoelectric point (pI), total number of positive and negative residues, estimated half-life, extinction coefficient [25], instability index [26], aliphatic index [27] and grand average of hydropathicity (GRAVY) [28] were computed using the ProtParam tool in the Expasy Proteomic Server (http://expasy.org/tools/ protparam.html) [29]. 2.7. Molecular modeling and secondary structure prediction Secondary structure of Fein-Penaeidin was predicted using GOR IV [30]. GOR IV uses all possible pair frequencies within a window of 17 amino acid residues and cross-validates on a data base of 267 proteins. The protein sequence of Fein-Penaeidin was submitted to the full-chain structure prediction server ROBETTA [31–33] and visualized using PyMOL. Robetta provides both ab initio and comparative models of protein domains. It uses the ROBETTA fragment insertion method [34]. Domains without a detectable PDB homolog are modeled with the Rosetta de novo protocol [35]. Comparative models are built from Parent PDBs detected by UW-PDB-BLAST or HHSEARCH and aligned by various methods which include HHSEARCH, Compass, and Promals. Loop regions are assembled from fragments and optimized to fit the aligned template structure [36]. 2.8. Model evaluation Models so produced were ranked on Structural Analysis and Verification Server (SAVES). Models were evaluated on basis of the geometrical and stereo chemical constraints using ProCheck [37] and factors such as unfavorable atomic contacts, side chain planarity problems; connections to aromatic rings out of plane etc. were assessed using What Check (WhatIf) [38]. Ramachandran plot statistics [39] were used to evaluate the best model. The root mean square deviation (RMSd) values were calculated using the modeler by fitting the carbon backbone of the predicted. Five models were predicted using different templates among those that showed the good resolution factor and R-factor was used. 2.9. Quantification of Fein-Penaeidin gene expression in different tissues In order to study the Fein-Penaeidin expression in different organs of F. indicus, total RNA was isolated from the hemocyte, heart, gills, muscles, hepatopancreas, intestine and eyestalk using TRIzol reagent according to manufacturer instructions. The firststrand cDNAs were synthesized from 2 mg of the total RNA using reverse transcriptase enzymes. Comparative analysis of FeinPenaeidin gene expression was achieved by qRT-PCR using an ABI PRISM 7500 Sequence Detection System (Model 7500, Applied Biosystems, Foster City, CA, USA), and QuantiTects SYBR Green qRT-PCR reagents (Qiagen). Total RNA was purified and a 3 ml aliquot from each sample was used as template for a 25 ml onestep RT-PCR reaction with final a primer concentration of 0.4 mM. The reaction conditions were set-up as follows: initial denature step for 5 min at 94 1C, 40 cycles of denaturing (94 1C for 5 s), annealing (60 1C for 10 s), and extending (72 1C for 10 s). Fluorescent detection was performed after each extension step. All samples were run in triplicate with a standard curve of serially

2.10. Immune challenge with peptidoglycon (PG) and V. parahaemolyticus In the immune challenge experiments, F. indicus (approximately 10–20 g each) was maintained in 500 L tank filled with air pumped sea water. For the challenge test, there were three treatments (F. indicus injected with PG, V. parahaemolyticus and saline) combined with seven exposure times at 0, 3, 6, 12, 24, 36 and 48 h. Peptidoglycon (PG) isolated from Bacillus subtilis (69554, Sigma, USA) which had been dissolved in 0.85% NaCl solution to 1 mg ml  1. F. indicus was injected in the abdominal side with PG solution at a rate of 20 ml per 20 g of shrimp to reach a dose of 1 mg kg  1. V. parahaemolyticus (accession no: HQ693275) was injected in each shrimp at a concentration of 6  10  4 CFU. Hemolymph was collected from the ventral sinus using a 1-mL sterile syringe preloaded with 100 ml anticoagulant at 0, 3, 6, 12, 24, 36, and 48 h post-injection. The hemolymph was centrifuged immediately at 800 g for 20 min at 4 1C for 20 min. The resulting pellet was used for total RNA isolation, and used for the Fein-Penaeidin transcript. Control groups were injected with 20 ml saline. For each treatment and each exposure time, hemolymph were extracted from three shrimps. Quantitative RT-PCR was performed using the gene specific primers QFISP F (ATGCGTCTCGTGGTCTGCCT) with QFISP R (CCATAGGGTGGAGCTCTGGA). The primers b-actin F and b-actin R were used to amplify the b-actin fragment that was used as a positive control.

