- Email: [email protected]
Molecular identification of Lutjanus species by PCR-RFLP analysis of mitochondrial 12S rRNA region
Journal of Food Composition and Analysis 84 (2019) 103329
Contents lists available at ScienceDirect
Journal of Food Composition and Analysis journal homepage: www.elsevier.com/locate/jfca
Original Research Article
Molecular identification of Lutjanus species by PCR-RFLP analysis of mitochondrial 12S rRNA region
T
⁎
Balasubramanian Sivaramana, Geevaretnam Jeyasekarana,b, , Robinson Jeya Shakilaa, Lidiya Wilweta, Venkatesan Alamelua, Samraj Aanandc, Durairaj Sukumard a
Department of Fish Quality Assurance and Management, Fisheries College and Research Institute, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Thoothukkudi, India b Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, India c Erode Centre for Freshwater Aquaculture, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Bhavanisagar, India d Department of Fish Processing Technology, Fisheries College and Research Institute, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Thoothukkudi, India
A R T I C LE I N FO
A B S T R A C T
Keywords: Snappers Authentication 12S rRNA PCR-RFLP Endonucleases
A PCR-RFLP was developed by targeting the mitochondrial 12S rRNA region to authenticate the six species viz., Lutjanus fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus available along the Indian coast. A newly designed primer set, 12SU-F/12SU-R, was used for PCR amplification to obtain a product size of 550 bp, which was then digested using three endonucleases viz., BseDI, Mn1I and MspA1I. All the six species were unambiguously differentiated by BseDI enzyme. Mn1I differentiated only four species viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras; while MspAI differentiated four species viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. madras from the rest. The developed PCR-RFLP protocol using BseDI enzyme can therefore be easily adopted by regulatory authorities to the prevention of possible adulteration of species for red snappers.
1. Introduction Snappers fetch high price in the international seafood market because of their taste, quality and consumer preference. Red snapper, Lutjanus campechanus is highly priced and so several snappers belonging to the genera, Lutjanus and other morphologically similar low value species such as redspot emperor (Lethrinus lentjan) are often substituted as red snapper in seafood export trade (Lin et al., 2012). The adulteration level of red snapper was recorded as even 77% (Marko et al., 2004). Red snappers are usually consumed in fresh and salted forms. In India, finfish is the second largest exported item next to shellfish in terms of quantity (MPEDA, 2018). Snappers are demersal fishes and occupy a major portion of marine fish landings in the East Coast of India. Snappers comprise of 21 fish groups and those belonging to the family, Lutjanidae are one of the highly demanded fish groups. In this region, 30 species of snappers belonging to this family were recorded and identified (Murugan et al., 2014). Snapper identification using morphological characteristics is easy due to coloration and well established when the fish is in whole and unprocessed form. In processed forms such as cooked, fried and canned, the identification of species is quite difficult due to the lack of morphological characters. So, there is
⁎
need for a method without using morphological characters to authenticate the snapper species. Now-a-days, PCR based molecular methods are employed for processed fish authentication. Though DNA based methods are easy to use, species level differentiation is very difficult among closely related species, when a number of species have similar sequence pattern and high intra-species variation. Therefore, selection of target DNA sequence is a critical step in the differentiation of closely related species for a successful authentication. Simple PCR method is capable of detecting species-specific variation, but not closely related species due to their high similarity in their DNA sequence. This difficulty is overcome using PCR-RFLP method by digesting the PCR amplicon with different restriction enzymes that yields species-specific electrophoretic patterns (Rasmussen and Morrissey, 2008). The other methods include singlestranded conformational polymorphism (SSCP), DNA barcoding, forensically informative nucleotide sequencing (FINS), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), next generation sequencing (NGS) and DNA micro array technique (Rasmussen and Morrissey, 2009). RFLP is one of the most commonly used methods to differentiate the species based on the variation in the nucleotide sequences, which
Corresponding author at: Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, India. E-mail address: [email protected] (G. Jeyasekaran).
https://doi.org/10.1016/j.jfca.2019.103329 Received 16 April 2019; Received in revised form 18 September 2019; Accepted 18 September 2019 Available online 25 September 2019 0889-1575/ © 2019 Elsevier Inc. All rights reserved.
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
L. erythropterus (NC_031331), L. johnii (NC_024572), L. kasmira (FJ416614), L. malabaricus (FJ824741), L. rivulatus (NC_009869), L. russellii (EF514208) and L. sebae (FJ824742) in the GenBank database. Forward primer, 12SUF:5’TGCTTAGCCACACCCTCAAG3′ and reverse primer 12SUR:5’CCATACGCTACACCTCGACC3′ were designed based on the multiple sequence alignment using BioEdit Software (Hall, 1999).
produces different lengths of restriction fragments that varies for each species. RFLP has been widely used for the identification of several commercially valuable marine species such as cephalopods, groupers, whitefish, shrimps, snappers (Chapela et al., 2003; Sumathi et al., 2015; Ferrito et al., 2016; Wilwet et al., 2018; Sivaraman et al., 2018). PCRRFLP is an easy, rapid, robust and low cost technique than the other DNA based techniques such as SSCP, AFLP, DNA sequencing and micro array analysis (Aranishi et al., 2005). The same technique is widely used in the seafood authentication in a large scale to enforce labelling regulations and to reduce the seafood fraud. Few works are carried out on the authentication of snapper species. Thirteen snapper species from Western Atlantic region were differentiated by a PCR-RFLP method targeting 12S rRNA gene and cytochrome b gene (Chow et al., 1993). Zhang et al. (2007) have identified the salted red snapper species by a semi nested PCR-RFLP targeting 12S rRNA region. Wong and Hanner (2008) have used DNA barcoding to identify possible substitution of other species in snapper products. Another DNA barcoding study was done by Veneza et al. (2014) to authenticate the Western Atlantic region snappers by targeting 5S rDNA and cytochrome c oxidase subunit I genes. Nine snapper species available in Indian coast were authenticated by targeting the D-loop region using PCR-RFLP and PCR-SSCP methods (Sivaraman et al., 2018, 2019). Most of the previous studies carried out by the different authors on the snapper authentication have targeted 12S rRNA gene, but by employing more than one enzyme to differentiate the species. In this study the same 12S rRNA gene of the snapper was targeted to develop a PCRRFLP method to authenticate the six snapper species available in the Indian coast using a single restriction enzyme.
