Molecular identification of bacteriocins produced by Lactococcus lactis dairy strains and their technological and genotypic characterization

Food Control 51 (2015) 1e8

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Molecular identification of bacteriocins produced by Lactococcus lactis dairy strains and their technological and genotypic characterization Maria Barbara Pisano*, Maria Elisabetta Fadda, Roberta Melis, Maria Laura Ciusa, Silvia Viale, Maura Deplano, Sofia Cosentino Department of Public Health, Clinical and Molecular Medicine, University of Cagliari, Cittadella Universitaria, SS 554, Km 4,500 09042, Monserrato, CA, Italy

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 August 2014 Received in revised form 29 October 2014 Accepted 4 November 2014 Available online 11 November 2014

In this study, the bacteriocins produced by ten Lactococcus lactis subsp. lactis strains, previously isolated from raw milk and traditional Sardinian cheeses, were identified by targeting and sequencing the bacteriocin encoding genes. The inhibitory activity against different food borne and spoilage bacteria, and the technological and genotypic characteristics of the bacteriocinogenic L. lactis strains were also analysed. The presence of the nisin structural gene was confirmed for all L. lactis strains. Three strains were shown to harbour the Lactococcins B structural gene. The sequences of PCR products for the nisin gene from the ten bacteriocinogenic strains were compared with that of L. lactis strain ATCC 11454 (nisin A producer strain). Differences were observed in strain 6LS5 indicating its ability to produce the nisin Z variant. Five strains presented a wider inhibitory spectrum resulting in activity towards Pseudomonas aeruginosa and all the Bacillus, Listeria, Staphylococcus and Clostridium strains tested. High b-galactosidase and moderate aminopeptidase activities, that promote the desirable flavours in cheese, were detected in the majority of the strains. Rep-PCR with primer (GTG)5 revealed high diversity among the strains and allowed discrimination at both interspecific and intraspecific level. The autochthonous bacteriocinogenic isolates from Sardinian dairy products described in this work may potentially find application as starter, co-starter or protective adjunct cultures in the manufacturing of cheeses. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Lactococcus lactis PCR Nisin Lactoccocin B

1. Introduction Several studies have demonstrated that the autochthonous microbiota of traditional food products, other than improving the final technological and organoleptic properties have the capability to interfere with the growth of many food borne spoilage and pathogenic bacteria such as Listeria monocytogenes, Bacillus cereus,
lvez, Staphylococcus aureus and Clostridium tyrobutyricum (Ga
pez, Abriouel, Valdivia, & Omar, 2008). In particular, lactic acid Lo bacteria (LAB) are well known for their ability to produce pathogeninhibiting substances such as organic acids, hydrogen peroxide,
les CO2, diacetyl or antimicrobial peptides, i.e. bacteriocins (Gonza et al., 2007; Stiles & Holzapfel, 1997). Amongst the LAB group, Lactococcus lactis plays an important role in the fermentation processes in the dairy industry (Beresford,

* Corresponding author. Tel.: þ39 0706754145; fax: þ39 0706754197. E-mail address: [email protected] (M.B. Pisano). http://dx.doi.org/10.1016/j.foodcont.2014.11.005 0956-7135/© 2014 Elsevier Ltd. All rights reserved.

Fitzimons, & Cogan, 2001). In addition to its essential role in milk acidification, it contributes considerably to the formation of cheeses flavour by producing peptides and amino acids, it prevents the growth of pathogenic and spoilage bacteria and creates optimal conditions for ripening. For this reasons it is included in commercial starter cultures for the production of cheeses and fermented milks (Wouters, Ayad, Hugenholtz, & Smit, 2002). This microorganism is also capable of producing lantibiotic and non-lantibiotic bacteriocins (Venema, Venema, & Kok, 1995). Among them, nisin, a 34-amino acid lantibiotic is one of the most studied bacteriocins. Up to now five variants are already known, nisin A (the first to be discovered), Z, Q, U, and F (De Kwaadsteniet, Ten Doeschate, & Dicks, 2008). The differences between these variants are based on changes in the amino acid chain that could interfere with their antimicrobial activity. Nisin has been approved as a safe food preservative by the EU (E234), as well as by the WHO and FDA and is being used as a practical food preservative in more than 50 countries (Delves-Broughton, Blackburn, Evans, & Hugenholtz, 1996). Several bacteriocin-producing lactococci were isolated and used as starter or adjunct cultures in the manufacture of cheeses

2

M.B. Pisano et al. / Food Control 51 (2015) 1e8

(Bouksaim, Lacroix, Audet, & Simard, 2000; Dal Bello et al., 2013). However the identification and characterization of novel strains that harbour unique flavour-forming activities or that produce novel, broad-range bacteriocins (or nisin variants) is necessary in order to extend the number of available cultures for application in the dairy industry as biopreservatives. Detection and genetic sequencing of bacteriocins genes are important powerful means of obtaining a precise identification of new bacteriocins or variants (Nes & Johnborg, 2004). In a previous paper (Cosentino et al., 2012), the antimicrobial properties of L. lactis strains isolated from traditional Sardinian dairy products were analysed and six strains were found to produce nisin-like bacteriocins active against L. monocytogenes. Our research group has recently identified four additional bacteriocinogenic strains from the lactococcal population of Sardinian dairy products. In this work, the bacteriocin-like substances of ten L. lactis strains were characterized by testing the inhibitory activity against different food borne and spoilage bacteria (some of which were of dairy origin) and identified by targeting and sequencing the bacteriocin encoding genes. The technological and genotypic characteristics of the bacteriocinogenic L. lactis strains were also analysed. 2. Material and methods 2.1. Bacterial strains and cultures conditions Bacteriocinogenic L. lactis subsp. lactis strains were isolated from ewe's and goat's milk and from Fiore Sardo cheese. Six strains were characterized in a previous study as producers of antimicrobial