3. Results 3.1. Cloning and sequence analysis of Fein-Penaeidin The penaeidin cDNA of F. indicus (Fein-Penaeidin) consisted of 234 bp encoding 77 amino acids including an signal peptide of 19 amino acids (Fig. 1). The calculated molecular mass of the mature protein is 8.335 kDa with an estimated pI of 9.5. The signal peptide region of Fein-Penaeidin is highly conserved in all other crustacean penaeidins (MRLVVCLVSLASFALVCRA). Also the proline-rich residues at the NH2-terminus and the six cysteine residues at the COOH-terminus are conserved and found homologous with other crustacean sequences. Gly (G), Arg (R), Cys (C) and Ala (A) are abundant in the Fein-Penaeidin sequence. The total numbers of negatively charged residues (Asp þGlu) were one while the numbers of positively charged residues (ArgþLys) were ten. The estimated extinction coefficient was computed to be 7950 when all pairs of Cys residues form cystines and 7450 when all Cys residues are reduced. The estimated half-life is 30 h in mammalian reticulocytes, in vitro, 420 h in yeast, in vivo and 410 h (Escherichia coli, in vivo). The instability index (II) is computed to be 65.37 and this classifies the protein as unstable. The Aliphatic index and the Grand average of hydropathicity (GRAVY) were found to be 63.38 and  0.144, respectively. The nucleotide sequence and deduced amino acid sequence was submitted to GenBank (accession no: HM535649). According to the search data in the Gen Bank, comparision of full-length alignment of penaeidin of F. indicus with penaeidins of other Penaeid shrimps was performed by BLAST (Fig. 2) and its identity of the Fein-Penaeidin fragment with the penaeidins of other species is from 95% (P. monodon) (Table 1).

38

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

Fig. 1. Nucleotide sequence (above) and deduced amino acid sequence of the open reading frame (below) of Fein-Peneaidin cDNA. Nucleotides are numbered from the first base at the 50 end. Amino acids are numbered (italics) from the initiating methionine.The underlined amino acid residues indicate a putative signal sequence. Cysteine residues that participate in the formation of the intermolecular disulphide bond are bold and italicized. An asterisk is the start and stop codon. The sequence was submitted to GenBank with accession no: HM535649.

3.2. Phylogenetic analysis of Fein-Penaeidin A phylogenetic analysis of the penaeidin family was performed at the amino acid level using MAFFT version 6 by the Neighbor Joining (NJ) method. The phylogenetic tree of Fein-Penaeidin showed that the penaeidin family was divided into five groups: Penaeidin of P. monodon is the first group, Penaeidin 2 of L. vannamei, Litopenaeus schmitti, Litopenaeus stylirostris, Farfantepenaeus paulensis is the second group. Penaeidin 3 of L. vannamei, F. paulensis, L. schmitti, L. stylirostris and Fenneropenaeus chinensis is the third group. Penaeidin 4 of L. vannamei and penaeidin 5 of F. chinensis is the fourth group. Penaeidin like antimicrobial peptide in F. indicus reported by Antony et al. [44] is the fifth group where in the present study Fein-Penaeidin found highly homologous with P. monodon penaeidins and originates from the same branches of P. monodon (Fig. 3).

3.3. Secondary structure prediction/homology modeling The secondary structure analysis using GOR 4 showed that the percentage of coil and helix is maximum in Fein-Penaeidin (Fig. 4a). Among 77 amino acids, 59 amino acids (76.62 %) were found to have random coil structure and about 10 amino acids (12.99 %) were found to have an alpha helix structure. The protein also had extended strands. The final over all model energy was as low as  3037.183 kJ/mol.