2.4. PCR analysis For the PCR analysis, the reaction mixture consisted of 4 μl of template DNA, 2 μl of each primer, 20 μl of PCR master mix and 22 μl of sterile water to obtain a total volume of 50 μl. The PCR amplification was performed in a thermal cycler (EP gradient S, Eppendorf, Hamburg, Germany) at the following condition: an initial denaturation at 95 °C for 2 min followed by 35 cycles. Each cycle consisted of denaturation at 95 °C for 15 s, annealing at 56 °C for 15 s and extension at 72 °C for 30 s, a final extension step at 72 °C for 10 min followed by chilling at 4 °C. The PCR amplicon (5 μl) was electrophoresed on 2% agarose gel containing ethidium bromide (0.5 mg/ml) along with a 100 bp DNA marker. 2.5. DNA sequencing and selection of restriction enzymes PCR product of each snapper species was sequenced (Eurofins Genomics, Bangalore, India) and compared with available sequences in NCBI databases using BLAST program (Altschul et al., 1990). The obtained sequences were deposited in the NCBI GenBank database. Online restriction analysis tool, Webcutter 2.0 (http://rna.lundberg.gu.se/ cutter2/) was used for in silico RFLP analysis to select the appropriate restriction enzymes.
2. Material and methods 2.1. Fish samples
2.6. PCR-RFLP analysis Six commercially available snapper species were procured from Thoothukudi Fishing Harbour, India and brought to the laboratory in iced condition. Six specimen (n = 6) were collected for each species and morphologically identified with the help of FAO species identification catalogue as Lutjanus fulvus (blacktail snapper), L. rivulatus (blubberlip snapper), L. quinquelineatus (five-lined snapper), L. fulviflamma (blackspot snapper), L. madras (Indian snapper) and L. decussatus (checkered snapper). In the laboratory, snappers were washed with potable water, beheaded, eviscerated, washed again and held at −70 °C in an ultra-freezer until used for the DNA extraction.
Three appropriate endonucleases viz., BseDI, Mn1I and MspAI were selected on the basis of in silico studies. The digestion mixture consisted of 8 μl of PCR product, 2 μl of Tango assay buffer (10X), 1 μl (10 U) of restriction enzyme and 19 μl of molecular grade water to get a 30 μl total volume. The mixture was incubated at 55 °C for 2 h and the reaction was stopped by heating at 80 °C for 20 min for BseDI. Enzymes, Mn1I and MspA1I were incubated at 37 °C for 15 min and inactivated by heating at 65 °C for 20 min. The resulting RFLP fragments were electrophoresed in 10% native polyacrylamide gel electrophoresis (PAGE) and visualized after silver staining. Silver staining was performed as per the method described by Budowle et al. (1991). A standard 50 bp DNA marker was run alongside to determine the size of digested RFLP fragments.
2.2. DNA extraction DNA was extracted using phenol-chloroform method according to the method earlier described by Sivaraman et al. (2018). Fish muscle tissue (20 mg) was mixed with a reagent mixture consisted of 950 μl of lysis buffer (200 mM tris-HCl (pH 8.0), 100 mM EDTA and 250 mM NaCl), 20 μl of protenase K and 30 μl of 20% SDS; and incubated at 55 °C for 1 h in a water bath. Then, equal volume of phenol:choloform: isoamyl alcohol (25:24:1) was added, mixed well and centrifuged at 9200 rpm for 10 min. Top aqueous layer was transferred to a fresh tube and mixed with equal volume of iso-propanol and 200 μl of 10 M ammonium acetate. Tube was inverted several times and centrifuged at 13,200 rpm for 10 min. The pellet was washed with 70% ethanol and air dried. The extracted DNA was dissolved in 100 μl TE buffer, quantified using biophotometer (Eppendorf AG, Humburg, Germany) and used for PCR analysis.
3. Results and discussion 3.1. Amplification of 12S rRNA region The mitochondrial 12S rRNA gene of snapper fishes has a total molecular length of ˜950 bp. The newly designed forward primer, 12SU-F is between the position of 145–164 bp and reverse primer, 12SU-R is between the position of 682–700 bp (Fig. 1). The designed primer successfully amplified the targeted 12S rRNA region giving a product size of 550 bp in all the six snapper species viz., L. fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus
2.3. PCR primer designing The primers were manually designed based on the mitochondrial 12S rRNA gene sequences available for the following snapper species viz., Lutjanus argentimaculatus (NC_016661), L. bengalensis (FJ171339),
Fig. 1. Location and size of the DNA fragments of 12S rRNA gene amplified and position of the designed primer set. 2
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
Fig. 2. PCR products of amplified mitochondrial 12S rRNA region using 12SUF/12SU-R primer set for the identification of different snapper species. Lane M 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
without any non-specific amplification (Fig. 2). Mitochondrial 12S rRNA is widely used in several DNA based methods such as RFLP, SSCP and FINS (Zhang et al., 2007; Asensio et al., 2001; Dudu et al., 2011) and has also been used as a target in several seafood authentication studies (Chow et al., 1993; Cespedes et al., 2000; Asensio et al., 2001). The 12S rRNA gene has considerable length, mutation rate, and large sequence availability in databases, and hence is a good target region for authentication of seafood (Cespedes et al., 2000). As this gene has less degeneracy than mitochondrial protein-coding genes, it contains sufficient intra and inter-specific variations (Comesana et al., 2003; Yang et al., 2014).