substances against L. monocytogenes (Cosentino et al., 2012). Four additional strains, belonging to the same culture collection, were found to have inhibitory activity towards L. monocytogenes related to heat stable proteinaceous compounds and were considered in this work. All of these isolates were identified by phenotypic and genetic tests based on polymerase chain reaction amplification using species-specific primers derived from 16S rRNA sequences, as previously reported (Pisano, Fadda, Deplano, Corda, & Cosentino, 2006). All strains were also subjected to amplification of the16S rRNA gene by using the universal primers Y1 (50 -TGG CTC AGG ACG AACGCT GGC GGC-30 ) and Y2 (50 -CCT ACT GCTGCC TCC CGT AGG AGT-30 ) which amplify a 348-bpregion containing the sequence differences reported between the subspecies lactis and cremoris (Salama, Sandine, & Giovannoni, 1991). The PCR products were purified using the PCR extract mini Kit (5PRIME, Hamburg, Germany), subsequently sequenced with ABI Prism 310 DNA sequencer (Applied Biosystems) and compared to the sequences in GeneBank database using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). All bacteriocinogenic strains were maintained at 20  C in M17 broth (Microbiol, Cagliari, Italy) with 15% (v/v) glycerol (Microbiol) as cryoprotector and subcultured twice as 1% inocula in M17 broth at 30  C for 24 h prior to experimental use. Several foodborne pathogens and spoilage strains from different sources were used as indicator bacteria. In addition to the reference and type strains, 11 bacterial strains from our cultures collection were used. The complete list of strains is reported in Table 1. All indicator strains were stored on nutrient broth (Microbiol) plus 20% (v/v) glycerol at 20  C except LAB strains which were maintained in MRS broth (Microbiol) with 15% (v/v) glycerol. Before use, they were subcultured twice in the appropriate medium.

Table 1 Origin, bacteriocin activity, presence of bacteriocin genes and antibacterial spectra of the Lactococcus lactis subsp. lactis strains isolated from Sardinian dairy products. Bacteriocinogenic strains 9FS16

16FS16

11FS16

16FS16-48

Fiore Sardo cheese Bacteriocin activity (AU/ml)a Bacteriocin-encoding genes Nisin Lacticin 481 Lactoccin A Lactoccin B Lactoccin M Target strains Listeria monocytogenes Listeria monocytogenes Listeria monocytogenes Listeria ivanovii Listeria ivanovii Enterococcus faecalis Enterococcus faecalis Enterococcus faecalis Lactobacillus casei Staphylococcus aureus Staphylococcus aureus Staphylococcus simulans Bacillus cereus Bacillus licheniformis Bacillus subtilis Bacillus firmus Clostridium sporogenes Clostridium tyrobutyricum Escherichia coli E. coli Salmonella enteritidis Yersinia enterocolitica Pseudomonas aeruginosa Pseudomonas aeruginosa a b

ATCC 7644 ATCC 19115 FS17B48Hb (ewe's cheese) FSNS1b(ewe's cheese) L21b(ewe's milk) ATCC 29212 ATCC 19433 ATCC 14028 DSM 20011 ATCC 25923 TNFBb(clinical isolate) 1BPL4b(ewe's cheese) ATCC 11778 15LC53b(goat's milk) 20LC19b(goat's milk) F1b (spread cheese) F1b(spread cheese) F1b(spread cheese) ATCC 35150 ATCC 25922 ATCC 13076 ATCC 9610 ATCC 27853 1CCBb(clinical isolate)

3LC39

1LC18

6/23898

Goat's milk

Ewe's milk

10/18771

6LS5

9/20234

320

320

320

320

160

160

320

320

640

160

þ    

þ    

þ    

þ    

þ   þ 

þ   þ 

þ    

þ   þ 

þ    

þ    

þ þ þ þ þ þ þ þ þ     þ þ þ þ þ      

þ þ þ þ þ þ þ þ þ þ þ þ  þ þ þ þ þ      

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ     þ þ

þ þ þ þ þ þ þ þ þ þ þ þ   þ þ þ þ      

þ þ þ þ þ þ þ þ þ     þ þ þ þ þ      

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ     þ þ

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ     þ þ

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ     þ þ

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ     þ þ

þ þ þ þ þ þ þ þ þ þ þ þ  þ þ þ þ þ      

Arbitrary units/ml obtained by critical dilution method using Listeria monocytogenes ATCC 19115. Our strain collection.