3.4. Structure analysis and verification Quality assessment of the modeled protein was done in SAVS. The stereochemical quality of a protein, stereochemical parameters of the residues and the statistical Z-score deviation of the modeled protein was verified using SAVS version 1. The score given to the modeled protein was greater than 0.2, suggesting that the modeled protein has a refined structure. The overall quality factor as shown by the errat option of the SAVS metaserver, was 83.871.

3.5. Ramachandran plot analysis for the target protein The Ramachandran plot provided by the procheck option showed that 91.5% of the amino acids residues are present in the more favoured region, 8.5% of the amino acid residues are in the additionally allowed region (Fig. 4b). Only 0.5% of the residues were present in the disallowed region. A good quality model would be expected to have over 90% of the amino acid residues in the most favoured region, and during homology modeling 98% of the amino acid residues must be present in the allowed region. This shows that the target protein as a good quality model.

3.6. Tissues distribution and expression pattern analysis of Fein-Penaeidin injected with PG, and V. parahaemolyticus The distribution of Fein-Penaeidin mRNA in different tissues was examined and the mRNA expression level of Fein-Penaeidin varied among the samples tested in the haemocytes, heart, hepatopancreas, gills, muscles, intestine and eye of non-challenged shrimp. Total RNA from different tissues of Fein-Penaeidin were extracted, transcribed into cDNAs then used as the template for PCR amplification. Beta-actin served as control. qRT-PCR analysis showed that interestingly Fein-Penaeidin were expressed in all parts of the tissues tested. In unchallenged shrimp, FeinPenaeidin was abundant in the haemocytes and intermediate in the heart, gill and muscles with only a weak signal noted in the hepatopancreas, intestine and eyestalk (Fig. 5a and b). In challenged shrimps, strong signals of Fein-Penaeidin transcripts were found to be standard at all the seven exposure times at 0, 3, 6, 12, 24, 36 and 48 h. The transcript of Fein-Penaeidin increased to the highest level at 6 h after PG and V. parahaemolyticus challenge. (Fig. 6a and b). Significant difference (p o0.05) in Fein-Penaeidin expression was found between the PG, V. parahaemolyticus and the control group at 6, 12, 24, 36 and 48 h of post –injections.

4. Discussion The penaeidins which are present in different tissues of shrimp body and haemocytes, could combine antimicrobial and chitinbinding properties that may be important in interactions between immune function and developmental function through the synthesis of the exoskeleton in shrimp [40]. The multifunctional properties of AMPs represent an important new area to be investigated. In the present study we have reported the fulllength sequence of penaeidin from the haemocytes of the Indian white shrimp F. indicus and its mRNA transcript expression was analyzed in peptidoglycan and V. parahaemolyticus challenged F. indicus. While it is clear that each penaeidin class is encoded by a separate and unique gene, the issue of the genomic sources for the observed isoform diversity in expressed penaeidins is still unresolved. Cuthbertson et al. [41] reported the diversity of the penaeidin in L. vannamei and Litopenaeus setiferus, and discovered a novel penaeidin class, designated as penaeidin-4. In the present study, the deduced peptide sequence of the cloned PCR products of the F. indicus penaeidin gene has an open reading frame of 234 bp encoding 77 amino acid including an signal peptide of 19 amino acids. The multiple alignment of the present study Fein-Penaeidin sequence has revealed a high level of homology with penaeidin from P. monodon. A phylogentic tree analysis of Fein-Penaeidin indicated the same subgroup of Penaeidin from

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

39

Fig. 2. Multiple sequence alignment of Fein-Penaeidin with that of an arthropod: Identical amino acid residues are shaded dark blue, dark yellow indicates conservation in three or more species. Asterisk (n) indicates the conserved six cysteine residues. The double headed arrow indicates the position of the signal peptides, proline-rich and cyteine-rich domains.

