Molecular markers for the discrimination of Triticum turgidum L. subsp. dicoccum (Schrank ex Schübl.) Thell. and Triticum timopheevii (Zhuk.) Zhuk. subsp. timopheevii

Journal of Archaeological Science 35 (2008) 239e246 http://www.elsevier.com/locate/jas

Molecular markers for the discrimination of Triticum turgidum L. subsp. dicoccum (Schrank ex Schu¨bl.) Thell. and Triticum timopheevii (Zhuk.) Zhuk. subsp. timopheevii Paola Boscato a, Christian Carioni a, Andrea Brandolini b,*, Laura Sadori c, Mauro Rottoli a b

a Laboratorio di Archeobiologia, Musei Civici, Como, Italy Istituto Sperimentale per la Cerealicoltura - CRA, S. Angelo Lodigiano (LO), Italy c Dipartimento di Biologia Vegetale, University ‘‘La Sapienza’’, Roma, Italy

Received 3 April 2006; received in revised form 1 March 2007; accepted 1 March 2007

Abstract The persistent uncertainty on the classification of the ‘‘new’’ glume wheat found in Neolithic and Bronze Age sites from Greece and other European settlements might be resolved only through analysis of its ancient DNA. Tools able to discriminate among different Triticum species on the basis of scarce, very damaged DNA, are therefore essential. While current attempts concentrate on DNA fragments sequencing and comparison, in some instances PCR-based selective amplification techniques might offer a cheaper and quicker alternative. The purpose of this research was therefore the identification of species-specific primers, able to distinguish caryopses of Triticum timopheevii subsp. timopheevii from those of Triticum turgidum subsp. dicoccum. Primers and their working conditions were defined and optimized using DNA from modern accessions. The ribosomal primers ITS1 tim and ITS2 tim, and the nuclear primer acetyl-coenzyme A tim clearly discriminated the sequences of Triticum timopheevii from other species. Finally, Neolithic charred wheat grains found in the sites of Sammardenchia (Pozzuolo del Friuli, Udine) and La Marmotta (Lago di Bracciano, Roma), belonging to the ‘‘new’’ wheat type or to emmer, were tested with the three selected primers. However, the results were not conclusive, because the samples analysed were apparently too degraded to yield useful DNA. Ó 2007 Elsevier Ltd. All rights reserved. Keywords: New glume wheat; aDNA; PCR; Species-specific primers; Triticum timopheevii

1. Introduction About 12,000 years ago, in the Fertile Crescent some human groups passed from a society based on hunting and harvesting to a society founded upon plant husbandry. The rise of agriculture radically transformed human communities, spearheading the Neolithic revolution. Among the species that contributed to this change, wheat had a prominent role: its transformation from weed to staple crop led, through complex crossing/polyploidisation/ rearrangement patterns, to the

* Corresponding author. Tel.: þ39 0371 211261; fax: þ39 0371 210372. E-mail address: [email protected] (A. Brandolini). 0305-4403/$ - see front matter Ó 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jas.2007.03.003

evolution of different species, most of them of relevant economic importance (Zohary and Hopf, 2000). During the 1990s, charred fossils remains ascribed to an unknown hulled wheat were found in three Neolithic and in one Bronze Age sites in northern Greece (Jones et al., 2000). Grains, spikelets bases and glumes were morphologically different from those of Triticum monococcum L. subsp. monococcum (briefly, T. monococcum), Triticum turgidum L. subsp. dicoccum (Schrank ex Schu¨bl.) Thell. (briefly, T. dicoccum) and Triticum aestivum subsp. spelta L. Thell. (briefly, T. spelta) (Jones et al., 2000). In a short span of time the ‘‘new’’ Triticum was identified in several Neolithic sites throughout Europe (Kohler-Schneider, 2003), including the Italian site of Sammardenchia (Rottoli, 2004). Its taxonomic classification is still uncertain, but studies on spikelet bases