Fig. 3. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with BseDI enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
differentiated L. quinquelineatus; and an another one at 410 bp differentiated L. madras; and a unique band at 440 bp differentiated L. rivulatus (Fig. 3 and Table 1). The enzyme, BseDI thus produced different marker bands in all the six snapper species. The enzyme Mn1I differentiated four species of Lutjanus viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras from the rest (Fig. 4). Two species viz., L. rivulatus and L. decussatus produced same banding patterns by giving major bands at 200,125 and 85 bp and minor bands at 345, 265, 250, 180, 170, 145, 125, 110, 70, 50 and < 50 bp. The other four species were clearly differentiated from each other as they gave unique banding pattern. L. fulvus shared same banding pattern as that of L. rivulatus and L. decussatus but it lacked two bands at 170 and 290 bp. Likewise, L. quinquelineatus had one band at 290 bp and also lacked the band at 170 bp. In L. fulviflamma, a band at 170 bp was absent but a band at 240 bp was present. In L. madras two major bands were present at 350 and 85 bp and several minor bands were seen at 350, 180, 170, 145, 110, 70, 50 and < 50 bp (Fig. 4 and Table 1). The enzyme MspAI enzyme produced a same banding pattern with two prominent bands at 450 and110 bp in all snapper species. Besides them, L. fulvus and L. decussatus had two minor bands at 350 and 190 bp while the other four species had different minor banding patterns. In L. rivulatus, a minor band at 190 bp; in L. quinquelineatus at 350, 240, 190 and 50 bp; in L. fulviflamma at 370, 250, 190 and 160 bp; and in L. madras at 240 and 160 bp (Fig. 5 and Table 1) were the marker bands. Few studies on PCR-RFLP using 12S rRNA gene were carried out to identify the fish species. Thirteen snapper species from Western Atlantic region were distinguished by a RFLP method targeting 12S rRNA gene region and nine restriction enzymes viz., AluI, CfoI, DdeI, HaeIII, HinfI, MboI, MspI, RsaI and TaqI (Chow et al., 1993). In another study, Zhang et al. (2007) used semi-nested PCR-RFLP method by targeting 450 bp length 12S rRNA region to differentiate red snapper species, L. sanguineus, L. erythopterus, L. argentimaculatus and L. malabarius, in the commercial salted fish products with a cocktail mixture of restriction
3.2. Sequence analysis and selection of restriction enzymes The amplified mitochondrial 12S rRNA fragments of all the six species were sequenced and confirmed to the genus, Lutjanus by using BLAST programme. The sequences were deposited in NCBI GenBank database and accession numbers were obtained (MG255108- Lutjanus fulvus, MG255112 - L. rivulatus, MG255113 - L. quinquelineatus, MG255114 - L. fulviflamma, MG255115 - L. madras and MG255116 - L. decussatus). Endonucleses for restriction digestion were selected by in silico RFLP analysis and three enzymes viz., BseDI, Mn1I and MspA1 were chosen. BseDI enzyme is isolated from Bacillus stearothermophilus and it has cutting sites at 5’…C/CNNG G…3′ & 3′…G GNNC/C…5’. The source of Mn1I is Moraxella nonliquefaciens and the cutting sites are 5’…CCTC(N)7/…3′ & 3′…GGAG(N)7/…5’, while the source for MspA1 is Moraxella species and the cutting sites are 5’…CMG/CKG…3′ & 3′…GKC/GMC…5’. 3.3. PCR-RFLP analysis for snapper identification The amplified 12S rRNA region obtained for six species of snappers were individually cleaved using the endonucleases viz., BseDI, Mn1I and MspAI. The enzyme, BseDI produced 3 to 4 prominent bands and 4 to 6 minor bands in the snapper species (Fig. 3). The three prominent bands at 240, 230 and 120 bp were found to be common in four snapper species viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. decussatus; while in the remaining two species viz., L. fulvus and L. madras, four bands were prominent at 230, 140, 120 and 110 bp. Minor bands were noticed at 440, 430, 420, 400, 350, 300, 250 and 190 bp. A band at 240 bp differentiated L. fulvus from L. madras. A twin band between 400–450 bp differentiated L. fulviflamma; a band at 400 bp 3
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
Table 1 Expected and obtained size of digested 12S rRNA fragments of six snapper species upon digestion with restriction enzymes. Species
Obtained sizes (bp) of digested fragments BseDI
L. L. L. L. L. L.
fulvus rivulatus quinquelineatus fulviflamma madras decussatus
110, 120, 120, 120, 110, 120,
120, 230, 180, 230, 120, 230,
Mn1I 140, 240, 230, 240, 140, 240,
190, 230, 240, 340, 350, 420 350, 440 240,345, 350, 390, 440 340, 350,430, 440 190, 230, 350, 420 350, 430, 440
< 50, < 50, < 50, < 50, < 50, < 50,
MspAI 50, 50, 50, 50, 50, 50,
70, 70, 70, 70, 70, 70,
85, 85, 85, 85, 85, 85,
110, 110, 110, 110, 110, 110,
125, 125, 125, 125, 145, 125,
145, 145, 145, 145, 180, 145,
180, 170, 180, 180, 350, 170,
200, 180, 200, 200, 380 180,
250, 200, 250, 240,
345 250, 265, 345 290, 345 250, 345
200, 250, 265, 345
110, 190, 350, 450 110, 190, 450 50, 110, 190, 240, 350, 450 110, 190, 250, 370, 450 110, 160, 240, 450 110, 190, 350, 450
Fig. 5. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with MspAI enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
Fig. 4. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with Mn1I enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
authentication to ensure safety and traceability as per the labeling requirements for the food processors and regulatory authorities.
enzymes viz., MaeII, HaeIII, ScaI and SnaBI. The above studies used more than two enzymes for species differentiation. In our study, a single enzyme BseD1 itself had differentiated all the six species of snappers viz., L. fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus. The other endonucleases, Mn1I could only differentiate four species of Lutjanus viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras. Also, MspAI enzyme had differentiated another set of four species of Lutjanus viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. madras.
Acknowledgements Authors wish to thank the financial support provided by Indian Council of Agricultural Research, New Delhi, India through the NAE (Niche Area of Excellence) programme on Fish Safety and Quality Assurance to carry out the present study. The TNFU merit fellowship awarded to the first author to undertake the research as part of his doctoral degree programme is hereby acknowledged.
