- Email: [email protected]
Molecular identification of genus Scylla (Decapoda: Portunidae) based on DNA barcoding and polymerase chain reaction
Biochemical Systematics and Ecology 41 (2012) 41–47
Contents lists available at SciVerse ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Molecular identification of genus Scylla (Decapoda: Portunidae) based on DNA barcoding and polymerase chain reaction Hongyu Ma, Chunyan Ma, Lingbo Ma* Key Laboratory of East China Sea and Oceanic Fishery Resources Exploitation, Ministry of Agriculture, East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Jungong road 300#, Shanghai 200090, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 August 2011 Accepted 17 December 2011 Available online 7 January 2012
In this study, we first examined the utility of COI sequences as DNA barcoding for identification of genus Scylla, which includes four species: Scylla paramamosain, Scylla serrata, Scylla tranquebarica and Scylla olivacea. The mean intraspecific Kimura 2-parameter distances were 0.003 for S. paramamosain, 0.014 for S. serrata, 0.017 for S. olivacea and 0.006 for S. tranquebarica. The interspecific K2P distances were higher than the intraspecific distances: the minimum interspecific distance (0.092) was between S. paramamosain and S. tranquebarica while the maximum interspecific distance (0.196) was between S. paramamosain and S. olivacea. No overlap was found between intraspecific and interspecific distances, suggesting the existence of a distinct barcoding gap. The maximum-likelihood (ML) phylogenetic tree consisted of four distinct clusters, each containing individuals from one species only. Furthermore, a molecular species identification method was developed successfully, by which these four species could be identified rapidly and effectively from each other though a PCR reaction. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Scylla DNA barcoding COI Molecular identification PCR
1. Introduction DNA barcoding, i.e. the analysis of a short and standardized region of mitochondrial cytochrome c oxidase I (COI) gene (Hebert et al., 2003a), has become a popular technique for identification of a wide variety of species within a known taxonomic framework, and linking different biological life stages of the same species (Schindel and Miller, 2005; Puillandre et al., 2009; Feng et al., 2011). Many animals have been successfully investigated using DNA barcoding, such as fish (Persis et al., 2009), birds (Yang et al., 2010), ommastrephid squids (Wakabayashi et al., 2006), bivalve molluscs (Blair et al., 2006), stomatopod (Tang et al., 2010), thrips (Glover et al., 2010), hoverflies (Stahls et al., 2009), and turtles (Naro-Maciel et al., 2010). Ideally, there is a barcoding gap between intraspecific and interspecific divergence (Davison et al., 2009). The interspecific genetic distance was demonstrated to be larger than 0.02 in more than 98% of closely related species pairs (Hebert et al., 2003a). The genus Scylla is a commercially important crab resource for fisheries and aquaculture. It is widely distributed over vast geographic areas ranging from southeastern and eastern Africa to Southeast Asia and Indo-Pacific regions (Fuseya and Watanabe, 1996). For a long time, the classification for Scylla has been controversial. Estampador (1949) assigned Scylla to four taxa (three species and one subspecies) including Scylla serrata, Scylla oceanica, Scylla tranquebarica, and S. serrata var. paramamosain, whereas Stephenson and Campbell (1960) suggested only one species (S. serrata) for this genus. Afterwards, Keenan et al. (1998) extensively revised the taxonomy of genus Scylla using both morphometric and genetic approaches, and divided this genus into four distinct species: S. serrata, S. olivacea, S. tranquebarica and Scylla paramamosain. * Corresponding author. Tel.: þ86 21 65809298. E-mail address: [email protected] (L. Ma). 0305-1978/$ – see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.bse.2011.12.016
42
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Among these four species, S. paramamosain is the most common species distributed in China (Ma et al., 2006), however, it was erroneously named S. serrata for a long time (Huang et al., 2006; Wang et al., 2007). Therefore, it is crucial to develop an effective method for unambiguously identifying these broodstocks. Morphological approach is thought to be problematic for the identification of closely related species, especially when morphological features are missing or misleading (Hebert et al., 2003b). Species-diagnostic RAPD markers were developed, by which three species (S. serrata, S. oceanica and S. tranquebarica) can be identified, but not including S. paramamosain (Klinbunga et al., 2000). Moreover, based on 16S rDNA, all four species can be identified, but this procedure is time-consuming (Imai et al., 2004). In this study, we first examined the utility of mtDNA COI gene as DNA barcoding for identification of genus Scylla, including S. paramamosain, S. serrata, S. olivacea and S. tranquebarica. Then we developed a rapid and effective method for species identification based on the polymerase chain reaction. 