240

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

morphology by Jones et al. (2000) and comparative measurements on charred seeds of modern and ancient wheat grains by Kohler-Schneider (2003) suggest that it might be similar to Triticum timopheevii (Zhuk.) Zhuk. subsp. timopheevii (briefly, T. timopheevii). Four hypotheses for its origin and classification were proposed by Jones et al. (2000): (1) It derives from T. dicoccum, after genetic mutations or chromosomal rearrangement; an indirect support arrives from Kushnir and Halloran (1983) that observed mutants of T. dicoccum morphologically similar to T. timopheevii. (2) It derives from the wild species T. turgidum subsp. dicoccoides (Korn. ex Asch. & Graeb.) Thell. (briefly, T. dicoccoides) or T. timopheevii subsp. armeniacum (Jakubz.) Slageren (briefly, T. armeniacum). According to Brown (1999), the modern T. dicoccum results from two separate domestication events, that gave origin to two indistinguishable morphologies. Therefore, a third domestication event, that produced a type morphologically more similar to the modern T. timopheevii than to T. dicoccum, is theoretically possible. (3) Stems from introgression of T. dicoccum with T. dicoccoides or another species. (4) Is linked to a wider ancient distribution of T. timopheevii, presently cultivated only in Georgia.

2. Materials and methods 2.1. Materials The charred wheat grains and spikelet bases used for morphological studies and DNA analysis were recovered from storage silos of the Sammardenchia site (Pozzuolo del Friuli, Udine) and from the lacustrine sediments of La Marmotta (Lago di Bracciano, Roma) (Fig. 1). The samples were AMS dated to 5570e4461 years BC for Sammardenchia and 5690e5260 years BC for La Marmotta. The identification of Triticum monococcum and Triticum dicoccum followed Hillman et al. (1996), while the ‘‘new’’ glume wheat was classified adopting the criteria by Jones et al. (2000), for spikelet bases, and Kohler-Schneider (2003), for kernels. Modern samples of wheats with AB genome: T. dicoccoides (wild emmer; 1 sample), T. dicoccum (emmer, 11 samples), T. durum (durum wheat; 3 samples); ABD genome: T. spelta (spelt; 1 sample); and AG genome: T. armeniacum (2 samples), T. timopheevii (4 samples), T. zhukovskii (4 samples), were from the wheat collection of the Istituto Sperimentale per la Cerealicoltura, Sant’Angelo Lodigiano, (Italy). Additional samples of T. armeniacum (4 samples) and T. ¨ zkan, timopheevii (10 samples) were kindly provided by Dr O Cucurova University, Adana, Turkey. 2.2. DNA extraction

The precise classification of the ‘‘new’’ wheat by morphological analysis is difficult for the often poor conditions of the charred remains. For an unequivocal identification, the use of DNA-based methods is therefore essential. Nevertheless, the extraction, the manipulation and the analysis of ancient DNA (aDNA) carry numerous problems, mainly related to the high degradation and low number of recoverable molecules. Reports dealing with the retrieval, sequencing and identification of short DNA stretches from plant remains, including charred seeds, are however available (Blatter et al., 2002; Schlumbaum et al., 1998). The second obstacle (i.e. scarcity of DNA molecules) might be overcome with the use of the polymerase chain reaction (PCR), that allows selective amplification and logarithmic increase of target DNA fragments (Mullis et al., 1986). Furthermore, this selective amplification can be utilised when the target DNA is mixed with foreign DNA fragments, a situation not at all rare in ancient remains. Nevertheless, the DNAbased identification of the ‘‘new’’ wheat species, either by sequencing or by amplification, has not yet been performed. Sorely lacking, for a PCR-based approach, are primers able to differentiate T. timopheevii from T. dicoccum. The aim of our research was therefore the identification of species-specific primers and the optimisation of their working conditions. The best primer combinations were then applied to putative aDNA extracted from charred grains, attributed by morphological analysis to the newly identified Triticum or to T. dicoccum and coming from two Italian Neolithic sites, Sammardenchia (Rottoli, 2004) and La Marmotta (Rottoli, 1993).

Standard precautions to avoid possible contaminations of the samples were adopted during the extraction of ancient and modern DNA. All the reagents, eppendorfs, mini-pestles and Gilson points utilized during extraction, amplification and electrophoresis were autoclaved at 121  C for 20 min and exposed to UV light for 10 min. DNA extraction and handling were conducted in a dedicated room, under a laminar flux extractor hood.

Fig. 1. Geographical localisation of the two Neolithic sites of Sammardenchia and La Marmotta.