4. Conclusions References The results indicated that the six snapper species belonging to the genus, Lutjanus, can easily be identified by targeting the mitochondrial 12S rRNA gene fragment using the newly designed primers (12SU-F/ 12SU-R) with single enzyme BseDI. The method is therefore a powerful technique for the detection of adulteration among snapper species of Indian origin and it represents an indisputably important addition to the currently available authentication technique for the selected six snapper species. A further study can be carried out using the same primer set and enzyme for the other snapper species such as L. argentimaculatus, L. sanguienus, L. gibbus, L. malabaricus, L. erythropterus, L. russelli and L. sebae, which will help to build a reference RFLP library to authenticate the important snapper species. The developed RFLP method can stand for a rapid and effective technique for snapper
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215 (3), 403–410. Aranishi, F., Okimoto, T., Izumi, S., 2005. Identification of gadoid species (Pisces, Gadidae) by PCR-RFLP analysis. J. Appl. Genet. 46 (1), 69–73. Asensio, L., González, I., Fernández, A., Rodríguez, M.A., Hernández, P.E., García, T., Martín, R., 2001. PCR-SSCP: a simple method for the authentication of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets. J. Agric. Food Chem. 49 (4), 1720–1723. Budowle, B., Chakrabortyt, R., Giusti, A.M., Eisenberg, A.J., Allen, R.C., 1991. Analysis of the VNTR locus DIS80 by the PCR followed by high-resolution PAGE. Am. J. Hum. Genet. 48, 137–144. Cespedes, A., García, T., Carrera, E., González, I., Fernández, A., Asensio, L., Hernández, P.E., Martín, R., 2000. Genetic differentiation between sole (Solea solea) and Greenland halibut (Reinhardtius hippoglossoides) by PCR–RFLP analysis of a 12S rRNA gene fragment. J. Sci. Food Agric. 80 (1), 29–32.
4
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
commercial fish and seafood species. Compr. Rev. Food Sci. Food Saf. 7 (3), 280–295. Rasmussen, R.S., Morrissey, M.T., 2009. Application of DNA‐based methods to identify fish and seafood substitution on the commercial market. Compr. Rev. Food Sci. Food Saf. 8 (2), 118–154. Sivaraman, B., Jeyasekaran, G., Shakila, R.J., Alamelu, V., Wilwet, L., Aanand, S., Sukumar, D., 2018. PCR-RFLP for authentication of different species of processed snappers using mitochondrial D-loop region by single enzyme. Food Control 90, 58–65. Sivaraman, B., Jeyasekaran, G., Shakila, R.J., Aanand, S., Sukumar, D., 2019. Authentication of nine snapper species by single-strand conformation polymorphism (SSCP) and forensically informative nucleotide sequencing (FINS) methods. Food Control 99, 124–130. Sumathi, G., Jeyasekaran, G., Shakila, R.J., Sivaraman, B., Arunkumar, G., Manimaran, U., Sukumar, D., 2015. Molecular identification of grouper species using PCR-RFLP technique. Food Control 51, 300–306. Veneza, I., Felipe, B., Oliveira, J., Silva, R., Sampaio, I., Schneider, H., Gomes, G., 2014. A barcode for the authentication of the snappers (Lutjanidae) of the western Atlantic: rDNA 5S or mitochondrial COI? Food Control 38, 116–123. Wilwet, L., Jeyasekaran, G., Shakila, R.J., Sivaraman, B., Padmavathy, P., 2018. A single enzyme PCR-RFLP protocol targeting 16S rRNA/tRNAval region to authenticate four commercially important shrimp species in India. Food Chem. 239, 369–376. Wong, E.H.K., Hanner, R.H., 2008. DNA barcoding detects market substitution in North American seafood. Food Res. Int. 41 (8), 828–837. Yang, L., Tan, Z., Wang, D., Xue, L., Guan, M.X., Huang, T., Li, R., 2014. Species identification through mitochondrial rRNA genetic analysis. Sci. Rep. 4, 4089. Zhang, J., Huang, H., Cai, Z., Huang, L., 2007. Species identification in salted products of red snappers by semi-nested PCR–RFLP based on the mitochondrial 12S rRNA gene sequence. Food Control 18 (11), 1331–1336.
Chapela, M.J., Sotelo, C.G., Pérez-Martín, R.I., 2003. Molecular identification of cephalopod species by FINS and PCR-RFLP of a cytochrome b gene fragment. Eur. Food Res. Technol. 217, 524–529. Chow, S., Clarke, M.E., Walsh, P.J., 1993. PCR-RFLP analysis on thirteen western Atlantic snappers (subfamily Lutjaninae): a simple method for species and stock identification. Fish. Bull. 91 (4), 619–627. Comesana, A.S., Abella, P., Sanjuan, A., 2003. Molecular identification of five commercial flatfish species by PCR–RFLP analysis of a 12S rRNA gene fragment. J. Sci. Food Agric. 83 (8), 752–759. Dudu, A., Georgescu, S.E., Popa, O., Dinischiotu, A., Costache, M., 2011. Mitochondrial 16s and 12srRNA sequence analysis in four salmonid species from Romania. Acta Zool. Academ. Sci. Hung. 57 (3), 233–246. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series Vol. 41, 95–98 No. 41. Lin, W.F., Lyu, Y.C., Wu, Y.J., Lu, C.H., Hwang, D.F., 2012. Species identification of snapper: a food poisoning incident in Taiwan. Food Control 25 (2), 511–515. Marko, P.B., Lee, S.C., Rice, A.M., Gramling, J.M., Fitzhenry, T.M., McAlister, J.S., Harper, G.R., Moran, A.L., 2004. Fisheries: mislabelling of a depleted reef fish. Nature 430 (6997), 309–310. MPEDA, 2018. Marine Product Export Development Authority of India. Retrieved March 18. from. pp. 2019. http://mpeda.gov.in/MPEDA/admin/files/PressRelease/ July02pressreleaseonexportperformance2017-18.pdf/. Murugan, A., Vinod, K., Saravanan, K.R., Anbalagan, T., Saravanan, R., Sanaye, S.V., Mojjada, S.K., Rajagopal, S., Balasubramanian, T., 2014. Diversity, occurrence and socio-economic aspects of snappers and job fish (Family: Lutjanidae) fisheries from Gulf of Mannar region, south-east coast of India. Indian J. Mar. Sci. 43 (4), 618–633. Rasmussen, R.S., Morrissey, M.T., 2008. DNA‐based methods for the identification of
5
Contents lists available at ScienceDirect
Journal of Food Composition and Analysis journal homepage: www.elsevier.com/locate/jfca
Original Research Article
Molecular identification of Lutjanus species by PCR-RFLP analysis of mitochondrial 12S rRNA region
T
⁎
Balasubramanian Sivaramana, Geevaretnam Jeyasekarana,b, , Robinson Jeya Shakilaa, Lidiya Wilweta, Venkatesan Alamelua, Samraj Aanandc, Durairaj Sukumard a
Department of Fish Quality Assurance and Management, Fisheries College and Research Institute, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Thoothukkudi, India b Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, India c Erode Centre for Freshwater Aquaculture, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Bhavanisagar, India d Department of Fish Processing Technology, Fisheries College and Research Institute, Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Thoothukkudi, India
A R T I C LE I N FO
A B S T R A C T
Keywords: Snappers Authentication 12S rRNA PCR-RFLP Endonucleases
A PCR-RFLP was developed by targeting the mitochondrial 12S rRNA region to authenticate the six species viz., Lutjanus fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus available along the Indian coast. A newly designed primer set, 12SU-F/12SU-R, was used for PCR amplification to obtain a product size of 550 bp, which was then digested using three endonucleases viz., BseDI, Mn1I and MspA1I. All the six species were unambiguously differentiated by BseDI enzyme. Mn1I differentiated only four species viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras; while MspAI differentiated four species viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. madras from the rest. The developed PCR-RFLP protocol using BseDI enzyme can therefore be easily adopted by regulatory authorities to the prevention of possible adulteration of species for red snappers.