P. monodon. Kang et al. [23] reported that F. chinensis chpenaeidin is grouped together with P. monodon penaeidin. Three classes of penaeidin namely PEN2, PEN3 and PEN4 were identified in the pacific white shrimp L. vannamei [8,41].

The Fein-Penaeidin sequence showed similarity to penaeidin, penaeidin 5, 3b and 3a of P. monodon (66–95%), Fi-penaeidin-like AMP (80%), F. chinenesis penaeidin 5-2, 5-1, 3-2, 3-1 and 5-3 (66– 74%), L. vannamei penaeidin 4c, 4a, 2b, 3i, 3h, 3g, 3f, 3a, 3d, 3a,

40

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

Table 1 Sequences used for the present study which found similar with Fi-penaedin. Species

Abbreviation

Acc. no.

Size (aa/bp)

Identity, similarity (%)

Fenneropeneus indicus

P-FI

HM535649

77aa/234 bp

–

Penaeus monodon

P-Pm P-pm P3a-Pm P3b-Pm P3-Pm P5-Pm p-pm

AAQ05769 AAQ84721 ACQ66006 ACQ66007 ACH70378 ACQ66008 ACS44640

74aa/225 bp 74aa/225 bp 74aa/225 bp 74aa/225 bp 79aa/240 bp 79aa/240 bp 43aa/130 bp

92/94 92,94 92/94 91/92 58/66 58/66 93/95

Fenneropenaeus indicus

Pen –like-Fi

ADJ39703

106aa/320 bp

70,80

Farfantepenaeus paulensis

PEN2-1-FP PEN2-2-FP

AAX58695 AAX58696

73aa/222 bp 73aa/222 bp

62/72 62/72

Farfantepenaeus brasiliensis

P-FB

ABO93324

71aa/216 bp

65/72

Farfantepenaeus subtilis

P-Fs

ABO93321

73aa/222 bp

62/70

Fenneropenaeus chinensis

P3-1-Fc P3-2-Fc P-Fc Pen5-2-Fc Pen5-3-Fc Pen5-1-Fc

AAP33450 ABC33920 AAV85945 AAZ80041 ABC33919 AAZ79334

71aa/216 bp 71aa/216 bp 79aa/240 bp 79aa/240 bp 79aa/240 bp 79aa/240 bp

67/74 66/73 58/66 58,66 58,66 57,67

Fenneropeaeus penicillatus

Pen3-p-Fpen Pen3-o-Fpen

ABY56821 ABY56820

82aa/249 bp 82aa/249 bp

58,64 56,62

Litopeneaus Vannamei

Pen3g-Lv Pen3 a.1-Lv Pen3 a.-2-Lv Pen3 a.-3-Lv Pen3a-Lv Pen3b-Lv Pen 3-1-Lv Pen3d-Lv Pen3f-Lv Pen3h-Lv Pen3e-Lv Pen3i-Lv Pen3-2-Lsmi Pen3c-Lv Pen3-11-Lv Pen3j-Lv Pen2-Lv Pen2-1-Lv Pen2b-Lv Pen2-4-Lv Pen4c-Lv Pen4-3-Lv Pen4a-Lv Pen4-1-Lv

AAK77536 AAK73084 AAK73085 AAK73086 AAK77532 CAA75144 ABA55001 AAK77533 AAK77535 AAK77537 AAK77534 AAK77538 ACL01099 CAA75145 ABA63168 AAK73083 CAA75142 ABA54999 AAK77539 ABA63168 AAK77542 ABA63168 AAK77540 ABA55000

82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 82aa/249 bp 75aa/228 bp 81aa/246 bp 67aa/204 bp 81aa/246 bp 72aa/219 bp 72aa/219 bp 72aa/219 bp 67aa/204 bp 67aa/204 bp 67aa/204 bp 67aa/204 bp 67aa/204 bp

58,64 58,64 58,64 58,64 58,64 56,62 58,64 58,64 57,63 58,63 57,61 57,63 54,66 56,63 52,61 60,68 55,63 55,63 55,63 52,61 54,61 52,61 52,61 52,61