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

241

Each kernel (fresh or charred) was surface-sterilized by exposure to UV light for 10 min and ground in a sterile eppendorf with a mini pestle. The extraction was performed following the CTAB method, in the form proposed by Threadgold and Brown (2003). The dry pellet was resuspended in 1 ml of TE pH 8.0 (10 mM TriseHCl pH 8.0, 1 mM EDTA) and stored at 20  C until the utilization.

observed: one with T. dicoccum characteristics and one attributable to the ‘‘new’’ wheat. In the remains of La Marmotta, however, the new Triticum was not observed. Typical new wheat and Triticum dicoccum kernels found in Sammardenchia are depicted in Fig. 2.

2.3. Primers selection

The search of specific sequences of Triticum timopheevii in the NCBI database, carried out during April 2004, identified 18 deposited sequences, most of them belonging to nuclear DNA. Similar sequences from different wheat species were identified and compared, as detailed in Section 2. For the selection of species-specific primers, only sequences with at least two discriminating bases inside the critical regions were considered. Therefore, seven unique DNA sequences were retained (Table 1), from which couples of T. timopheevii primers (each consisting of a forward and a reverse primer) were identified and synthesized. The theoretical amplification conditions, including the critical melting temperatures, were optimised by successive iterations. Details of the three most promising primer combinations, from the ribosomal ITS1 and ITS2, and the nuclear AcCoA, are presented in Table 2; in the same table are also described two control primer combinations, from the ribosomal ITS1 and ITS2, that amplify both T. timopheevii and T. dicoccum DNA.

Sequences specific for T. timopheevii, identified with the search engine Entrez (http://www.ncbi.nlm.nih.gov/entrez/ query.fcgi), and similar nucleotide sequences from other wheats, recovered with Megablast (http://www.ncbi.nlm.nih. gov/blast), were aligned with Clustalw (http://www.ebi.ac.uk/ clustalw); differences in the DNA fragments were spotted with Bioedit (http://www.mbio.ncsu.edu/bioedit/bioedit.html) and visually controlled. Primer sequences amplifying short DNA fragments (50e100 bp) were defined using Genefisher (http://www.genefisher.de). Primers that showed at least two differences in DNA bases between T. timopheevii and T. dicoccum, as well as two control primer combinations amplifying both T. timopheevii and T. dicoccum, were selected, and synthesized by Invitrogen (Paisley, UK). 2.4. Amplification

3.2. Primers selection and optimisation

The PCR reactions were carried out in 20 mL final volume using an iCycler thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). Each reaction consisted of 1 mL of DNA solution (corresponding to ca. 50 ng of modern DNA), 1 PCR buffer, 30 mM MgCl2, 3 mM dNTPs, 2 mM each of the two primers and 2.5 units of Taq polymerase (Invitrogen, Paisley, UK). The amplification protocol consisted of an initial denaturing step at 95  C for 2 min, followed by thirtyeight cycles of denaturation at 94  C for 25 s, annealing at the specific temperature for each primer pair for 25 s and extension at 70  C for 45 s. A final extension step was performed at 72  C for 10 min. The amplified samples were loaded into a 6% polyacrylamide non-denaturing gel and run for 1 h 30 min at constant 300 V. The DNA was visualised under UV after soaking the gels in 1 ethidium bromide solution, and photographed using a digital camera (DMCLC40E, Panasonic, Matsushita Electric Industrial Co., LTD, Japan). 3. Results 3.1. Morphology of spikelet wheat remains The morphological analysis of the remains from Sammardenchia and La Marmotta sites, carried out following the criteria cited in Section 2, easily distinguished einkorn (T. monococcum) caryopses from those of the tetraploid hulled wheat species. In the material from Sammardenchia, among the grains previously attributed to T. dicoccum and among the not-determined grains, two groups of kernels were

Fig. 2. Images of the ‘‘new’’ wheat type (A) and T. dicoccum (B) kernels from Sammardenchia.

242

Table 1 DNA sequences specific to T. timopheevii 1.

3.

4.

5.

6.

7.

Bold letters highlight differences between T. timopheevii and T. dicoccum; italics indicates the binding sites of the primers.

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

2.