1. Introduction Snappers fetch high price in the international seafood market because of their taste, quality and consumer preference. Red snapper, Lutjanus campechanus is highly priced and so several snappers belonging to the genera, Lutjanus and other morphologically similar low value species such as redspot emperor (Lethrinus lentjan) are often substituted as red snapper in seafood export trade (Lin et al., 2012). The adulteration level of red snapper was recorded as even 77% (Marko et al., 2004). Red snappers are usually consumed in fresh and salted forms. In India, finfish is the second largest exported item next to shellfish in terms of quantity (MPEDA, 2018). Snappers are demersal fishes and occupy a major portion of marine fish landings in the East Coast of India. Snappers comprise of 21 fish groups and those belonging to the family, Lutjanidae are one of the highly demanded fish groups. In this region, 30 species of snappers belonging to this family were recorded and identified (Murugan et al., 2014). Snapper identification using morphological characteristics is easy due to coloration and well established when the fish is in whole and unprocessed form. In processed forms such as cooked, fried and canned, the identification of species is quite difficult due to the lack of morphological characters. So, there is
⁎
need for a method without using morphological characters to authenticate the snapper species. Now-a-days, PCR based molecular methods are employed for processed fish authentication. Though DNA based methods are easy to use, species level differentiation is very difficult among closely related species, when a number of species have similar sequence pattern and high intra-species variation. Therefore, selection of target DNA sequence is a critical step in the differentiation of closely related species for a successful authentication. Simple PCR method is capable of detecting species-specific variation, but not closely related species due to their high similarity in their DNA sequence. This difficulty is overcome using PCR-RFLP method by digesting the PCR amplicon with different restriction enzymes that yields species-specific electrophoretic patterns (Rasmussen and Morrissey, 2008). The other methods include singlestranded conformational polymorphism (SSCP), DNA barcoding, forensically informative nucleotide sequencing (FINS), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), next generation sequencing (NGS) and DNA micro array technique (Rasmussen and Morrissey, 2009). RFLP is one of the most commonly used methods to differentiate the species based on the variation in the nucleotide sequences, which
Corresponding author at: Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, India. E-mail address: [email protected] (G. Jeyasekaran).
https://doi.org/10.1016/j.jfca.2019.103329 Received 16 April 2019; Received in revised form 18 September 2019; Accepted 18 September 2019 Available online 25 September 2019 0889-1575/ © 2019 Elsevier Inc. All rights reserved.
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
L. erythropterus (NC_031331), L. johnii (NC_024572), L. kasmira (FJ416614), L. malabaricus (FJ824741), L. rivulatus (NC_009869), L. russellii (EF514208) and L. sebae (FJ824742) in the GenBank database. Forward primer, 12SUF:5’TGCTTAGCCACACCCTCAAG3′ and reverse primer 12SUR:5’CCATACGCTACACCTCGACC3′ were designed based on the multiple sequence alignment using BioEdit Software (Hall, 1999).
produces different lengths of restriction fragments that varies for each species. RFLP has been widely used for the identification of several commercially valuable marine species such as cephalopods, groupers, whitefish, shrimps, snappers (Chapela et al., 2003; Sumathi et al., 2015; Ferrito et al., 2016; Wilwet et al., 2018; Sivaraman et al., 2018). PCRRFLP is an easy, rapid, robust and low cost technique than the other DNA based techniques such as SSCP, AFLP, DNA sequencing and micro array analysis (Aranishi et al., 2005). The same technique is widely used in the seafood authentication in a large scale to enforce labelling regulations and to reduce the seafood fraud. Few works are carried out on the authentication of snapper species. Thirteen snapper species from Western Atlantic region were differentiated by a PCR-RFLP method targeting 12S rRNA gene and cytochrome b gene (Chow et al., 1993). Zhang et al. (2007) have identified the salted red snapper species by a semi nested PCR-RFLP targeting 12S rRNA region. Wong and Hanner (2008) have used DNA barcoding to identify possible substitution of other species in snapper products. Another DNA barcoding study was done by Veneza et al. (2014) to authenticate the Western Atlantic region snappers by targeting 5S rDNA and cytochrome c oxidase subunit I genes. Nine snapper species available in Indian coast were authenticated by targeting the D-loop region using PCR-RFLP and PCR-SSCP methods (Sivaraman et al., 2018, 2019). Most of the previous studies carried out by the different authors on the snapper authentication have targeted 12S rRNA gene, but by employing more than one enzyme to differentiate the species. In this study the same 12S rRNA gene of the snapper was targeted to develop a PCRRFLP method to authenticate the six snapper species available in the Indian coast using a single restriction enzyme.