Litopenaeus stylirostris

Pen3-1-Lsty Pen3-Lsty Pen2-Lsty

AAY33770 AAQ62566 AAQ62565

79aa/240 bp 87aa/264 bp 72aa/219 bp

56,65 51,59 55,63

Litopenaeus setiferus

Pen3k-Lsti Pen2d-Lsti Pen4d-Lsti Pen3n-Lsti Pen3m-Lsti

AAK83450 AAK83453 AAK83455 AAK83452 AAK83451

75aa/228 bp 72aa/219 bp 67aa/204 bp 75aa/228 bp 75aa/228 bp

56,64 52,60 49,59 55,62 55,62

Litopenaeus schimitti

Pen3-1-Lsmi Pen4-1-Lsmi Pen2-2-Lsmi Pen2-1-Lsmi

ACL01098 AAX58699 AAX58698 AAX58697

75aa/228 bp 67aa/204 bp 72aa/219 bp 72aa/219 bp

55,65 51,61 51,61 51,61

3a.3, 3a.2, 3a.1, 3j, PEN4-3, PEN3-11, PEN2-4, PEN3-1, PEN4 1, PEN2-1, 3c, 3b, 2 and 3a (61–68%), L. setiferus penaeidin 4d, 3l, 2d, 3n, 3m and 3k (59–60%), L. schmitti penaeidin 3-2, 3-1, 4-1, 2-2 and 2-1 (61%), L. stylirostris penaeidin 3, 2 and 3-2 (51–59%), F. penicillatus pen 3-p and pen 3-o (56%-58%), F. paulensis penaeidin 2-2 and 2-1 (62%), Farfantepenaeus brasiliensis penaeidin (65%), F. subtilis penaeidin (62%). F. indicus penaeidin-like

antimicrobial peptide (ADJ39703) similarity was different from the present study Fein-Penaeidin (HM535649). Multiple alignment and phylogenetic studies also confirmed both sequences were separately grouped. It is suggested that both penaeidin (Fi-penaeidin and Fein-Penaeidin) from F. indicus may be different isoforms of penaeidin. In L. vannamei more number of isoforms of penaeidin 4c, 4a, 2b, 3i, 3h, 3g, 3f, 3a, 3d, 3a, 3a.3, 3a.2, 3a.1, 3j,

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

41

Fig. 3. Phylogenetic analysis of Fein-Penaeidin with other Penaeidin of penaeid shrimps.

PEN4-3, PEN3-11, PEN2-4, PEN3-1, PEN4-1, PEN2-1, 3c, 3b, 2 and 3a were reported [8,41]. The penaeidin sequence isoforms involved in the invertebrate immune system may be clearly known when the functional aspects of each sequence will be thoroughly studied. The proline-rich domain, COOH-terminal domain of penaeidins is characterized by the presence of six cysteine residues engaged in the formation of three intramolecular disulfide bridges, which are conserved in the Fein-Penaeidin sequence of F. indicus. To date, this unique chimeric structure is characteristic of the penaeidin family [8,10]. Secondary structure analysis using GOR4 revealed that coils were dominated among secondary structure elements followed by alpha helices. Based on the Ramachandron Plot value and overall quality factors, the best 3D structure generated was selected for structure validation. It is evident from Fig. 4a that the best model created using the template 1UEO employing the ROBETTA full-chain protein structure prediction server has more than 91.5% of its amino acid residues in the core region, 8.5% in the allowed region and only 0.5% in the disallowed region as compared to models created using the SWISSMODEL server having smaller percentage of amino acid residues in the allowed region. This indicates that the models created using the ROBETTA server are better in terms of geometrical and stereo chemical properties. The RMS Z-score of the modeled protein was greater than 0.2, showing that the modeled protein has a refined structure. The overall quality factor as shown by the errat option of the SAVS metaserver was 83.871, suggesting high model quality. The predicted structures conformed well to the stereochemistry indicating reasonably good quality. In previous results the predicted three-dimensional structure of penaeidin-5 was analyzed and showed the full length peptide using MODELER and a CSab-type a-helix structure in the carboxy terminal region [42]. Quantitative real-time PCR was used to demonstrate that the penaeidin genes are expressed at dramatically different levels in