>gij28172940jgbjAF343471.1j Triticum timopheevii clone 456 cytosolic acetyl-CoA carboxylase psi-Acc-2 pseudogene, partial sequence CAGAGCCGGCATCTAGAGGTCCAGCTGCTCTGTGACAAGCACGGCAACGTAGCAGCGCTGCACAGTCGGGACTGTAGTGTTCAGAGAAGGCACCAAAAGATTATCGAAGAGGGA CCAATCACTGTTGCTCCCCCAGAGAAGGTTAGAGAGCTTGAGCAGGCAGCAAGGCGGCTCGCTAAATGTGTGCAATATCAGGGTGCTGCTACAGTGGAATTTCTGTACAGCATGGAAA CAGGCGAATACTACTTCCTGGAGCTTAATCCAAGATTGCAGGTAGAACACCCTGTAACCGAATGGATTGCTGGAGTGAACCTACCTGCATCTCAAGTTGCGGTAGGAATGGGCATA CCCCTCTACAACATTCCAGAGATCAGACGCTTTTATGGAATGGAACATGGGGGTGGCTATCATAGCTGGAAGGAAATATCAGCTGTTGCGGCTAAATTTGACTTGGACAAAGCACAGT CTGTAAGGCCAACGGGTCACTGTGTAGCAGTTCGAGTTACTAGCGAGGATCCAGATGATGGGTTTAAGCCTACTGGTGGAAGAGTGGAGGAGCTAAACTTTAAAAGTAAA CCCAATGTTTGGGCCTATTTCTCGGTTAAGTCTGGCGGAGCAATTCATGAGTTTTCTGATTCTCAGTTTGGTCATGTTTTTGCTTTTGGGGAATCCAGGTCGTTGGCAATAGCCAATATG >gij5019395jembjAJ242425.1jTTI242425 Triticum timopheevii internal transcribed spacer 1 (ITS1) TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAATCTGTCGGCGACGGCACCGTCCGTCGCTCGGCCAATGCCTCGACCACCTCCCCTCCTCGGAGCGGTTGGGTGGT CGGGGTAAAAGAACCCACGGCGCCGAAGGCGTCAAGGAACACTGTGCCTAACCCGGGGGCATGGCTAGCTTGCTAGCCGTCCCTCGTGTTGCAAAGCTATTTAATC >gij5019391jembjAJ238924.1jTTI238924 Triticum timopheevii internal transcribed spacer 2 (ITS2) CAAAACACGCTCCCAACCACCCTTAATGGGAATCGGGATGCGGCATCTGGTCCCTCGTCTCGCAAGGGACGGTGGACCGAAGATCGGGCTGCCGGTGTACCGCGCCGAACACAGCG CATGGTGGGCGTCCTCGCTTTATCAATGCAGTGCATCCGACGCGCAGCTGGCATTATGGCCTCTAAACGACCCAACAAACGAAGCGCACGTCGCTTCGACC >gij21970jembjX66385.1jTT5SRNA38 Triticum timopheevii gene for 5S rRNA (pTt5S38) GGATGCGATCATACGAGCACTAACGCACCGGATCCCATCAGAACTCTGAAGTTAAGCGTGCTTGGGTGAGAGTAGTACTAGGATGGGTGACCTCCTCGGAAGTCCTCGTGTTGCATT CCCTTTTTAATTATTTTTTGCGCCTCGTGCAAACACTATCGCATGTGCGCGTTATATATTAACCCCGTTATATTACTCTTGACATTTGCGATATGTTTTAGCTCGCTGCTCGTTGGTGACG CGTCTAGAGGCGGCTTTGTGGCACCAGGAGCGCGCCCTCGAAGGGGTAAAAAAATACGTGTGCGCGGTATAGAGGGAAGGGGTGGAAACCGTGGTAAACGCGTCT CCGTGTTTGAGGGGGGGAGTAAGTTGTATGTATAGGGCATTATCCCATTATTAGGCAACGGTTGTAATGGTAGTAAGAATGTACAATCATCTTTGCAGTGGACCTGGGAGTGGCAAG CGTAAGGGACGAAGGCGGGGGTAACATGTC >gij1935011jembjY12404.1jTTHMWGS4 Triticum timopheevii 50 region of gene encoding HMW glutenin subunit, Glu-G1-1Tim GATTACGTGGCTTTAGCAGACTGTCCAAAAATCTGCTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAACTTCTTTTGTGTTGGCAAATTGTGCCTTTCCAATTGACTTTATTCTTCT CACGGTTTCTTCTTAGGCTGAACTAACCTCGCCGTGCACACAACCATTGTCCCGAACCTTCACCCTGTCCCTATAAAAGCCTAGCCAACCTTCACAATCTCCTCATCACCCACAACA CCGAGCA >gij1935010jembjY12403.1jTTHMWGS3 Triticum timopheevii 50 region of gene encoding HMW glutenin subunit, Glu-G1-2Tima GATTACGTGGCTTTAGCAGACTGTCCAAAAATCTGCTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCAACTTCTTTTGTGTTGGCAAATTGTGCCTTTCCAATTGACTTTATTCTTCTCA CGGTTTCTTCTTAGGCTGAACTAACCTCGCCGTGCACACAACCATTGTCCCGAACCTTCACCACGTCCCTATAAAAGCCCAACCAATCTCCACAATCTCATCATCACCCACAACA CCGAGCA >gij19070401jgbjAF346584.1j Triticum timopheevii waxy (WX-Tt1) gene, partial cds GACCAAGGAGAAGATCTATGGGCCCGACGCCGGCACGGACTACGAGGACAACCAGCTACGCTTCAGCCTTCTCTGCCAGGCAGCACTTGAGGTGCCCAGGATCCTCGACCTCAA CAACAACCCATACTTTTCTGGACCCTACGGTAAGATCAACAACACCCAGCTAGCTACTTAGTAGAGTGTATCTGAAGAACTTGATTTCTACTCGAGAGCACTGGATGATCATCATTTT CCTTGTACCTGGGTGCTGCCATGCCGTGCCGCGCAGGGGAAGACGTGGTGTTCGTGTGCAACGACTGGCACACGGGCCTTCTGGCCTGCTACCTCAAGAGCAACTACCAGT CCAATGGCATCTATAGGACGGC