2. Materials and methods 2.1. Mitochondrial COI gene sequences collection For S. paramamosain, 62 specimens were collected from four different localities in Hainan Island of China: Haikou (N ¼ 16), Wenchang (N ¼ 16), Sanya (N ¼ 15), and Dongfang (N ¼ 15). Genomic DNA was extracted from muscle tissue using the traditional proteinase K and phenol–chloroform extraction protocol as described by Ma et al. (2009). A pair of primers (COI-s: 50 -TTGACCCTGCTGGCGGTGG-30 and COI-a: 50 -CAATTGAGGAGGGTAAAAATGGAGTAA-30 ) were designed based on the mtDNA sequence of S. paramamosain from GenBank database (FJ827761). Polymerase chain reaction (PCR) was performed on a Peltier Thermal Cycler (PTC-200) in 25 ml total volume that included 0.4 mM each primer, 0.2 mM each dNTP, 1PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA under the following conditions: one cycle of denaturation at 94 C for 4 min; 37 cycles of 30 s at 94 C, 50 s at 54 C, and 50 s at 72 C. As a final step, products were extended for 7 min at 72 C. The PCR products were separated on 1.5% agarose gels to check the success of the PCR reaction, and then directly sequenced in both directions. For the three other species, COI gene sequences were downloaded from GenBank database on 16 December 2009. The details of these sequences are shown in Table 1. 2.2. Data analysis All sequences of four species were edited and spliced using software DNAstar version 7.1 (DNAstar, Madison, WI, USA). Haplotypes were identified using software Dna SP version 4.1 (Rozas et al., 2003). Pairwise sequence divergences were estimated using the Kimura 2-parameter (K2P) model (Kimura, 1980) with the pairwise deletion option in software MEGA 4.0 (Tamura et al., 2007). A maximum-likelihood (ML) phylogenetic tree of individual haplotypes was constructed using software PAUP* version 4.0 (Swofford, 2003) with a heuristic search option, stepwise addition, 50 replications and tree bisection reconnection (TBR) branch swapping. Likelihood ratio tests were implemented in program Modeltest version 3.7 to chose the best-fit model and estimate parameters. 2.3. Development of a PCR-based species identification method Based on the COI sequences of the four species, a pair of conserved primers (Sc-F and Sc-R) was designed that can amplify a PCR product with 325 bp in length at each species. This product could be considered as a positive control to confirm the PCR is working (Fig. 1 and Table 2). Additionally, three reverse primers were designed according to the species-specific nucleotides near the 30 end of primer binding region (Fig. 1 and Table 2) for species-specific amplification when paired with the conserved forward primer Sc-F. The PCR products of the four pairs of primers are different in length, so the four Scylla species can be Table 1 List of COI sequences, GenBank accession numbers and the geographic source of samples. N indicates the number of sequences analyzed. Species
N
GenBank accession no.
Source
S. paramamosain S. serrata
23 24
HQ687226-HQ687244, HQ687254-HQ687257 AY373341-AY373350 AF279313, AF279323, AF279325, AF279329-AF279331 AF097002, AF097003, AF097005, AF097014, AF097016-AF097018, GU055514 EF203942 AB114217, AB114218 AY373356 FJ827760, NC_012569 EU274297 AB114221, AB114222 AY373353, AY373354 FJ827759, NC_012567
China Australia Indian Ocean Unclear China Japan Australia Unclear China Philippines Australia Unclear
S. olivacea
6
S. tranquebarica
7
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
43
Fig. 1. Nucleotide sequences of mitochondrial cytochrome c oxidase I (COI) gene of the four species of Scylla. Nucleotides identical to the sequence on the top are shown with dots. The primer binding regions are boxed and the corresponding primer names are shown too.
44
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Table 2 Characterization of primers used to identify the four species of genus Scylla. Primers Sc-F and Sc-R are conserved and amplify PCR products of the same length in all species as a positive control. The primers ScPa-R, ScSe-R and ScOl-R are reverse species-specific primers, that, when paired with the forward primer ScF, can unambiguously identify S. paramamosain, S. serrata and S. olivacea, respectively. Name
Primer sequence (50 -30 )
Forward (F) or Reverse (R)
Product size (bp)
Identification of species
Sc-F Sc-R ScPa-R ScSe-R ScOl-R
GAYACDCGAGCYTAYTTTACATC TAGGATTWAGRGAYAAACCKGTAAA AACATAGTGGAAATGGGCTATG AATAAATCCTAAAGCCCATAATACA GTGTCATGTAGGATAATATCGACG
F R R R R
– 325 243 138 212
– All four species S. paramamosain only S. serrata only S. olivacea only
Table 3 Average and ranges of Kimura 2-parameter distance values within four Scylla species. N indicates the number of sequences analyzed; AD indicates average distance, SE indicates standard error. Species
N
AD SE
S. S. S. S.
23 24 6 7
0.003 0.014 0.017 0.006
paramamosain serrata olivacea tranquebarica
0.001 0.004 0.004 0.002
Minimum
Maximum
0.000 0.000 0.000 0.000
0.011 0.029 0.026 0.017
identified from each other through agarose gels electrophoresis. PCR reactions were conducted in a total volume of 25 ml and included 0.4 mM each of the five primers (one forward and four reverses), 0.2 mM each dNTP, 1 PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA under the following conditions: one cycle of denaturation at 94 C for 4 min; 30 cycles of 30 s at 94 C, 50 s at 53 C, and 50 s at 72 C. As a final step, products were extended for 7 min at 72 C. The PCR products were separated on 1.5% agarose gels with a DL1000 DNA marker. 3. Results 3.1. Collection of COI sequences For S. paramamosain, 62 COI homologous sequences were obtained. For the three other species, 37 COI sequences with different lengths were downloaded from GenBank database (24 were for S. serrata, six for Scylla olivacea, and seven for S. tranquebarica). Further, the consensus sequence with 359 bp in length was used for the further barcoding analysis. The number of haplotype were 10 for S. paramamosain, 16 for S. serrata, five for S. olivacea and three for S. tranquebarica, respectively.