M.B. Pisano et al. / Food Control 51 (2015) 1e8

2.2. Detection of bacteriocin activity Bacteriocin activity was assayed by a critical dilution method as
zquez described by Campos, Rodríguez, Calo-Mata, Prado, and Vela (2006). Briefly, the cell-free supernatants from bacteriocin producing strains, adjusted to pH 6.5 with 5 M NaOH and treated with catalase (1 mg/ml, Sigma), were serially two-fold diluted in 50 ml volumes of nutrient broth (Microbiol) in a 96-well microtitre plate. Each well was then inoculated with 50 ml of a 105 CFU/ml culture L. monocytogenes ATCC 19115 indicator strain. Microtitre plates were incubated at 37  C for 24 h. Bacteriocin activity was defined as the reciprocal of the highest dilution showing inhibition of the indicator strain and was expressed in arbitrary units per millilitre (AU/ml). 2.3. Spectrum of antibacterial activity The inhibitory spectra of the bacteriocinogenic L. lactis strains were determined using the agar spot test method as described by Schillinger and Lücke (1989). Briefly, 3 ml aliquots of a fresh overnight culture of the strains were spotted onto MRS agar (1.2% (w/v) agare0.2% (w/v) glucose) plates and incubated anaerobically in a
ux, France) for 24 h GasPak anaerobic jar (GENbox anaer, BioMerie at 30  C. These plates were then overlaid with 7 ml soft agar (0.7%, w/v) seeded with 100 ml of the indicator strain and incubated for 24 h at the optimal growth temperature and atmosphere for the indicator strain. Inhibition was scored positive in the presence of a detectable clear zone around the colony of the producer strain. 2.4. Bacteriocin genes detection and genotypic characterization of the strains by Rep-PCR PCR amplification was carried out to detect the genes coding for the bacteriocins produced by L. lactis, nisin, lacticin 481, lactococcin A, B, M using the primers listed in Table 2. Template DNA was extracted from overnight broth cultures. Cells were centrifuged at 10,000 g for 5 min and the pellets were washed twice in sterile distilled water and resuspended in 1 ml of distilled water. Cell lysis was obtained by using a synthetic resin (Instagene, Bio-Rad, Melville, NY, USA) according to the protocol specified by the manufacturer. Amplification reactions were performed in a Mastercycler gradient 5331 (Eppendorf, Hamburg, Germany) and reaction pa
re, rameters were those described by Ghrairi, Manai, Berjeaud, & Fre ~ ez, and (2004) for nisin primers and Rodríguez, Gonz
ales, Gaya, Nun Medina (2000) for lacticin 481 primers. For amplification of lactococcin A, B and M the following temperature profiles were used: primary DNA denaturation step at 95  C for 2 min, followed by 30 cycles of 1 min at 92  C, 1 min at 50  C and 1 min at 72  C, with an extension of the amplified product at 72  C for 5 min. Amplification products were visualised on 1.8% agarose gel added of ethidium bromide (0.5 mg/ml) using the DNA ladder100 bp (Sigma, Milan, Italy) as the molecular weight standard. Table 2 Primers used to detect genes coding for known lactococcal bacteriocins. Primer

50 -Sequence-30

Gene amplified

References

NisP5 NisP3 Lact481-F Lact481-R LactABM-F LactA-R LactB-R LactM-R

GGATTTGGTATCTGTTTCGAAG TCTTTCCCATTAACTTGTACTGTG TCTGCACTCACTTCATTAGTTA AAGGTAATTACACCTCTTTTAT GAAGAGGGCAATCAGTAGAG GTGTTCTATTTATAGCTAATG CCAGGATTTTCTTTGATTTACTTC GTGTACTGGTCTAGCATAAG

Structural nis genes Lacticin 481

Ghrairi et al., 2004 Rodríguez et al., 2000

Lactoccocin A, B, Alegría et al., and M 2010

3

All PCR products were purified using the PCR extract mini Kit (5PRIME, Hamburg, Germany) and subsequently sequenced with ABI Prism 310 DNA sequencer (Applied Biosystems). The sequences of PCR products for the nisin gene from the ten bacteriocinogenic strains were compared with that of L; lactis strain ATCC 11454 (nisin A producer strain) and the nisin variant was determined from the amino acid sequence deduced from the DNA sequence. Rep-PCR analysis of bacteriocinogenic strains was performed with the single oligonucleotide primer (GTG)5 (50 -GTG GTG GTGGTG GTG-30 ) (Gevers, Huys, & Swings, 2001). The reference or type strains L. lactis subsp. lactis ATCC 11454, L. lactis subsp. cremoris ATCC 19257T and Enterococcus faecalis ATCC 19433T, and four L. lactis subsp. lactis bacteriocin-negative isolates were included in the study for comparison purposes. Genomic DNA from each strain was extracted as reported above. PCR was performed in 50 ml reaction mixture volumes each containing 1  PCR buffer, 1.5 mM MgCl2, 250 mM dNTPs, 1 mM primer, 0.5 U of Taq DNA polymerase (Sigma), and 20 ml of template DNA. Each cycle consisted of an initial denaturation step (4 min at 94  C) followed by 35 cycles of amplification, with a denaturation step for 1 min at 94  C, annealing at 42  C for 1 min and extension at 72  C for 2 min. Reactions were completed with 6 min elongation at 72  C. Aliquots of 10 ml of amplified products were analysed by gel electrophoresis on a 1.5% (w/v) agarose gels in TBE (1  ) buffer with ethidium bromide (0.5 mg/ml). The gels were run for 2 h at a constant voltage of 60 V, visualised by UV transilluminator and photographed by a digital camera. Pictures were normalized and the DNA banding patterns were analysed using the Gel Compar software package, version 6.6 (Applied Maths, Belgium). Similarities among isolates were estimated using the Pearson coefficient and clustering was based on the UPGMA method. The study of reproducibility established a discrimination threshold (95.3%) below which patterns were considered to be different. 2.5. Technological characteristics Caseinolytic activity was evaluated in plate count agar (PCA) (Microbiol) with 10% sterile reconstituted Skim milk (RSM, Oxoid, Milan Italy). After overnight incubation at 30  C in aerobic conditions, the plates were checked for clear zones around the colony. To test lipolytic activity, two lipolytic media containing either Tween 80 or Tributyrin were used. M17 agar (Microbiol), with 0.01% calcium chloride (Sigma) and 0.1% of Tween 80, or M17 with 0.1% tributyrin were used. On the Tween 80 medium, lipolytic colonies were surrounded by cloudy zones of precipitated calcium salts of free fatty acids while on the tributyrin medium by clear zones against a turbid background of emulsified, unhydrolysed lipids. Citrate utilization was observed as zones of clearing around colonies on calcium citrate medium (Galeslod, Hassing, & Stadhouders, 1961). Salt tolerance was determined using M17 broth containing 6.5% NaCl incubated for 48 h at 30  C and evaluated by visual observation. Acidifying activity was determined by inoculation (1%) of the strains in UHT low-fat milk (1.5% fat). Values of pH were measured with a pH meter (Orion 420 A, Orion Research, Boston, USA) after 6 and 24 h of incubation, and acidifying activity was expressed as the decrease in pH with respect to the value of non-inoculated control milk. Enzymatic activities of lactococcal strains were also evaluated
rieux, Rome, Italy) as by using the API ZYM galleries (bioMe described by the manufacturer. Activity was recorded as the approximate nanomoles of substrate hydrolysed. 3. Results and discussion The detection of bacteriocin encoding genes in the ten L. lactis subsp. lactis strains analysed are presented in Table 1, where their