2.4. PCR analysis For the PCR analysis, the reaction mixture consisted of 4 μl of template DNA, 2 μl of each primer, 20 μl of PCR master mix and 22 μl of sterile water to obtain a total volume of 50 μl. The PCR amplification was performed in a thermal cycler (EP gradient S, Eppendorf, Hamburg, Germany) at the following condition: an initial denaturation at 95 °C for 2 min followed by 35 cycles. Each cycle consisted of denaturation at 95 °C for 15 s, annealing at 56 °C for 15 s and extension at 72 °C for 30 s, a final extension step at 72 °C for 10 min followed by chilling at 4 °C. The PCR amplicon (5 μl) was electrophoresed on 2% agarose gel containing ethidium bromide (0.5 mg/ml) along with a 100 bp DNA marker. 2.5. DNA sequencing and selection of restriction enzymes PCR product of each snapper species was sequenced (Eurofins Genomics, Bangalore, India) and compared with available sequences in NCBI databases using BLAST program (Altschul et al., 1990). The obtained sequences were deposited in the NCBI GenBank database. Online restriction analysis tool, Webcutter 2.0 (http://rna.lundberg.gu.se/ cutter2/) was used for in silico RFLP analysis to select the appropriate restriction enzymes.
2. Material and methods 2.1. Fish samples
2.6. PCR-RFLP analysis Six commercially available snapper species were procured from Thoothukudi Fishing Harbour, India and brought to the laboratory in iced condition. Six specimen (n = 6) were collected for each species and morphologically identified with the help of FAO species identification catalogue as Lutjanus fulvus (blacktail snapper), L. rivulatus (blubberlip snapper), L. quinquelineatus (five-lined snapper), L. fulviflamma (blackspot snapper), L. madras (Indian snapper) and L. decussatus (checkered snapper). In the laboratory, snappers were washed with potable water, beheaded, eviscerated, washed again and held at −70 °C in an ultra-freezer until used for the DNA extraction.
Three appropriate endonucleases viz., BseDI, Mn1I and MspAI were selected on the basis of in silico studies. The digestion mixture consisted of 8 μl of PCR product, 2 μl of Tango assay buffer (10X), 1 μl (10 U) of restriction enzyme and 19 μl of molecular grade water to get a 30 μl total volume. The mixture was incubated at 55 °C for 2 h and the reaction was stopped by heating at 80 °C for 20 min for BseDI. Enzymes, Mn1I and MspA1I were incubated at 37 °C for 15 min and inactivated by heating at 65 °C for 20 min. The resulting RFLP fragments were electrophoresed in 10% native polyacrylamide gel electrophoresis (PAGE) and visualized after silver staining. Silver staining was performed as per the method described by Budowle et al. (1991). A standard 50 bp DNA marker was run alongside to determine the size of digested RFLP fragments.
2.2. DNA extraction DNA was extracted using phenol-chloroform method according to the method earlier described by Sivaraman et al. (2018). Fish muscle tissue (20 mg) was mixed with a reagent mixture consisted of 950 μl of lysis buffer (200 mM tris-HCl (pH 8.0), 100 mM EDTA and 250 mM NaCl), 20 μl of protenase K and 30 μl of 20% SDS; and incubated at 55 °C for 1 h in a water bath. Then, equal volume of phenol:choloform: isoamyl alcohol (25:24:1) was added, mixed well and centrifuged at 9200 rpm for 10 min. Top aqueous layer was transferred to a fresh tube and mixed with equal volume of iso-propanol and 200 μl of 10 M ammonium acetate. Tube was inverted several times and centrifuged at 13,200 rpm for 10 min. The pellet was washed with 70% ethanol and air dried. The extracted DNA was dissolved in 100 μl TE buffer, quantified using biophotometer (Eppendorf AG, Humburg, Germany) and used for PCR analysis.
3. Results and discussion 3.1. Amplification of 12S rRNA region The mitochondrial 12S rRNA gene of snapper fishes has a total molecular length of ˜950 bp. The newly designed forward primer, 12SU-F is between the position of 145–164 bp and reverse primer, 12SU-R is between the position of 682–700 bp (Fig. 1). The designed primer successfully amplified the targeted 12S rRNA region giving a product size of 550 bp in all the six snapper species viz., L. fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus
2.3. PCR primer designing The primers were manually designed based on the mitochondrial 12S rRNA gene sequences available for the following snapper species viz., Lutjanus argentimaculatus (NC_016661), L. bengalensis (FJ171339),
Fig. 1. Location and size of the DNA fragments of 12S rRNA gene amplified and position of the designed primer set. 2
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
Fig. 2. PCR products of amplified mitochondrial 12S rRNA region using 12SUF/12SU-R primer set for the identification of different snapper species. Lane M 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
without any non-specific amplification (Fig. 2). Mitochondrial 12S rRNA is widely used in several DNA based methods such as RFLP, SSCP and FINS (Zhang et al., 2007; Asensio et al., 2001; Dudu et al., 2011) and has also been used as a target in several seafood authentication studies (Chow et al., 1993; Cespedes et al., 2000; Asensio et al., 2001). The 12S rRNA gene has considerable length, mutation rate, and large sequence availability in databases, and hence is a good target region for authentication of seafood (Cespedes et al., 2000). As this gene has less degeneracy than mitochondrial protein-coding genes, it contains sufficient intra and inter-specific variations (Comesana et al., 2003; Yang et al., 2014).