3.2. Intraspecific and interspecific divergence All 62 sequences of S. paramamosain and 37 sequences of three other species were aligned and compiled, no insertion or deletion sites were found. The intraspecific distances ranged from 0.000 to 0.011 for S. paramamosain (average 0.003), from 0.000 to 0.029 for S. serrata (average 0.014), from 0.000 to 0.026 for S. olivacea (average 0.017), and from 0.000 to 0.017 for S. tranquebarica (average 0.006) (Table 3). The maximum interspecific distance (0.196) was between S. paramamosain and S. olivacea, while the minimum distance (0.092) was between S. paramamosain and S. tranquebarica (Table 4). No overlaps between intraspecific and interspecific distances were found (the barcoding gaps are shown in Fig. 2). The largest barcoding gap was present in S. olivacea, while the smallest one existed in S. serrata. The ML phylogenetic tree is shown in Fig. 3. Distinct clusters corresponding to species were found, with high bootstrap support. The nearest relationship was observed between S. paramamosain and S. tranquebarica, while the largest relationship was found between S. paramamosain and S. olivacea.
Table 4 Interspecific Kimura 2-parameter distance values, with standard errors, among four species of genus Scylla.
S. S. S. S.
paramamosain serrata olivacea tranquebarica
S. paramamosain
S. serrata
S. olivacea
S. tranquebarica
– 0.118 0.017 0.196 0.023 0.092 0.016
– – 0.178 0.022 0.096 0.015
– – – 0.147 0.020
– – – –
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
45
Fig. 2. The range of Kimura 2-parameter distances for the four species. White bars (intraspecific) and gray bars (interspecific) indicate distance ranges as percentages (%). Black circles represent the average distance observed within the range.
3.3. Development of a PCR-based species identification method A total of eleven, five and 22 species-specific nucleotide sites were found for S. paramamosain, S. serrata and S. olivacea, respectively, whereas, no specific site was found in case of S. tranquebarica. A pair of conserved primers (Sc-F and Sc-R) which can give a product as positive control were designed. In addition, three species-specific reverse primers when paired with the forward primer Sc-F can give species-specific bands were designed too. The results of species identification based on PCR with the above five primers are shown in Fig. 4. A common fragment of 325 bp in length was observed for all four species, while three species-specific fragments with different lengths (243 bp, 213 bp and 137 bp) each were observed only for S.
Fig. 3. The maximum-likelihood (ML) phylogenetic tree of individual haplotypes of the four species of Scylla.
46
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Fig. 4. Agarose gel showing the species-specific PCR products of the four species. Lane M: DL1000 DNA marker; lanes 1–3: S. paramamosain, lanes 4–6: S. olivacea, lanes 7–9: S. serrata, and lanes10–12: S. tranquebarica. ‘A’ indicates the bands amplified using the two conserved primers Sc-F and Sc-R that was present in all individuals of the four species as a positive control. ‘B’ indicates the band amplified using primer Sc-F and ScPa-R present only in S. paramamosain. ‘C’ indicates the band amplified using primer Sc-F and ScOl-R present only in S. olivacea. ‘D’ indicates the band amplified using primer Sc-F and ScSe-R present only in S. serrata. Because no species-specific site was found in COI sequence of S. tranquebarica, we couldn’t design a reverse primer for this species.
paramamosain, S. olivacea and S. serrata, respectively. This result indicates that we have successfully developed a rapid and effective PCR-based species identification method in the genus Scylla. 4. Discussion The rapid and effective identification of closely related species is important for scientific researches and artificial production. In this study, we first confirmed the utility of DNA barcoding for identification of genus Scylla, and then developed a PCR-based method for identification. For the four species, all interspecific distances were higher than 0.02, in the range from 0.092 to 0.196. A distinct barcoding gap was found between intraspecific and interspecific distances in each species and no intraspecific–interspecific distance overlap was detected. All that indicated COI gene sequence can provide sufficient variation as DNA barcoding for identification of the four species of genus Scylla. The phylogenesis of genus Scylla was analyzed using ML method, which indicated that all four species formed monophyletic clusters, and S. paramamosain and S. tranquebarica was genetically nearest, while S. paramamosain and S. olivacea was genetically farthest. This result was in accord with the previous studies (Keenan et al., 1998; Ma et al., 2006). A PCR-based species identification method was developed in this study that showed more advantages than DNA barcoding, as the former only needs PCR amplification, while the latter needs not only a PCR amplification but also sequencing. Based on the different lengths of PCR products, we can easily identify these four species of genus Scylla. This method is also more time-saving and procedure-simple than the way based on 16S rDNA (Imai et al., 2004). In conclusion, we confirmed that COI gene is suitable for DNA barcoding in genus Scylla, and developed a PCR-based method that could be used rapidly and effectively for identification of these four species. Both methods will be useful for linking different developmental stages and the planning of hybridization breeding of genus Scylla. Acknowledgments This research was supported by the National Non-Profit Institutes (East China Sea Fisheries Research Institute) (No. 2011M05), the National Natural Science Foundation of China (No. 31001106), and the Science and Technology Commission of Shanghai Municipality (No. 10JC1418600). References Blair, D., Waycott, M., Byrne, L., Dunshea, G., Smith-Keune, C., Neil, K.M., 2006. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers. Mar. Biotechnol. 8, 380–385. Davison, A., Blackie, R.L.E., Scothern, G.P., 2009. DNA barcoding of stylommatophoran land snails: a test of existing sequences. Mol. Ecol. Resour. 9, 1092–1101. Estampador, E.P., 1949. Studies on Scylla (Crustacea: Portunidae). I. Revision of the genus. Philipp. J. Sci. 78, 95–108. Feng, Y., Li, Q., Kong, L., Zheng, X., 2011. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Mol. Biol. Rep. 38, 291–299. Fuseya, R., Watanabe, S., 1996. Genetic variability in the mud crab genus Scylla (Brachyura: Portunidae). Fisheries Sci. 62, 705–709. Glover, R.H., Collins, D.W., Walsh, K., Boonham, N., 2010. Assessment of loci for DNA barcoding in the genus Thrips (Thysanoptera: Thripidae). Mol. Ecol. Resour. 10 (1), 51–59. Hebert, P.D.N., Ratnasignham, S., deWaard, J.R., 2003a. Barcoding animal life: cytochrome c oxidase subunit I divergences among closely related species. Proc. R. Soc. B 270, S96–S99. Hebert, P.D.N., Cywinska, A., Ball, S.L., deWaard, J.R., 2003b. Biological identification through DNA barcodes. Proc. R. Soc. B. 270, 313–321. Huang, W.S., Wang, K.J., Yang, M., Cai, J.J., Li, S.J., Wang, G.Z., 2006. Purification and part characterization of a novel antibacterial protein Scygonadin, isolated from the seminal plasma of mud crab, Scylla serrata (Forskal, 1775). J. Exp. Mar. Biol. Ecol. 339, 37–42. Imai, H., Cheng, J.H., Hamasaki, K., Numachi, K.I., 2004. Identification of four mud crab species (genus Scylla) using ITS-1 and 16S rDNA markers. Aquat. Living Resour. 17, 31–34.
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
47
Keenan, C.P., Davie, P.F., Mann, D.L., 1998. A revision of the genus Scylla de Haan, 1833. Raffles Bull. Zool. 46, 217–245. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Klinbunga, S., Boonyapakdee, A., Pratoomchat, B., 2000. Genetic diversity and species-diagnostic markers of mud crabs (genus Scylla) in eastern Thailand determined by RAPD analysis. Mar. Biotechnol. 2, 180–187. Ma, H.Y., Yang, J.F., Su, P.Z., Chen, S.L., 2009. Genetic analysis of gynogenetic and common populations of Verasper moseri using SSR markers. Wuhan Univ. J.Nat. Sci. 14, 267–273. Ma, L.B., Zhang, F.Y., Ma, C.Y., Qiao, Z.G., 2006. Scylla paramamosain (Estampador) the most common mud crab (genus Scylla) in China: evidence from mtDNA. Aquac. Res. 37, 1694–1698. Naro-Maciel, E., Reid, B., Fitzsimmons, N.N., Le, M., Desalle, R., Amato, G., 2010. DNA barcodes for globally threatened marine turtles: a registry approach to documenting biodiversity. Mol. Ecol. Resour. 10 (2), 252–263. Persis, M., Reddy, A.C.S., Rao, L.M., Khedkar, G.D., Ravinder, K., Nasruddin, K., 2009. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India. Mol. Biol. Rep. 36, 1733–1740. Puillandre, N., Strong, E.E., Bouchet, P., Boisselier, M.C., Couloux, A., Samadi, S., 2009. Identifying gastropod spawn from DNA barcodes: possible but not yet practicable. Mol. Ecol. Resour. 9, 1311–1321. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, 2496–2497. Schindel, D.E., Miller, S.E., 2005. DNA barcoding a useful tool for taxonomists. Nature 435, 17. Stahls, G., Vujic, A., Perez-Banon, C., Radenkovic, S., Rojo, S., Petanidou, T., 2009. COI barcodes for identification of Merodon hoverflies (Diptera, Syrphidae) of Lesvos Island, Greece. Mol. Ecol. Resour. 9, 1431–1438. Stephenson, W., Campbell, B., 1960. The Australian Portunids (Crustacea: Portunidae) IV: remaining genera. Aust. J. Mar. Freshwater Res. 11, 73–122. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (* and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA 4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tang, R.W.K., Yau, C., Ng, W., 2010. Identification of stomatopod larvae (Crustacea: Stomatopoda) from Hong Kong waters using DNA barcodes. Mol. Ecol. Resour. 10 (3), 439–448. Wakabayashi, T., Suzuki, N., Sakai, M., Ichii, T., Chow, S., 2006. Identification of ommastrephid squid paralarvae collected in northern Hawaiian waters and phylogenetic implications for the family Ommastrephidae using mtDNA analysis. Fisheries Sci. 72, 494–502. Wang, K.J., Huang, W.S., Yang, M., Chen, H.Y., Bo, J., Li, S.J., Wang, G.Z., 2007. A male-specific expression gene, encodes a novel anionic antimicrobial peptide, scygonadin, in Scylla serrata. Mol. Immunol. 44, 1961–1968. Yang, R., Wu, X., Yan, P., Li, X., 2010. Using DNA barcodes to identify a bird involved in a birdstrike at a Chinese airport. Mol. Biol. Rep. 37, 3517–3523.