4

M.B. Pisano et al. / Food Control 51 (2015) 1e8

origin and spectrum of activity toward pathogenic and spoilage bacteria are also shown. With respect to nisin structural gene, a 598-bp fragment was amplified from the genomic DNA of all strains, which was identical to that of a nisin positive control strain L. lactis subsp. lactis ATCC 11454 (Fig. 1A). Moreover three strains also produced an amplicon of 545 bp-fragment for lactoccocin B (Fig. 1B). No positive amplification for lacticin 481 and lactoccocins A and M genes was obtained with the primers used. Sequencing of the PCR-amplified fragments confirmed the presence of the nisin structural gene for all Lactococcus strains. Interestingly, three strains were shown to harbour the lactococcin B structural gene. The presence of genes encoding for nisin and lactococcin B in the same strain was already described by Dal Bello et al. (2010) in L. lactis subsp. cremoris 40FL7 strain isolated from an artisanal ripened cheese made from cow's milk. Lactococcin B is a class II bacteriocin with approximately 5 KDa molecular weight that exclusively inhibits the growth of sensitive lactococci. It has bactericidal effect but its activity depends on the reduced state of Cys-24 residue (Venema et al.,1993). The producers strains have potential application in the dairy industry as they could be used as starters in cheese making to mediate lysis of natural starter strains in order to accelerate ripening and increase flavour development (Morgan, Ross, & Hill, 1997). In this work, the three isolates with the genetic determinants for both bacteriocins were isolated from raw goat's and ewe's milk, providing further proof of their importance as a source of technologically interesting LAB strains. The sequences obtained for the nisin structural gene were shown to be identical to that of L. lactis strain ATCC 11454 nisin gene (GenBank: M65089.1) for all bacteriocinogenic strains with the exception of one (6LS5) in which a nucleotide difference was observed. The nucleotide and predicted amino acid sequences of PCR-amplified fragments for nisin gene from L. lactis subsp. lactis 6LS5 is reported in Fig. 2. The nucleotide change was C-to-A transversion at position 148 resulting in an asparagine (AAT)

Fig. 1. Amplification of nisin (A) and lactococcin B (B) structural genes from L. lactis subsp. lactis isolated from Sardinian dairy products. Order: line M, 100 bp ladder from Sigma; lines 1e10 bacteriocin-producer strains 9FS16, 11FS16, 16FS16, 16FS16-48, 1LC18, 3LC39, 9/20234, 6LS5, 6/23898, 10/18771; line 11 L. lactis ATCC 11454 (nisin A producer strain); line 12, blank to which DNA was not added. Order (B): line 1e3 bacteriocin-producer strains 3LC39, 1LC18, 10/18771; line 4 blank to which DNA was not added.