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

243

Table 2 Primers sequences, their theoretical melting temperatures and fragment lengths Primer

Oligonucleotide sequence

Melting temperature ( C)

AcCoA timF AcCoA timR

TGTTGCTCCCCCAGAGAAG GTACAGAAATTCCACTGTAGC

60 60

99

ITS1 timF ITS1 timR

CTCGGAGCGGTTGGGTGGT TTCGGCGCCGTGGGTTCT

64 60

46

ITS2 timF ITS2 timR

AGATCGGGCTGCCGGTGTAC GTCGTTTAGAGGCCATAATGC

66 62

106

ITS1 controlF ITS1 controlR

GGGCTCGGGGTAAAAGAAC GTGTTCCTTGACGCCTTCG

60 60

46

ITS2 controlF ITS2 controlR

AAGATTGGGCTGCCGGCGTA GTCGTTCAAAGGCCATAATGC

64 62

107

Product size (bp)

Fig. 3A reports the amplification pattern for ITS1 tim primer combination, achieved with an annealing temperature of 70  C, decreasing 0.1 for each cycle down to 67  C, and with the following reagents: 1 mL of modern DNA solution, 1 PCR buffer, 1.5 mM MgCl2, 0.75 mM of each primer, 0.1 mM dNTPs and 1 unit Taq polymerase. Lanes 1 and 14 of the acrylamide gel host the molecular weight ladder (PCR low ladder set, Sigma-Aldrich), lanes 2 and 13 the negative controls, lanes 3 and 4 T. zhukovskii, lanes 5e7 T. timopheevii and lanes 8e12 T. dicoccum. The only amplified DNAs belong to the T. timopheevii and T. zhukovskyi accessions. The molecular weight of the DNA fragments is 46 bp, as expected. Fig. 3B presents the PCR results for ITS2 tim primers combination. The amplification was carried out at an annealing temperature of 70  C, with the follow reagents: 1 mL of modern DNA solution, 1 buffer, 1.5 mM MgCl2, 0.5 mM of each primer, 0.1 mM dNTPs, 1 unit of TAQ. Lanes 1 and 13 of the acrylamide gel host the molecular weight ladder, lane 2 the negative control, lanes 3, 5 and 6 T. timopheevii, lane 4 T. zhukovskyi, lane 7 T. araraticum, lanes 8e10 T. dicoccum, lane 11 T. durum and lane 12 T. spelta. The image shows, once again, only the amplification of the samples of the T. timopheevii complex, with fragments that have the expected length of 106 bp. Fig. 3C reports the results of the amplification achieved with the AcCoA tim primers, obtained at an annealing temperature of 66  C and with the following amplification mix: 1 mL of modern DNA solution, 1 buffer, 1.5 mM MgCl2, 0.5 mM of each primer, 0.1 mM dNTPs, 1 unit of TAQ. Lane 13 of the acrylamide gel host the molecular weight ladder, lanes 1, 3 and 4 T. timopheevii, lane 2 T. zhukovskyi, lane 5 T. araraticum, lanes 6e8 T. dicoccum, lane 9 T. durum, lanes 10 and 11 T. spelta, and lane 12 the control. Only the samples of the T. timopheevii complex are amplified; the fragments have the expected length of 99 bp. The ITS1 control and ITS2 control amplifications (not shown) were performed at 66  C and 72  C annealing temperatures, respectively, and with the following amplification mix: 1 mL of modern DNA solution, 1 buffer, 2.5 mM MgCl2, 0.5 mM of each primer, 0.1 mM dNTPs, 1 unit of TAQ.