Contents lists available at SciVerse ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Molecular identification of genus Scylla (Decapoda: Portunidae) based on DNA barcoding and polymerase chain reaction Hongyu Ma, Chunyan Ma, Lingbo Ma* Key Laboratory of East China Sea and Oceanic Fishery Resources Exploitation, Ministry of Agriculture, East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Jungong road 300#, Shanghai 200090, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 August 2011 Accepted 17 December 2011 Available online 7 January 2012
In this study, we first examined the utility of COI sequences as DNA barcoding for identification of genus Scylla, which includes four species: Scylla paramamosain, Scylla serrata, Scylla tranquebarica and Scylla olivacea. The mean intraspecific Kimura 2-parameter distances were 0.003 for S. paramamosain, 0.014 for S. serrata, 0.017 for S. olivacea and 0.006 for S. tranquebarica. The interspecific K2P distances were higher than the intraspecific distances: the minimum interspecific distance (0.092) was between S. paramamosain and S. tranquebarica while the maximum interspecific distance (0.196) was between S. paramamosain and S. olivacea. No overlap was found between intraspecific and interspecific distances, suggesting the existence of a distinct barcoding gap. The maximum-likelihood (ML) phylogenetic tree consisted of four distinct clusters, each containing individuals from one species only. Furthermore, a molecular species identification method was developed successfully, by which these four species could be identified rapidly and effectively from each other though a PCR reaction. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Scylla DNA barcoding COI Molecular identification PCR
1. Introduction DNA barcoding, i.e. the analysis of a short and standardized region of mitochondrial cytochrome c oxidase I (COI) gene (Hebert et al., 2003a), has become a popular technique for identification of a wide variety of species within a known taxonomic framework, and linking different biological life stages of the same species (Schindel and Miller, 2005; Puillandre et al., 2009; Feng et al., 2011). Many animals have been successfully investigated using DNA barcoding, such as fish (Persis et al., 2009), birds (Yang et al., 2010), ommastrephid squids (Wakabayashi et al., 2006), bivalve molluscs (Blair et al., 2006), stomatopod (Tang et al., 2010), thrips (Glover et al., 2010), hoverflies (Stahls et al., 2009), and turtles (Naro-Maciel et al., 2010). Ideally, there is a barcoding gap between intraspecific and interspecific divergence (Davison et al., 2009). The interspecific genetic distance was demonstrated to be larger than 0.02 in more than 98% of closely related species pairs (Hebert et al., 2003a). The genus Scylla is a commercially important crab resource for fisheries and aquaculture. It is widely distributed over vast geographic areas ranging from southeastern and eastern Africa to Southeast Asia and Indo-Pacific regions (Fuseya and Watanabe, 1996). For a long time, the classification for Scylla has been controversial. Estampador (1949) assigned Scylla to four taxa (three species and one subspecies) including Scylla serrata, Scylla oceanica, Scylla tranquebarica, and S. serrata var. paramamosain, whereas Stephenson and Campbell (1960) suggested only one species (S. serrata) for this genus. Afterwards, Keenan et al. (1998) extensively revised the taxonomy of genus Scylla using both morphometric and genetic approaches, and divided this genus into four distinct species: S. serrata, S. olivacea, S. tranquebarica and Scylla paramamosain. * Corresponding author. Tel.: þ86 21 65809298. E-mail address: [email protected] (L. Ma). 0305-1978/$ – see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.bse.2011.12.016
42
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Among these four species, S. paramamosain is the most common species distributed in China (Ma et al., 2006), however, it was erroneously named S. serrata for a long time (Huang et al., 2006; Wang et al., 2007). Therefore, it is crucial to develop an effective method for unambiguously identifying these broodstocks. Morphological approach is thought to be problematic for the identification of closely related species, especially when morphological features are missing or misleading (Hebert et al., 2003b). Species-diagnostic RAPD markers were developed, by which three species (S. serrata, S. oceanica and S. tranquebarica) can be identified, but not including S. paramamosain (Klinbunga et al., 2000). Moreover, based on 16S rDNA, all four species can be identified, but this procedure is time-consuming (Imai et al., 2004). In this study, we first examined the utility of mtDNA COI gene as DNA barcoding for identification of genus Scylla, including S. paramamosain, S. serrata, S. olivacea and S. tranquebarica. Then we developed a rapid and effective method for species identification based on the polymerase chain reaction. 