Fig. 4. (a) Structure of Fein-Penaeidin modeled by the ROBETTA structure prediction software and the ribbon structure was visualized by PYMOL. The protein Fein-Penaeidin was modeled using homology modeling based on the template obtained from PDB. (b) Ramachandra plot validation of Fein-Penaeidin.

the tissues of F. indicus. An abundance of penaeidin expression was present in the haemocytes and weakly detected in other tissues such as the gills, heart and intestine. This differential pattern of expression would suggest that transcription of penaeidin genes is controlled by distinct regulatory elements. In the immune challenged experiments both peptidoglycan and V. parahaemolyticus injected, time course analysis of Fein-Penaeidin revealed that Fein-Penaeidin was up-regulated to the highest level at 6 hr following the challenge. Penaeidin mRNA has been shown to be strongly expressed in many Penaeid shrimp including F. chinensis [23], L. vannamei [21] and P. monodon [43]. Using northern blot analysis, penaeidin transcript was detected in haemocytes but not in heart, intestine, gills, subcuticular epithelium, lymphoid organ, hepatopancreas or muscles in P. monodon [11]. Moreover, RT-PCR analysis indicated that penaeidin mRNA was detected in heart, gills, hepatopancreas nodules and

42

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

eye, subcuticular epithelium, brain and stomach that was not detected using the northern blot technique in F. chinensis [23]. In conclusion, a 234 bp Fein-Penaeidin gene was cloned from haemocytes of the Indian white shrimp F. indicus with higher expression in haemocytes, heart, gills and muscles. The FeinPenaeidin amino acid sequence of F. indicus shows 95% similarity to penaeidin of P. monodan. Phylogenetic analysis indicated that the Fein-Penaeidin is an independent group and is definitely distinct from the Fi-penaeidin and penaeidin 1, 2, 3 and 4 of other penaeidin of shrimp. The Ramachandran plot provided by procheck option indicated that 91.5% of the amino acids showed the target protein as a good quality model. The Fein-Penaeidin expression was significantly higher at 6 h post injection with PG and V. parahaemolyticus indicating the immune resistance.

Acknowledgment This work was supported by Department of Biotechnology (DBT), New Delhi, India, under the Project grants code: BT/PR11907/AAQ/ 03/459/2009. Fig. 5. (a) Expression of Fein-Penaeidin transcripts and b-actin in different tissues. Lane 1, hemocytes; 2, heart; 3, gills; 4, muscles; 5, hepatopancreas; 6, intestine; 7, eye. (b) Relative gene expression of Fein-Penaeidin in different tissues by real time PCR analysis.

Fig. 6. Time course expression profiles of Fein-Penaeidin mRNA in the hemocytes against challenges of peptidoglycon (a) and Vibrio parahaemolyticus (b) by q-RT-PCR.

testis but not in the brain of L. vannamei [10]. In addition to haemocytes, gills, heart, and intestine, RT-PCR analysis indicated a positive signal for a ch-penaeidin transcript in the hepatopancreas,