Fig. 3. Polyacrylamide gel electrophoresis of the amplicons obtained from modern DNA with the three selected primer combinations. (A) ITS1 tim primers. Lanes 1 and 14, molecular weight ladder; lanes 2 and 13, negative control; lanes 3 and 4, T. zhukovskyi; lanes 5e7, T. timopheevii; lanes 8e12, T. dicoccum. (B) ITS2 tim primers. Lanes 1 and 13, molecular weight ladder; lane 2, negative control; lane 3, T. zhukovskyi; lanes 4e6, T. timopheevii; lane 7, T. armeniacum; lanes 8e10, T. dicoccum; lane 11, T. durum; lane 12, T. spelta. (C) AcCoA tim primers. Lane 1, T. zhukovskyi; lanes 2e4, T. timopheevii; lane 5, T. armeniacum; lanes 6e8, T. dicoccum; lane 9, T. durum; lanes 10 and 11, T. spelta; lane 12, negative control; lane 13, molecular weight ladder.

The three selected primer combinations consistently amplified T. timopheevii/armeniacum/zhukovskii DNA fragments of the expected length and failed to amplify T. dicoccum/durum/ dicoccoides/spelta DNA. Similarly, the control primer

244

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

combinations consistently amplified DNA of all the Triticum species, subspecies and samples tested. 3.3. PCR analysis of the archaeological samples The DNA was extracted by the archaeological charred samples following the same methods applied to the modern samples. However, in all the extraction steps the suspensions showed an amber-orange colour, suggesting the presence of unknown substances. Small dark pellets were observed before resuspension. After DNA extraction, a preliminary electrophoresis was carried out to verify the presence of visually detectable ancient DNA. In all cases, the only DNA observed was that of the modern control accessions. In the acrylamide gel loaded with putative DNA from the Sammardenchia site samples, whitish halos were visualised (Fig. 4). These halos were absent both in the modern samples and in the ancient samples from La Marmotta. The primers ITS1 tim, ITS2 tim and AcCoA tim were then used to amplify the putative DNAs extracted from the archaeological samples from Sammardenchia and La Marmotta, as well as on some control modern samples. The starting amplification conditions were those previously optimised using the modern DNA samples. An acrylamide gel electrophoresis of the amplified samples is presented in Fig. 5A. Neither the Neolithic samples (lanes 3e10, 16e23 and 29e36) nor the modern T. dicoccum checks (lanes 12, 25 and 38) showed amplifications, while the modern T. timopheevii checks (lanes 11, 24 and 37) presented fragments of the expected lengths. All the ancient samples from Sammardenchia showed the white halos previously cited. To reduce possible negative effects on the PCR by the unknown products, a few amplifications were performed after diluting the extracts up to 16 times; the results, however, did not change. Fig. 5B presents an acrylamide gel electrophoresis of the samples amplified using a control primer combination (ITS2 control): no ancient DNA is observed, as the only amplicons (lanes 31e39) belong to modern wheats samples. 4. Discussion The recovery of nucleic acids from ancient or prehistoric plants and animals remains raised an initial enthusiasm among