residue at position 27 of the nisin peptide, instead of histidine (CAT). This modification corresponded to nisin Z, one of the five natural variants of nisin that have been previously described (De Kwaadsteniet et al., 2008; Mulders, Boerrigter, Rollema, Siezen, & de Vos, 1991). The deferred agar spot test method using MRS agar with reduced concentration of glucose was performed to obtain the inhibitory spectra of the nisin-producing L. lactis strains. Under these conditions, the ten strains showed antagonistic activity against a broad range of pathogenic and spoilage Gram-positive bacteria including isolates from raw milk and dairy products (Table 1). However, the inhibitory spectrum was not identical within the strains tested. Five strains (11FS16, 1LC18, 6/23898, 10/ 18771 and 6LS5) presented a broader spectrum of antimicrobial activity showing inhibitory activity against all tested Bacillus, Listeria, Staphylococcus, Clostridium and also Pseudomonas aeruginosa strains. This wide inhibitory spectrum may be very beneficial to the dairy industry if the selected strains were to be applied to cheese production. Considering the main characteristics of bacteriocins, the inhibitory activity against P. aeruginosa could be due to the production of other metabolites such as organic acids, hydrogen peroxide, diacetyl and/or unidentified bacteriocins (Alegría,
pez, & Mayo, 2010; Dal Bello et al., 2010; Delgado, Roces, Lo
les et al., 2007). Perin and Nero (2014) detected inhibitory Gonza activity by the agar spot test method against the strain P. aeruginosa ATCC 27853. This strain could be more susceptible to end products of glucose metabolism represented by not only lactate but also the mixed acid products formate, ethanol and acetate (Alakomi et al., 2000; Sloss, Cumberland, & Milner, 1993). Further characterization of the bacteriocinogenic strains was carried out in order to evaluate their potential to be used as indigenous starter cultures (Table 3). A certain degree of variability was observed for some technological and enzymatic activities. The majority of the strains showed proteolytic activity on casein agar after 24 h of incubation at 30  C. As expected, none of the strains produced lypolitic reactions on tributyrin agar. However, a lypolitic activity was observed on Tween 80 agar by the strains 3LC39. The strain 6/23898 produced diacetyl, a flavour compound derived from citrate metabolism, and was therefore assigned to biovar diacetylactis. All bacteriocinogenic strains were salt tolerant as they could grow in 6.5% NaCl. This atypical characteristic for Lactococcus species has been already observed in strains of dairy origin and confirmed the great adaptability of this species to different environmental conditions (Nomura, Kobayashi, Narita, Kimoto-Nira, & Okamoto, 2006; Piraino, Zotta, Ricciardi, McSweeney, & Parente, 2008; Rodríguez et al., 2000). With regard to acidifying activity in milk, lactococci strains comprised both slow and medium acidifiers. The strains 3LC39 and 16FS16 were found to be the strongest milk acidifier showing a pH drop of 1.88 and 1.81 units after 24 h, respectively. The remaining strains caused a pH decrease ranging between 1.06 and 1.76 units. These results are in agreement with other authors (Dal Bello et al., 2012) who observed similar variability in acid production among bacteriocinogenic L. lactis strains. The bacteriocinogenic L. lactis strains were also characterized by determining the enzymatic activities using the API ZYM kit (Table 4). The analysis was performed on cells in the stationary phase. Esterase (C4) and esterase-lipase (C8) were absent or weak, with the strains 6/23898, 9FS16, and 11FS16 showing the highest value of these enzyme activities. Among the strains no or very weak activity of proteases trypsin and a-chymotripsin were observed. However, five strains showed moderate leucine arylamidase (30 nmoles of hydrolysed substrate) and weak valine and/or cysteine arylamidase (5e20 nmoles of hydrolysed substrate). Esteraselipase (C4 and C8) and amino peptidases are important technological characteristics for LAB strains intended for use in the

M.B. Pisano et al. / Food Control 51 (2015) 1e8

5

Fig. 2. Nucleotide sequences of DNA 598-bp fragment containing nisA and nisB genes (structural nisgenes) of L. lactis subsp. lactis 6LS5 compared with the sequences of L. lactis ATCC 11454 nisin gene (Gene Bank:M65089.1) and predicted amino acid sequences of the nisin DNA codifying region.

manufacturing of cheeses because they may contribute to the degradation of fats and protein thereby increasing short chain fatty and free amino acids concentration which might affect cheese characteristics, nutritional value and aroma (Herreros, Fresno, Gonz
ales, &Tornadijo, 2003; McSweeney & Sousa, 2000). Alkaline phosphatase was low or absent among all strains. In contrast, a strong/moderate acid phosphatase and phosphohydrolase activities were observed in most of the strains. These enzymes are essential for the hydrolysis of phosphopetides during cheese ripening. Almost all the strains exhibited a strong b-galactosidase activity which is the main enzymatic activity responsible for the hydrolysis of lactose and acidification of dairy products (Fox, Lucey, & Cogan, 1990). A high variability among the strains was found for a and b-glucosidase. In particular, two strains (6/23898 and 11FS16) were found to possess a strong a-glucosidase and a moderate b-glucosidase activities (>40 and 30 nmoles of hydrolysed substrate, respectively). Overall, the enzymatic profiles of bacteriocinogenic L. lactis strains were found to be in line with the API ZYM results of other authors who analysed L. lactis strains of
ndez, Alegria, Delgado, Martin, & Mayo, 2011; dairy origin (Ferna s-Paus, Kakouri, Montel, & Nomura et al., 2006; Parapouli, Delbe Samelis, 2013). The rep-PCR profiles of the bacteriocinogenic L. lactis strains generated with primer (GTG)5 produced the UPGMA dendrogram shown in Fig. 3. The type and references strains L. lactis subsp. lactis ATCC 11454, L. lactis subsp. cremoris ATCC 19257T and E. faecalis