References [1] Bachere E, Gueguen Y, Gonzalez M, Lorgeril J, Garnier J, Romestand B. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunological reviews 2004;198:149–68. [2] Zasloff M. Antimicrobial peptides of multicellular organisms. Nature 2002; 415:389–95. [3] Boman HG. Antibacterial peptides: basic facts and emerging concepts. Journal of Internal medicine 2003;254:197–215. [4] Selsted ME, Ouellette AJ. Mammalian defensins in the antimicrobial immune response. Nature Immunology 2005;6:551–7. [5] Schnapp D, Kemp GD, Smith VJ. Purification and characterization of a prolinerich antibacterial peptide, with sequence similarity to bactenecin-7, from the haemocytes of the shore crab, Carcinus maenas. European Journal of biochemistry 1996;240:532–9. [6] Hancock REW. Cationic peptides: effectors in innate immunity and novel antimicrobials. Lancet Infectious Diseases 2001;1:156–64. [7] Prenner EJ, R.N.A.H. Lewis, Elhaney RN. The interaction of the antimicrobial peptides gramicidin S with lipid bilayer model and biological membranes. Biochimica et Biophysica Acta 1999;1462:201–21. [8] Destoumieux D, Bulet P, Loew D, Van Dorsselaer A, Rodriguez J, Bache re E. Penaeidins, a new family of antimicrobial peptides isolated from the shrimp Penaeus vannamei (Decapoda). The Journal of Biological Chemistry 1997; 272:283–406. [9] Destoumieux D, Munoz M, Bulet P, Bache re E. Penaeidins, a family of antimicrobial peptides from penaeid shrimp (Crustacea, Decapoda). Cellular and Molecular Life Sciences 2000;57:1260–71. [10] Ho SH, Chao YC, Tsao HW, Sakai M, Chou HN, Song YL. Molecular cloning and recombinant expression of tiger shrimp Penaeus monodon penaeidin. Fish Pathology 2004;39:15–23. [11] Supungul P, Klinbunga S, Pichyangkura R, Hirono I, Aoki T, Tassanakajon A. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Diseases of Aquatic Organisms 2004;61:123–35. [12] Chiou TT, Wu JL, Chen TT, Lu JK. Molecular cloning and characterization of cDNA of penaeidin-like antimicrobial peptide from tiger shrimp (Penaeus monodon). Marine Biotechnology 2005;7:119–27. [13] Cuthbertson BJ, Bullesbach EE, Fievet J, Bachere E, Gross PS. A new (penaeidin class 4) of antimicrobial peptides from the Atlantic white shrimp (Litopenaeus setiferus) exhibits target specificity and an independent proline-rich-domain function. The Biochemical Journal 2004;381:79–86. [14] Cuthbertson BJ, Yang Y, Bachere E, Bullesbach EE, Gross PS, Aumelas A. Solution structure of synthetic penaeidin-4 with structural and functional comparisons with penaeidin-3. The Journal of Biological Chemistry 2005; 22(280):16009–18. [15] Yang Y, Poncet J, Garnier J, Zatylny C, Bache re E, Aumelas A. Solution structure of the recombinant penaeidin-3, a shrimp antimicrobial peptide. The Journal of Biological Chemistry 2003;278:36859–67. [16] Li CY, Yan HY, Song YL. Tiger shrimp (Penaeus monodon) penaeidin possesses cytokine features to promote integrin-mediated granulocyte and semigranulocyte adhesion. Fish and Shellfish Immunology 2010;28:1–9. [17] Lightner DV, Lewis DH. A septicemic bacterial disease syndrome of Penaeid shrimp. Marine Fisheries Review 1975;37:25–8. [18] Adams A. Response of penaeid shrimp to exposure to Vibrio species. Fish and Shellfish Immunology 1991;1:59–70.