Fig. 3. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with BseDI enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
differentiated L. quinquelineatus; and an another one at 410 bp differentiated L. madras; and a unique band at 440 bp differentiated L. rivulatus (Fig. 3 and Table 1). The enzyme, BseDI thus produced different marker bands in all the six snapper species. The enzyme Mn1I differentiated four species of Lutjanus viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras from the rest (Fig. 4). Two species viz., L. rivulatus and L. decussatus produced same banding patterns by giving major bands at 200,125 and 85 bp and minor bands at 345, 265, 250, 180, 170, 145, 125, 110, 70, 50 and < 50 bp. The other four species were clearly differentiated from each other as they gave unique banding pattern. L. fulvus shared same banding pattern as that of L. rivulatus and L. decussatus but it lacked two bands at 170 and 290 bp. Likewise, L. quinquelineatus had one band at 290 bp and also lacked the band at 170 bp. In L. fulviflamma, a band at 170 bp was absent but a band at 240 bp was present. In L. madras two major bands were present at 350 and 85 bp and several minor bands were seen at 350, 180, 170, 145, 110, 70, 50 and < 50 bp (Fig. 4 and Table 1). The enzyme MspAI enzyme produced a same banding pattern with two prominent bands at 450 and110 bp in all snapper species. Besides them, L. fulvus and L. decussatus had two minor bands at 350 and 190 bp while the other four species had different minor banding patterns. In L. rivulatus, a minor band at 190 bp; in L. quinquelineatus at 350, 240, 190 and 50 bp; in L. fulviflamma at 370, 250, 190 and 160 bp; and in L. madras at 240 and 160 bp (Fig. 5 and Table 1) were the marker bands. Few studies on PCR-RFLP using 12S rRNA gene were carried out to identify the fish species. Thirteen snapper species from Western Atlantic region were distinguished by a RFLP method targeting 12S rRNA gene region and nine restriction enzymes viz., AluI, CfoI, DdeI, HaeIII, HinfI, MboI, MspI, RsaI and TaqI (Chow et al., 1993). In another study, Zhang et al. (2007) used semi-nested PCR-RFLP method by targeting 450 bp length 12S rRNA region to differentiate red snapper species, L. sanguineus, L. erythopterus, L. argentimaculatus and L. malabarius, in the commercial salted fish products with a cocktail mixture of restriction
3.2. Sequence analysis and selection of restriction enzymes The amplified mitochondrial 12S rRNA fragments of all the six species were sequenced and confirmed to the genus, Lutjanus by using BLAST programme. The sequences were deposited in NCBI GenBank database and accession numbers were obtained (MG255108- Lutjanus fulvus, MG255112 - L. rivulatus, MG255113 - L. quinquelineatus, MG255114 - L. fulviflamma, MG255115 - L. madras and MG255116 - L. decussatus). Endonucleses for restriction digestion were selected by in silico RFLP analysis and three enzymes viz., BseDI, Mn1I and MspA1 were chosen. BseDI enzyme is isolated from Bacillus stearothermophilus and it has cutting sites at 5’…C/CNNG G…3′ & 3′…G GNNC/C…5’. The source of Mn1I is Moraxella nonliquefaciens and the cutting sites are 5’…CCTC(N)7/…3′ & 3′…GGAG(N)7/…5’, while the source for MspA1 is Moraxella species and the cutting sites are 5’…CMG/CKG…3′ & 3′…GKC/GMC…5’. 3.3. PCR-RFLP analysis for snapper identification The amplified 12S rRNA region obtained for six species of snappers were individually cleaved using the endonucleases viz., BseDI, Mn1I and MspAI. The enzyme, BseDI produced 3 to 4 prominent bands and 4 to 6 minor bands in the snapper species (Fig. 3). The three prominent bands at 240, 230 and 120 bp were found to be common in four snapper species viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. decussatus; while in the remaining two species viz., L. fulvus and L. madras, four bands were prominent at 230, 140, 120 and 110 bp. Minor bands were noticed at 440, 430, 420, 400, 350, 300, 250 and 190 bp. A band at 240 bp differentiated L. fulvus from L. madras. A twin band between 400–450 bp differentiated L. fulviflamma; a band at 400 bp 3
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
Table 1 Expected and obtained size of digested 12S rRNA fragments of six snapper species upon digestion with restriction enzymes. Species
Obtained sizes (bp) of digested fragments BseDI
L. L. L. L. L. L.
fulvus rivulatus quinquelineatus fulviflamma madras decussatus
110, 120, 120, 120, 110, 120,
120, 230, 180, 230, 120, 230,
Mn1I 140, 240, 230, 240, 140, 240,
190, 230, 240, 340, 350, 420 350, 440 240,345, 350, 390, 440 340, 350,430, 440 190, 230, 350, 420 350, 430, 440
< 50, < 50, < 50, < 50, < 50, < 50,
MspAI 50, 50, 50, 50, 50, 50,
70, 70, 70, 70, 70, 70,
85, 85, 85, 85, 85, 85,
110, 110, 110, 110, 110, 110,
125, 125, 125, 125, 145, 125,
145, 145, 145, 145, 180, 145,
180, 170, 180, 180, 350, 170,
200, 180, 200, 200, 380 180,
250, 200, 250, 240,
345 250, 265, 345 290, 345 250, 345
200, 250, 265, 345
110, 190, 350, 450 110, 190, 450 50, 110, 190, 240, 350, 450 110, 190, 250, 370, 450 110, 160, 240, 450 110, 190, 350, 450
Fig. 5. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with MspAI enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
Fig. 4. PCR-RFLP patterns of amplified 12S rRNA region of snappers digested with Mn1I enzyme. Lane M - 100 bp DNA marker; Lane 1 - Lutjanus fulvus; Lane 2 - L. rivulatus; Lane 3 - L. quinquelineatus; Lane 4 - L. fulviflamma; Lane 5 - L. madras; Lane 6 - L. decussatus.
authentication to ensure safety and traceability as per the labeling requirements for the food processors and regulatory authorities.
enzymes viz., MaeII, HaeIII, ScaI and SnaBI. The above studies used more than two enzymes for species differentiation. In our study, a single enzyme BseD1 itself had differentiated all the six species of snappers viz., L. fulvus, L. rivulatus, L. quinquelineatus, L. fulviflamma, L. madras and L. decussatus. The other endonucleases, Mn1I could only differentiate four species of Lutjanus viz., L. fulvus, L. quinquelineatus, L. fulviflamma and L. madras. Also, MspAI enzyme had differentiated another set of four species of Lutjanus viz., L. rivulatus, L. quinquelineatus, L. fulviflamma and L. madras.
Acknowledgements Authors wish to thank the financial support provided by Indian Council of Agricultural Research, New Delhi, India through the NAE (Niche Area of Excellence) programme on Fish Safety and Quality Assurance to carry out the present study. The TNFU merit fellowship awarded to the first author to undertake the research as part of his doctoral degree programme is hereby acknowledged.