ATCC 19433T and four bacteriocin-negative L. lactis subsp. lactis strains were included in the analysis for comparison purpose. The repeatability of the rep-PCR fingerprints was assessed by comparing the profiles of L. lactis ATCC 11454 and E. faecalis ATCC 19433 obtained from two separate cultures of the same strain (a and b). The similarity of the electrophoresis patterns was greater than 95% for both strains indicating a very high level of repeatability of the method. The dendrogram shows two main clusters with a similarity coefficient below 40%. Cluster A was comprised of E. faecalis ATCC 19433 from duplicate DNA extractions and L. lactis subp. cremoris ATCC 19257. The ten bacteriocinogenic L. lactis strains, the reference strain ATCC 11454 nisin producer and the three autochthonous (3M17LS5, 1M17LS6, 4FS1748) and one commercial (MOS562DC) bacteriocin-negative strains were grouped in cluster B. Cluster B was further divided into two sub-clusters (B1 and B2). B1 is composed of the bacteriocin-producing strains and the reference strain ATCC 11454 (nisin A producer). It is worth noting that the strains of this sub-cluster share 60% similarity, six of them being closely related to the reference strain (82% similarity). Subcluster B2 is composed of two bacteriocin-negative strains 3M17LS5 and 1M17LS6 that share 87.4% similarity. Two other bacteriocin-negative strains (4FS1748, MOS562DC) fell completely out side of the sub-clusters due to their low similarity (42 and 38%, respectively) with other strains. These genotyping data confirmed the high degree of heterogeneity of L. lactis species previously observed in other studies (Dal

6

M.B. Pisano et al. / Food Control 51 (2015) 1e8

Table 3 Technological characteristics of bacteriocigenic L. lactis strains. Strains

Casein hydrolysis

Lipolytic activitya

Citrate utilization

Diacetyl production

Salt tolerance (6.5% NaCl)

Acidifying activityb

DpH (6 h) þ þ  þ þ þ þ  þ 

16FS16 9FS16 11FS16 6LS5 1LC18 3LC39 9/20234 10/18771 16FS16-48 6/23898 a b

/ / / / / /þ / / / /

  þ       þ

         þ

þ þ þ þ þ þ þ þ þ þ

0.98 0.55 0.65 0.77 0.70 0.37 0.5 0.71 1.04 0.99

± ± ± ± ± ± ± ± ± ±

0.04 0.11 0.01 0.01 0.06 0.08 0.18 0.05 0.14 0.18

DpH (24 h) 1.81 1.34 1.29 1.49 1.13 1.88 1.30 1.06 1.76 1.70

± ± ± ± ± ± ± ± ± ±

0.10 0.08 0.15 0.21 0.17 0.20 0.14 0.02 0.17 0.22

On Tributyrin agar/Tween 80 agar. Values presented are means ± SD of two replicate evaluations for each strain.

Table 4 Enzymatic profiles of whole cells of bacteriocigenic L. lactis strains detected by the API-ZYM system. Enzyme tested

Alcaline phosphatase Esterase (C4) Esterase-Lipase (C8) Lipase (C14) Leucine arylamidase Valine arylamidase Cystine arylamidase Trypsin a-Chymotrypsin Acid phosphatase Naphthol-AS-BI-phosphohydrolase a-galactosidase b-galactosidase b-glucuronidase a-glucosidase b-glucosidase N-acetyl-b-glucosaminidase a

Strainsa 6/23898

1LC18

3LC39

9FS16

9/20234

10/18771

6LS5

16FS16

11FS16

16FS16-48

5 20 20 10 30 10 20 5 5 30 30 20 >40 5 >40 30 5

20 0 5 0 0 0 0 0 0 20 20 0 >40 5 0 10 0

20 0 0 5 10 0 0 0 5 >40 20 0 >40 0 0 30 0

20 20 20 0 5 5 5 5 5 >40 >40 10 >40 10 30 30 5

20 0 0 5 0 0 0 0 0 >40 >40 0 20 0 0 0 0

0 0 10 5 30 5 5 0 0 >40 20 5 >40 5 10 20 0

0 0 10 0 5 0 0 0 0 >40 >40 0 30 0 5 20 0

0 0 5 5 30 0 0 0 5 30 30 5 >40 5 5 5 0

5 20 20 5 30 5 5 0 5 30 >40 5 >40 5 >40 30 0

20 0 0 10 30 10 0 0 5 30 >40 5 >40 5 5 30 0

Activity expressed as the approximate nanomoles of hydrolysed substrate after 24 h of incubation at 30  C. Strains were all negative for a-mannosidase and a-fucosidase.

Fig. 3. Dendrogram obtained by cluster analysis of rep-PCR fingerprints of bacteriocinogenic L. lactis strains isolated from Sardinian dairy products.

M.B. Pisano et al. / Food Control 51 (2015) 1e8

Bello et al., 2010; Parapouli et al., 2013) and allowed to differentiate between the L. lactis strains of the subspecies lactis phenotype which produce nisin, confirming the discriminatory power of the (GTG)5-PCR in typing at species and subspecies level (Dal Bello et al., 2010). 4. Conclusions The results of this study confirmed the inhibitory effect of all bacteriocinogenic L. lactis subsp. lactis strains towards L. monocytogenes which was not restricted to the type strains but was also observed against one dairy isolate. The bacteriocinogenic strains also inhibited the growth of two dairy isolates of Listeria ivanovii that is considered a pathogenic species for ruminant
zquez-Boland et al., 2001) and an opportunistic human path(Va ogen because of its potential to cause bacteraemia in immunocompromised and debilitated individuals (Guillet et al., 2010). Among spoilage bacteria, they inhibited Bacillus and Clostridium species, in particular, C. tyrobutyricum and Clostridium sporogenes, two species frequently involved in spoilage and late blowing