2. Materials and methods 2.1. Mitochondrial COI gene sequences collection For S. paramamosain, 62 specimens were collected from four different localities in Hainan Island of China: Haikou (N ¼ 16), Wenchang (N ¼ 16), Sanya (N ¼ 15), and Dongfang (N ¼ 15). Genomic DNA was extracted from muscle tissue using the traditional proteinase K and phenol–chloroform extraction protocol as described by Ma et al. (2009). A pair of primers (COI-s: 50 -TTGACCCTGCTGGCGGTGG-30 and COI-a: 50 -CAATTGAGGAGGGTAAAAATGGAGTAA-30 ) were designed based on the mtDNA sequence of S. paramamosain from GenBank database (FJ827761). Polymerase chain reaction (PCR) was performed on a Peltier Thermal Cycler (PTC-200) in 25 ml total volume that included 0.4 mM each primer, 0.2 mM each dNTP, 1PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA under the following conditions: one cycle of denaturation at 94 C for 4 min; 37 cycles of 30 s at 94 C, 50 s at 54 C, and 50 s at 72 C. As a final step, products were extended for 7 min at 72 C. The PCR products were separated on 1.5% agarose gels to check the success of the PCR reaction, and then directly sequenced in both directions. For the three other species, COI gene sequences were downloaded from GenBank database on 16 December 2009. The details of these sequences are shown in Table 1. 2.2. Data analysis All sequences of four species were edited and spliced using software DNAstar version 7.1 (DNAstar, Madison, WI, USA). Haplotypes were identified using software Dna SP version 4.1 (Rozas et al., 2003). Pairwise sequence divergences were estimated using the Kimura 2-parameter (K2P) model (Kimura, 1980) with the pairwise deletion option in software MEGA 4.0 (Tamura et al., 2007). A maximum-likelihood (ML) phylogenetic tree of individual haplotypes was constructed using software PAUP* version 4.0 (Swofford, 2003) with a heuristic search option, stepwise addition, 50 replications and tree bisection reconnection (TBR) branch swapping. Likelihood ratio tests were implemented in program Modeltest version 3.7 to chose the best-fit model and estimate parameters. 2.3. Development of a PCR-based species identification method Based on the COI sequences of the four species, a pair of conserved primers (Sc-F and Sc-R) was designed that can amplify a PCR product with 325 bp in length at each species. This product could be considered as a positive control to confirm the PCR is working (Fig. 1 and Table 2). Additionally, three reverse primers were designed according to the species-specific nucleotides near the 30 end of primer binding region (Fig. 1 and Table 2) for species-specific amplification when paired with the conserved forward primer Sc-F. The PCR products of the four pairs of primers are different in length, so the four Scylla species can be Table 1 List of COI sequences, GenBank accession numbers and the geographic source of samples. N indicates the number of sequences analyzed. Species
N
GenBank accession no.
Source
S. paramamosain S. serrata
23 24
HQ687226-HQ687244, HQ687254-HQ687257 AY373341-AY373350 AF279313, AF279323, AF279325, AF279329-AF279331 AF097002, AF097003, AF097005, AF097014, AF097016-AF097018, GU055514 EF203942 AB114217, AB114218 AY373356 FJ827760, NC_012569 EU274297 AB114221, AB114222 AY373353, AY373354 FJ827759, NC_012567
China Australia Indian Ocean Unclear China Japan Australia Unclear China Philippines Australia Unclear
S. olivacea
6
S. tranquebarica
7
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
43
Fig. 1. Nucleotide sequences of mitochondrial cytochrome c oxidase I (COI) gene of the four species of Scylla. Nucleotides identical to the sequence on the top are shown with dots. The primer binding regions are boxed and the corresponding primer names are shown too.
44
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Table 2 Characterization of primers used to identify the four species of genus Scylla. Primers Sc-F and Sc-R are conserved and amplify PCR products of the same length in all species as a positive control. The primers ScPa-R, ScSe-R and ScOl-R are reverse species-specific primers, that, when paired with the forward primer ScF, can unambiguously identify S. paramamosain, S. serrata and S. olivacea, respectively. Name
Primer sequence (50 -30 )
Forward (F) or Reverse (R)
Product size (bp)
Identification of species
Sc-F Sc-R ScPa-R ScSe-R ScOl-R
GAYACDCGAGCYTAYTTTACATC TAGGATTWAGRGAYAAACCKGTAAA AACATAGTGGAAATGGGCTATG AATAAATCCTAAAGCCCATAATACA GTGTCATGTAGGATAATATCGACG
F R R R R
– 325 243 138 212
– All four species S. paramamosain only S. serrata only S. olivacea only
Table 3 Average and ranges of Kimura 2-parameter distance values within four Scylla species. N indicates the number of sequences analyzed; AD indicates average distance, SE indicates standard error. Species
N
AD SE
S. S. S. S.
23 24 6 7
0.003 0.014 0.017 0.006
paramamosain serrata olivacea tranquebarica
0.001 0.004 0.004 0.002
Minimum
Maximum
0.000 0.000 0.000 0.000
0.011 0.029 0.026 0.017
identified from each other through agarose gels electrophoresis. PCR reactions were conducted in a total volume of 25 ml and included 0.4 mM each of the five primers (one forward and four reverses), 0.2 mM each dNTP, 1 PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA under the following conditions: one cycle of denaturation at 94 C for 4 min; 30 cycles of 30 s at 94 C, 50 s at 53 C, and 50 s at 72 C. As a final step, products were extended for 7 min at 72 C. The PCR products were separated on 1.5% agarose gels with a DL1000 DNA marker. 3. Results 3.1. Collection of COI sequences For S. paramamosain, 62 COI homologous sequences were obtained. For the three other species, 37 COI sequences with different lengths were downloaded from GenBank database (24 were for S. serrata, six for Scylla olivacea, and seven for S. tranquebarica). Further, the consensus sequence with 359 bp in length was used for the further barcoding analysis. The number of haplotype were 10 for S. paramamosain, 16 for S. serrata, five for S. olivacea and three for S. tranquebarica, respectively.