4. Conclusions References The results indicated that the six snapper species belonging to the genus, Lutjanus, can easily be identified by targeting the mitochondrial 12S rRNA gene fragment using the newly designed primers (12SU-F/ 12SU-R) with single enzyme BseDI. The method is therefore a powerful technique for the detection of adulteration among snapper species of Indian origin and it represents an indisputably important addition to the currently available authentication technique for the selected six snapper species. A further study can be carried out using the same primer set and enzyme for the other snapper species such as L. argentimaculatus, L. sanguienus, L. gibbus, L. malabaricus, L. erythropterus, L. russelli and L. sebae, which will help to build a reference RFLP library to authenticate the important snapper species. The developed RFLP method can stand for a rapid and effective technique for snapper
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215 (3), 403–410. Aranishi, F., Okimoto, T., Izumi, S., 2005. Identification of gadoid species (Pisces, Gadidae) by PCR-RFLP analysis. J. Appl. Genet. 46 (1), 69–73. Asensio, L., González, I., Fernández, A., Rodríguez, M.A., Hernández, P.E., García, T., Martín, R., 2001. PCR-SSCP: a simple method for the authentication of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets. J. Agric. Food Chem. 49 (4), 1720–1723. Budowle, B., Chakrabortyt, R., Giusti, A.M., Eisenberg, A.J., Allen, R.C., 1991. Analysis of the VNTR locus DIS80 by the PCR followed by high-resolution PAGE. Am. J. Hum. Genet. 48, 137–144. Cespedes, A., García, T., Carrera, E., González, I., Fernández, A., Asensio, L., Hernández, P.E., Martín, R., 2000. Genetic differentiation between sole (Solea solea) and Greenland halibut (Reinhardtius hippoglossoides) by PCR–RFLP analysis of a 12S rRNA gene fragment. J. Sci. Food Agric. 80 (1), 29–32.
4
Journal of Food Composition and Analysis 84 (2019) 103329
B. Sivaraman, et al.
commercial fish and seafood species. Compr. Rev. Food Sci. Food Saf. 7 (3), 280–295. Rasmussen, R.S., Morrissey, M.T., 2009. Application of DNA‐based methods to identify fish and seafood substitution on the commercial market. Compr. Rev. Food Sci. Food Saf. 8 (2), 118–154. Sivaraman, B., Jeyasekaran, G., Shakila, R.J., Alamelu, V., Wilwet, L., Aanand, S., Sukumar, D., 2018. PCR-RFLP for authentication of different species of processed snappers using mitochondrial D-loop region by single enzyme. Food Control 90, 58–65. Sivaraman, B., Jeyasekaran, G., Shakila, R.J., Aanand, S., Sukumar, D., 2019. Authentication of nine snapper species by single-strand conformation polymorphism (SSCP) and forensically informative nucleotide sequencing (FINS) methods. Food Control 99, 124–130. Sumathi, G., Jeyasekaran, G., Shakila, R.J., Sivaraman, B., Arunkumar, G., Manimaran, U., Sukumar, D., 2015. Molecular identification of grouper species using PCR-RFLP technique. Food Control 51, 300–306. Veneza, I., Felipe, B., Oliveira, J., Silva, R., Sampaio, I., Schneider, H., Gomes, G., 2014. A barcode for the authentication of the snappers (Lutjanidae) of the western Atlantic: rDNA 5S or mitochondrial COI? Food Control 38, 116–123. Wilwet, L., Jeyasekaran, G., Shakila, R.J., Sivaraman, B., Padmavathy, P., 2018. A single enzyme PCR-RFLP protocol targeting 16S rRNA/tRNAval region to authenticate four commercially important shrimp species in India. Food Chem. 239, 369–376. Wong, E.H.K., Hanner, R.H., 2008. DNA barcoding detects market substitution in North American seafood. Food Res. Int. 41 (8), 828–837. Yang, L., Tan, Z., Wang, D., Xue, L., Guan, M.X., Huang, T., Li, R., 2014. Species identification through mitochondrial rRNA genetic analysis. Sci. Rep. 4, 4089. Zhang, J., Huang, H., Cai, Z., Huang, L., 2007. Species identification in salted products of red snappers by semi-nested PCR–RFLP based on the mitochondrial 12S rRNA gene sequence. Food Control 18 (11), 1331–1336.
Chapela, M.J., Sotelo, C.G., Pérez-Martín, R.I., 2003. Molecular identification of cephalopod species by FINS and PCR-RFLP of a cytochrome b gene fragment. Eur. Food Res. Technol. 217, 524–529. Chow, S., Clarke, M.E., Walsh, P.J., 1993. PCR-RFLP analysis on thirteen western Atlantic snappers (subfamily Lutjaninae): a simple method for species and stock identification. Fish. Bull. 91 (4), 619–627. Comesana, A.S., Abella, P., Sanjuan, A., 2003. Molecular identification of five commercial flatfish species by PCR–RFLP analysis of a 12S rRNA gene fragment. J. Sci. Food Agric. 83 (8), 752–759. Dudu, A., Georgescu, S.E., Popa, O., Dinischiotu, A., Costache, M., 2011. Mitochondrial 16s and 12srRNA sequence analysis in four salmonid species from Romania. Acta Zool. Academ. Sci. Hung. 57 (3), 233–246. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series Vol. 41, 95–98 No. 41. Lin, W.F., Lyu, Y.C., Wu, Y.J., Lu, C.H., Hwang, D.F., 2012. Species identification of snapper: a food poisoning incident in Taiwan. Food Control 25 (2), 511–515. Marko, P.B., Lee, S.C., Rice, A.M., Gramling, J.M., Fitzhenry, T.M., McAlister, J.S., Harper, G.R., Moran, A.L., 2004. Fisheries: mislabelling of a depleted reef fish. Nature 430 (6997), 309–310. MPEDA, 2018. Marine Product Export Development Authority of India. Retrieved March 18. from. pp. 2019. http://mpeda.gov.in/MPEDA/admin/files/PressRelease/ July02pressreleaseonexportperformance2017-18.pdf/. Murugan, A., Vinod, K., Saravanan, K.R., Anbalagan, T., Saravanan, R., Sanaye, S.V., Mojjada, S.K., Rajagopal, S., Balasubramanian, T., 2014. Diversity, occurrence and socio-economic aspects of snappers and job fish (Family: Lutjanidae) fisheries from Gulf of Mannar region, south-east coast of India. Indian J. Mar. Sci. 43 (4), 618–633. Rasmussen, R.S., Morrissey, M.T., 2008. DNA‐based methods for the identification of
5