mez-Torres, Herna
ndez, and Avila cheese. Recently, Garde, Go (2014) have pointed out that nisin has the potential to control Clostridium perfringens. Further studies, using suitable nisin producing strains for in situ production, may be performed to further evaluate this potential. The bacteriocinogenic isolates from Sardinian dairy products described in this work may be used as starter, co-starter or protective adjunct cultures in the manufacturing of cheese. Laboratory-scale cheese making trials using these strains as starter or co-starter are currently in progress in order to assess their technological performance and confirm their ability to counteract the growth of L. monocytogenes and other food-borne pathogens and spoilage bacteria. Acknowledgements This study was in part founded by Regione Autonoma Sardegna (RAS L.R. 7/2007). Silvia Viale was supported by a Grant from P.O. Sardegna FSE 2007e2013. The authors thank Dr. Germano Orrù (DNA Sequencing Service, AOU- Cagliari, Department of Surgical Sciences, University of Cagliari, Italy) for his valuable support. References Alakomi, H. L., Skytt€ a, E., Saarela, M., Mattila-Sandholm, T., Latva-Kala, K., & Helander, I. M. (2000). Lactic acid permeabilizes Gram-negative bacteria by disrupting the outer membrane. Applied and Environmental Microbiology, 66(5), 2001e2005.
pez, B., & Mayo, B. (2010). Bacteriocins produced Alegría, A., Delgado, S., Roces, C., Lo by wild Lactococcus lactis strains isolated from traditional, starter-free cheeses made of raw milk. International Journal of Food Microbiology, 143(1e2), 61e66. Beresford, T. R., Fitzimons, N. L., & Cogan, T. M. (2001). Recent advances in cheese microbiology. International Dairy Journal, 11(4e7), 259e274. Bouksaim, M., Lacroix, C., Audet, P., & Simard, R. E. (2000). Effects of mixed starter composition on nisin Z production by Lactococcus lactis subsp. lactis biovar. diacetylactis UL 719 during production and ripening of Gouda cheese. International Journal of Food Microbiology, 59(3), 141e156.
zquez, J. (2006). Campos, C. A., Rodríguez, O., Calo-Mata, P., Prado, M., & Barros-Vela Preliminary characterization of bacteriocins from Lactococcus lactis, Enterococcus faecium and Enterococcus mundtii strains isolated from turbot (Psetta maxima). Food Research International, 39(3), 356e364. Cosentino, S., Fadda, M. E., Deplano, M., Melis, R., Pomata, R., & Pisano, M. B. (2012). Antilisterial activity of nisin-like bacteriocin producing Lactococcus lactis subsp. lactis isolated from traditional sardinian dairy products. BioMed Research International, 1e8. Dal Bello, B., Cocolin, L., Zeppa, G., Field, D., Cotter, P. D., & Hill, C. (2012). Technological characterization of bacteriocin producing Lactococcus lactis strains employed to control Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology, 153(1e2), 58e65.

7

Dal Bello, B., Rantsiou, K., Bellio, A., Zeppa, G., Ambrosoli, R., Civera, T., et al. (2010). Microbial ecology of artisanal products from North west of Italy and antimicrobial activity of the autochthonous populations. LWT- Food Science and Technology, 43(7), 1151e1159. Dal Bello, B., Zeppa, G., Bianchi, D. M., Decastelli, L., Traversa, A., Gallina, S., et al. (2013). Effect of nisin-producing Lactococcus lactis starter cultures on the inhibition of two pathogens in ripened cheeses. International Journal of Dairy Technology, 66(4), 468e477. De Kwaadsteniet, M., Ten Doeschate, K., & Dicks, L. M. (2008). Characterization of the structural gene encoding nisin F, a new lantibiotic produced by a Lactococcus lactis subsp. lactis isolated from freshwater catfish (Clariasgariepinus). Applied and Environmental Microbiology, 74(2), 547e549. Delves-Broughton, J., Blackburn, P., Evans, R. J., & Hugenholtz, J. (1996). Applications of the bacteriocin, nisin. Antonie van Leeuwenhoek, 69(2), 193e202.
ndez, E., Alegría, A., Delgado, S., Martín, M. C., & Mayo, B. (2011). Comparative Ferna phenotypic and molecular genetic profiling of wild Lactococcus lactis subsp. lactis strains of the L. lactis subsp. lactis and L. lactis subsp. cremoris genotypes, isolated from starter-free cheeses made of raw milk. Applied and Environmental Microbiology, 77(15), 5324e5335. Fox, P. F., Lucey, J. A., & Cogan, T. M. (1990). Glycolysis and related reactions during cheese manufacture and ripening. Critical Reviews in Food Science and Nutrition, 29(4), 237e253. Galeslod, T. E., Hassing, F., & Stadhouders, J. (1961). Agar medium for the isolation and enumeration of aroma bacteria in starters. Netherlands Milk and Dairy Journal, 15, 127e129.
lvez, A., Lo
pez, R. L., Abriouel, H., Valdivia, E., & Omar, N. B. (2008). Application of Ga bacteriocins in the control of food borne pathogenic and spoilage bacteria. Critical Reviews in Biotechnology, 28(2), 125e152.