3.2. Intraspecific and interspecific divergence All 62 sequences of S. paramamosain and 37 sequences of three other species were aligned and compiled, no insertion or deletion sites were found. The intraspecific distances ranged from 0.000 to 0.011 for S. paramamosain (average 0.003), from 0.000 to 0.029 for S. serrata (average 0.014), from 0.000 to 0.026 for S. olivacea (average 0.017), and from 0.000 to 0.017 for S. tranquebarica (average 0.006) (Table 3). The maximum interspecific distance (0.196) was between S. paramamosain and S. olivacea, while the minimum distance (0.092) was between S. paramamosain and S. tranquebarica (Table 4). No overlaps between intraspecific and interspecific distances were found (the barcoding gaps are shown in Fig. 2). The largest barcoding gap was present in S. olivacea, while the smallest one existed in S. serrata. The ML phylogenetic tree is shown in Fig. 3. Distinct clusters corresponding to species were found, with high bootstrap support. The nearest relationship was observed between S. paramamosain and S. tranquebarica, while the largest relationship was found between S. paramamosain and S. olivacea.
Table 4 Interspecific Kimura 2-parameter distance values, with standard errors, among four species of genus Scylla.
S. S. S. S.
paramamosain serrata olivacea tranquebarica
S. paramamosain
S. serrata
S. olivacea
S. tranquebarica
– 0.118 0.017 0.196 0.023 0.092 0.016
– – 0.178 0.022 0.096 0.015
– – – 0.147 0.020
– – – –
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
45
Fig. 2. The range of Kimura 2-parameter distances for the four species. White bars (intraspecific) and gray bars (interspecific) indicate distance ranges as percentages (%). Black circles represent the average distance observed within the range.
3.3. Development of a PCR-based species identification method A total of eleven, five and 22 species-specific nucleotide sites were found for S. paramamosain, S. serrata and S. olivacea, respectively, whereas, no specific site was found in case of S. tranquebarica. A pair of conserved primers (Sc-F and Sc-R) which can give a product as positive control were designed. In addition, three species-specific reverse primers when paired with the forward primer Sc-F can give species-specific bands were designed too. The results of species identification based on PCR with the above five primers are shown in Fig. 4. A common fragment of 325 bp in length was observed for all four species, while three species-specific fragments with different lengths (243 bp, 213 bp and 137 bp) each were observed only for S.
Fig. 3. The maximum-likelihood (ML) phylogenetic tree of individual haplotypes of the four species of Scylla.
46
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
Fig. 4. Agarose gel showing the species-specific PCR products of the four species. Lane M: DL1000 DNA marker; lanes 1–3: S. paramamosain, lanes 4–6: S. olivacea, lanes 7–9: S. serrata, and lanes10–12: S. tranquebarica. ‘A’ indicates the bands amplified using the two conserved primers Sc-F and Sc-R that was present in all individuals of the four species as a positive control. ‘B’ indicates the band amplified using primer Sc-F and ScPa-R present only in S. paramamosain. ‘C’ indicates the band amplified using primer Sc-F and ScOl-R present only in S. olivacea. ‘D’ indicates the band amplified using primer Sc-F and ScSe-R present only in S. serrata. Because no species-specific site was found in COI sequence of S. tranquebarica, we couldn’t design a reverse primer for this species.
paramamosain, S. olivacea and S. serrata, respectively. This result indicates that we have successfully developed a rapid and effective PCR-based species identification method in the genus Scylla. 4. Discussion The rapid and effective identification of closely related species is important for scientific researches and artificial production. In this study, we first confirmed the utility of DNA barcoding for identification of genus Scylla, and then developed a PCR-based method for identification. For the four species, all interspecific distances were higher than 0.02, in the range from 0.092 to 0.196. A distinct barcoding gap was found between intraspecific and interspecific distances in each species and no intraspecific–interspecific distance overlap was detected. All that indicated COI gene sequence can provide sufficient variation as DNA barcoding for identification of the four species of genus Scylla. The phylogenesis of genus Scylla was analyzed using ML method, which indicated that all four species formed monophyletic clusters, and S. paramamosain and S. tranquebarica was genetically nearest, while S. paramamosain and S. olivacea was genetically farthest. This result was in accord with the previous studies (Keenan et al., 1998; Ma et al., 2006). A PCR-based species identification method was developed in this study that showed more advantages than DNA barcoding, as the former only needs PCR amplification, while the latter needs not only a PCR amplification but also sequencing. Based on the different lengths of PCR products, we can easily identify these four species of genus Scylla. This method is also more time-saving and procedure-simple than the way based on 16S rDNA (Imai et al., 2004). In conclusion, we confirmed that COI gene is suitable for DNA barcoding in genus Scylla, and developed a PCR-based method that could be used rapidly and effectively for identification of these four species. Both methods will be useful for linking different developmental stages and the planning of hybridization breeding of genus Scylla. Acknowledgments This research was supported by the National Non-Profit Institutes (East China Sea Fisheries Research Institute) (No. 2011M05), the National Natural Science Foundation of China (No. 31001106), and the Science and Technology Commission of Shanghai Municipality (No. 10JC1418600). References Blair, D., Waycott, M., Byrne, L., Dunshea, G., Smith-Keune, C., Neil, K.M., 2006. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers. Mar. Biotechnol. 8, 380–385. Davison, A., Blackie, R.L.E., Scothern, G.P., 2009. DNA barcoding of stylommatophoran land snails: a test of existing sequences. Mol. Ecol. Resour. 9, 1092–1101. Estampador, E.P., 1949. Studies on Scylla (Crustacea: Portunidae). I. Revision of the genus. Philipp. J. Sci. 78, 95–108. Feng, Y., Li, Q., Kong, L., Zheng, X., 2011. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Mol. Biol. Rep. 38, 291–299. Fuseya, R., Watanabe, S., 1996. Genetic variability in the mud crab genus Scylla (Brachyura: Portunidae). Fisheries Sci. 62, 705–709. Glover, R.H., Collins, D.W., Walsh, K., Boonham, N., 2010. Assessment of loci for DNA barcoding in the genus Thrips (Thysanoptera: Thripidae). Mol. Ecol. Resour. 10 (1), 51–59. Hebert, P.D.N., Ratnasignham, S., deWaard, J.R., 2003a. Barcoding animal life: cytochrome c oxidase subunit I divergences among closely related species. Proc. R. Soc. B 270, S96–S99. Hebert, P.D.N., Cywinska, A., Ball, S.L., deWaard, J.R., 2003b. Biological identification through DNA barcodes. Proc. R. Soc. B. 270, 313–321. Huang, W.S., Wang, K.J., Yang, M., Cai, J.J., Li, S.J., Wang, G.Z., 2006. Purification and part characterization of a novel antibacterial protein Scygonadin, isolated from the seminal plasma of mud crab, Scylla serrata (Forskal, 1775). J. Exp. Mar. Biol. Ecol. 339, 37–42. Imai, H., Cheng, J.H., Hamasaki, K., Numachi, K.I., 2004. Identification of four mud crab species (genus Scylla) using ITS-1 and 16S rDNA markers. Aquat. Living Resour. 17, 31–34.
H. Ma et al. / Biochemical Systematics and Ecology 41 (2012) 41–47
47
Keenan, C.P., Davie, P.F., Mann, D.L., 1998. A revision of the genus Scylla de Haan, 1833. Raffles Bull. Zool. 46, 217–245. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Klinbunga, S., Boonyapakdee, A., Pratoomchat, B., 2000. Genetic diversity and species-diagnostic markers of mud crabs (genus Scylla) in eastern Thailand determined by RAPD analysis. Mar. Biotechnol. 2, 180–187. Ma, H.Y., Yang, J.F., Su, P.Z., Chen, S.L., 2009. Genetic analysis of gynogenetic and common populations of Verasper moseri using SSR markers. Wuhan Univ. J.Nat. Sci. 14, 267–273. Ma, L.B., Zhang, F.Y., Ma, C.Y., Qiao, Z.G., 2006. Scylla paramamosain (Estampador) the most common mud crab (genus Scylla) in China: evidence from mtDNA. Aquac. Res. 37, 1694–1698. Naro-Maciel, E., Reid, B., Fitzsimmons, N.N., Le, M., Desalle, R., Amato, G., 2010. DNA barcodes for globally threatened marine turtles: a registry approach to documenting biodiversity. Mol. Ecol. Resour. 10 (2), 252–263. Persis, M., Reddy, A.C.S., Rao, L.M., Khedkar, G.D., Ravinder, K., Nasruddin, K., 2009. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India. Mol. Biol. Rep. 36, 1733–1740. Puillandre, N., Strong, E.E., Bouchet, P., Boisselier, M.C., Couloux, A., Samadi, S., 2009. Identifying gastropod spawn from DNA barcodes: possible but not yet practicable. Mol. Ecol. Resour. 9, 1311–1321. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, 2496–2497. Schindel, D.E., Miller, S.E., 2005. DNA barcoding a useful tool for taxonomists. Nature 435, 17. Stahls, G., Vujic, A., Perez-Banon, C., Radenkovic, S., Rojo, S., Petanidou, T., 2009. COI barcodes for identification of Merodon hoverflies (Diptera, Syrphidae) of Lesvos Island, Greece. Mol. Ecol. Resour. 9, 1431–1438. Stephenson, W., Campbell, B., 1960. The Australian Portunids (Crustacea: Portunidae) IV: remaining genera. Aust. J. Mar. Freshwater Res. 11, 73–122. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (* and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA 4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tang, R.W.K., Yau, C., Ng, W., 2010. Identification of stomatopod larvae (Crustacea: Stomatopoda) from Hong Kong waters using DNA barcodes. Mol. Ecol. Resour. 10 (3), 439–448. Wakabayashi, T., Suzuki, N., Sakai, M., Ichii, T., Chow, S., 2006. Identification of ommastrephid squid paralarvae collected in northern Hawaiian waters and phylogenetic implications for the family Ommastrephidae using mtDNA analysis. Fisheries Sci. 72, 494–502. Wang, K.J., Huang, W.S., Yang, M., Chen, H.Y., Bo, J., Li, S.J., Wang, G.Z., 2007. A male-specific expression gene, encodes a novel anionic antimicrobial peptide, scygonadin, in Scylla serrata. Mol. Immunol. 44, 1961–1968. Yang, R., Wu, X., Yan, P., Li, X., 2010. Using DNA barcodes to identify a bird involved in a birdstrike at a Chinese airport. Mol. Biol. Rep. 37, 3517–3523.