B. Vaseeharan et al. / Results in Immunology 2 (2012) 35–43

[19] Lavilla-Pitogo CR, Leano EM, Paner MG. Mortalities of pond-cultured juvenile shrimp Penaeus monodon associated with dominance of luminescent vibrios in the rearing environment. Aquaculture 1998;164:337–49. [20] Rojtinnakorn J, Hirono I, Itami T, Takahashi Y, Aoki T. Gene expression in haemocytes of kuruma prawn, Penaeus japonicus, in response to infection with WSSV by EST approach. Fish and Shellfish Immunology 2002;13:69–83. [21] Munoz M, Vandenbulcke F, Saulnier D, Bachere E. Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp. European Journal of Biochemistry 2002;269: 2678–89. [22] Munoz M, Vandenbulcke F, Gueguen Y, Bachere E. Expression of penaeidin antimicrobial peptides in early larval stages of the shrimp Penaeus vannamei. Developmental and Comparative Immunology 2003;27:283–9. [23] Kang JC, Wang J, Zhao X, Yang X, Shao H, Xiang J. Molecular cloning and expression analysis of Ch-penaeidin,an antimicrobial peptide from Chinese shrimp, Fenneropeneaus chinensis. Fish and Shellfish Immunology 2004;16: 513–25. [24] Zdobnov EM, Apweiler R. InterProScan—an integration platform for the signature-recognition methods in InterPro. Bioinformatics 2001;17:847–8. [25] Gill SC, Von Hippel PH. Extinction coefficient. Analytical Biochemistry 1989; 182:319–28. [26] Guruprasad K, Reddy BVP, Pandit MW. Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Engineering 1990;4:155–64. [27] Ikai AJ. Thermo stability and aliphatic index of globular proteins. Journal of Biochemistry 1980;88:1895–8. [28] Kyte J, Doolottle RF. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 1982;157:105–32. [29] Gasteiger E. Protein identification and analysis tools on the ExPASy server. In: Walker John M, editor. The proteomics protocols handbook. Humana Press; 2005. p. 571–607. [30] Doolittle RF, Garnier J, Gibrat JF, Robson B, editors. Methods in enzymology, vol. 266; 1996. p. 540–53. [31] Chivian D, Kim DE, Malmstrom L, Schonbrun J, Rohl CA, Baker D. Proteins 2005;61(7):157–66.

43

[32] Chivian D, Kim DE, Malmstrom L, Bradley P, Robertson T, Murphy P, et al. Proteins 2003;53(6):524–33. [33] Kim DE, Chivian D, Baker D. Protein structure prediction and analysis using Robetta server. Nucleic Acids Research 2004;32:526–31. [34] Simons KT, Kooperberg C, Huang E, Baker D. Assembly of protein tertiary structures from fragments with similar local sequences using simulated annealing and Bayesian scoring functions. Journal of Molecular Biology 1997;25:209–25. [35] Rohl CA, Strauss CE, Chivian D, Baker D. Modeling structurally variable regions in homologous proteins with Rosetta. Proteins 2004;55:656–77. [36] Bonneau R, Strauss CE, Rohl CA, Chivian D, Bradley P, Malmstrom L, et al. De novo prediction of three-dimensional structures for major protein families. Journal of Molecular Biology 2002;322:65–78. [37] Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereo chemical quality of protein structures. Journal of Applied Crystallography 1993;26:283–91. [38] Hooft RW, Vriend G, Sander C, Abola EE. Errors in protein structure. Nature 1996;381:272. [39] Ramachandran GN, Ramakrishnan C, Sasisekharan V. Stereochemistry of polypeptide chain configurations. Journal of Molecular Biology 1963;7:95–9. [40] Destoumieux D, Munoz M, Cosseau C, Rodriguez J, Bulet P, Comps M, et al. Penaeidins, antimicrobial peptides with chitin-binding activity, are produce4d and stored in shrimp granulocytes and released after microbial challenge. Journal of Cell Science 2000;113:461–9. [41] Cuthbertson BJ, Shepard EF, Chapman RW. Gross PS.Diversity of the penaeidin antimicrobial peptides in two shrimp species. Immunogenetics 2002; 54:442–5. [42] Yang SH, Huang HJ, Yang HY, Chen MHC, Hong HG, Chiou TT, et al. Structure and function of antimicrobial peptide penaeidin-5 form the black tiger shrimp Peneaus monodon. Aquaculture 2006;260:61–8. [43] Cheng WT, Tung YH, Liu CH, Chen JC. Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish and Shellfish Immunology 2006;20:438–49. [44] Antony SP, Bright Singh IS, Rosamma P. Molecular characterization and phylogenetic analysis of a penaeidin-like antimicrobial peptide, Fi-penaeidin from Fenneropenaeus indicus. Aquaculture 2011;319:298–301.