mez-Torres, N., Herna
ndez, M., & Avila, Garde, S., Go M. (2014). Susceptibility of Clostridium perfringens to antimicrobials produced by lactic acid bacteria: reuterin and Nisin. Food Control, 44, 22e45. Gevers, D., Huys, G., & Swings, J. (2001). Applicability of rep-PCR fingerprinting for identification of Lactobacillus species. FEMS Microbiology Letters, 205(1), 31e36. re, K. (2004). Antilisterial activity of lactic Ghrairi, T., Manai, M., Berjeaud, J. M., & Fre acid bacteria isolated from rigouta, a traditional Tunisian cheese. Journal of Applied Microbiology, 97(3), 621e628.
les, L., Sandoval, H., Sacrist
Gonza an, N., Castro, J., Fresno, J., & Tornadijo, M. (2007). Identification of lactic acid bacteria isolated from Genestoso cheese throughout ripening and study of their antimicrobial activity. Food Control, 18(6), 716e722. Guillet, C., Join-Lambert, O., Le Monnier, A., Leclercq, A., Mechaï, F., MamzerBruneel, M. F., et al. (2010). Human Listeriosis caused by Listeria ivanovii. Emerging Infectious Diseases, 16(1), 136e138. Herreros, M. A., Fresno, J. M., Gonz
ales Prieto, M. J., & Tornadijo, M. E. (2003). Technological characterization of lactic acid bacteria isolated from Armada cheese (a Spanish goats milk cheese). International Dairy Journal, 13(6), 469e479. McSweeney, P. L. H., & Sousa, M. J. (2000). Biochemical pathways for the production of flavor compounds in cheeses during ripening. Lait, 80, 293e324. Morgan, S., Ross, R. P., & Hill, C. (1997). Increasing starter cell lysis in Cheddar cheese using a bacteriocin-producing adjunct. Journal of Dairy Science, 80(1), 1e10. Mulders, J. W. M., Boerrigter, I. J., Rollema, H. S., Siezen, R. J., & de Vos, W. (1991). Identification and characterization of the lantibiotic nisin Z, a natural nisin variant. European Journal of Biochemistry, 201(3), 581e584. Nes, I. F., & Johnborg, O. (2004). Exploration of antimicrobial potential in LAB by genomics. Current Opinion in Biotechnology, 15(2), 100e104. Nomura, M., Kobayashi, M., Narita, T., Kimoto-Nira, H., & Okamoto, T. (2006). Phenotypic and molecular characterization of Lactococcus lactis from milk and plants. Journal of Applied Microbiology, 101(2), 396e405. s-Paus, C., Kakouri, A. I., Montel, M. C., & Samelis, J. (2013). Parapouli, M., Delbe Characterization of a wild, novel nisin A-producing Lactococcus strain with an L. lactis subsp. cremoris genotype and an L. lactis subsp. lactis phenotype, isolated from Greek raw milk. Applied and Environmental Microbiology, 79(11), 3476e3484. Perin, L. M., & Nero, L. A. (2014). Antagonistic lactic acid bacteria isolated from goat milk and identification of a novel nisin variant Lactococcus lactis. BMC Microbiology, 14, 36e44. Piraino, P., Zotta, T., Ricciardi, A., McSweeney, P. L. H., & Parente, E. (2008). Acid production, proteolysis, autolytic, and inhibitory properties of lactic acid bacteria isolated from pasta filata cheeses: a multivariate screening study. International Dairy Journal, 18(1), 81e92. Pisano, M. B., Fadda, M. E., Deplano, M., Corda, A., & Cosentino, S. (2006). Microbiological and chemical characterization of Fiore Sardo, a traditional Sardinian cheese made from ewe's milk. International Journal of Dairy Technology, 59(3), 171e179. ~ ez, M., & Medina, M. (2000). Diversity of Rodríguez, E., Gonz
ales, B., Gaya, P., Nun bacteriocins produced by lactic acid bacteria isolated from raw milk. International Dairy Journal, 10(1e2), 7e15. Salama, M., Sandine, W., & Giovannoni, S. (1991). Development and application of oligonucleotide probes for identification of Lactococcus lactis subsp. cremoris. Applied and Environmental Microbiology, 57(5), 1313e1318. Schillinger, U., & Lücke, F. K. (1989). Antibacterial activity of Lactobacillus sake isolated from meat. Applied Environmental Microbiology, 55(8), 1901e1906.

8

M.B. Pisano et al. / Food Control 51 (2015) 1e8

Sloss, J. M., Cumberland, N., & Milner, S. M. (1993). Acetic acid used for the elimination of Pseudomonas aeruginosa from burn and soft tissue wounds. Journal of the Royal Army Medical Corps, 139, 49e51. Stiles, M. E., & Holzapfel, W. H. (1997). Lactic acid bacteria of foods and their current taxonomy. International Journal of Food Microbiology, 36(1), 1e29.
zquez-Boland, J. A., Kuhn, M., Berche, P., Chakraborty, T., DominguezVa Bernal, G., Goebel, W., et al. (2001). Listeria pathogenesis and molecular virulence determinants. Clinical Microbiology Reviews, 14, 584e640.

Venema, K., Abee, T., Haandrikman, A. J., Leenhouts, K. J., Kok, J., Konings, W. N., et al. (1993). Mode of action of Lactococcin B, a thiol-Activated bacteriocin from Lactococcus lactis. Applied Environmental Microbiology, 59(4), 1041e1048. Venema, K., Venema, G., & Kok, J. (1995). Lactococcal bacteriocins: mode of action and immunity. Trends in Microbiology, 3(8), 299e304. Wouters, J. T. M., Ayad, E., Hugenholtz, J., & Smit, G. (2002). Microbes from raw milk for fermented dairy products. International Dairy Journal, 12(2e3), 91e109.