researchers, as ancient DNA analysis opened new research perspectives both in the archaeological and in that molecular field. The astonishing declarations purporting DNA extraction from very old remains, such as from a Cretaceous dinosaur (Zischler et al., 1995), were subsequently proved wrong, as the putative DNA was the result of modern DNA contamination during the recovery of the remains and their analysis (Pa¨a¨bo and Wilson, 1991; Wang et al., 1997; Young et al., 1995; Younsten and Rippere, 1997). Several reports nevertheless confirmed the retrieval, in special cases, of aDNA (Hagelberg and Clegg, 1991; Hanni et al., 1990; Horai et al., 1989, 1991; Pa¨a¨bo, 1984, 1985; Rollo et al., 1988; Thuesen and Engberg, 1990). In almost all the cases, the specimens were preserved in optimal (dry and cool) conditions: even more remarkable, therefore, was DNA recovery from charred samples of 2000e2500-year-old wheat (Allaby et al., 1994) and 600-year-old maize (Goloubinoff et al., 1993). The charred grains and spikelet bases from the Sammardenchia site showed the presence of specimens attributable to the ‘‘new’’ glume Triticum, first recognized in Greece (Jones et al., 2000) but also present in many other excavations in Europe (Kohler-Schneider, 2003). The study of spikelet bases (Jones et al., 2000) and charred kernels (Kohler-Schneider, 2003) suggested the existence of similarities between the ‘‘new’’ wheat and Triticum timopheevii, a glume wheat actually cultivated on limited areas in the Caucasian Georgia. The use of aDNA for the unequivocal identification of the ‘‘new’’ wheat species was attempted by Kohler-Schneider (2003) on samples from the Austrian site of Stillfried. However, the DNA gene (ribulose-1,5-bisphosphate-carboxylase) recovered and sequenced was not discriminant among Triticum species. Therefore, while the possibility of extracting useful aDNA from charred wheat grains was confirmed, the identity of the ‘‘new’’ wheat was unresolved. While full sequencing of the ancient DNA fragments is still the ultimate test, the use of PCR-based techniques could be useful for the quick and cheap assessment of DNA quality, before more expensive and time consuming but precise techniques are employed. Brown (1999), assessing the absolute length of DNA recovered from charred kernels, found that fragment size varied between 10 and 250 bp, with a mean of 50e70 bp. Therefore, selective primers inducing the amplification of very short but highly specific DNA regions might

Fig. 4. Polyacrylamide gel electrophoresis of the DNA extracts. Lanes 1e9, samples from Sammardenchia (1, 4, 6 and 9, ‘‘new’’ wheat; 2, 3, 5, 7 and 8, T. dicoccum); lanes 10e17, La Marmotta site (all samples are T. dicoccum); lane 18, sample from Sammardenchia (undetermined T. dicoccum/timopheevii); lane 19, modern T. timopheevii; lane 20, negative control; lanes 21 and 22, modern T. dicoccum; lanes 23e29, Sammardenchia samples (23e26, ‘‘new’’ wheat; 27 and 29, T. dicoccum; 28, undetermined T. dicoccum/timopheevii).

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

245

Fig. 5. Polyacrylamide gel electrophoresis of the amplicons obtained with the primer combinations: (A) ITS2 tim (lanes 1e13), ITS1 tim (lanes 15e26) and AcCoA tim (lanes 28e39). Lanes 1, 14, 27 and 40, molecular weight ladder; lanes 2e10, 15e23 and 28e36: ‘‘new’’ glume wheat samples from Sammardenchia; lanes 11, 24 and 37, modern T. timopheevii; lanes 12, 25 and 38, modern T. dicoccum; lanes 13, 26 and 39, negative controls. (B) ITS2 control. Lanes 1, 21 and 40, molecular weight ladder; lanes 2e10, ‘‘new’’ glume wheat samples from Sammardenchia; lanes 11e17 and 19e22, T. dicoccum samples from Sammardenchia; lanes 23e28, T. dicoccum samples from La Marmotta; lanes 29 and 30, negative controls; lanes 31, 32, 35 and 36, modern T. timopheevii; lanes 33, 34, 37, 38 and 39, modern T. dicoccum.

facilitate the identification of useful samples and their classification. As pointed out by several authors (Leonard et al., 2000; Loreille et al., 2001; Vila` et al., 2001), organellar DNA is theoretically more useful than nuclear DNA for the molecular analysis of archaeological samples because is protected by additional walls and is present in far more copies per cell than nuclear DNA, thus allowing it better survival chances. The two ribosomal primers ITS1 and ITS2, as well as the nuclear primer AcCoA, amplified short DNA fragments of 46, 106 and 99 bp, respectively, and showed a very good capacity to distinguish between modern T. turgidum and T. timopheevii accessions. However, they were unable to amplify the aDNAs from the Sammardenchia and La Marmotta samples. Independently from the preservation conditions, it is acknowledged that ancient DNA conservation is related to charring temperatures, since excessive heat (above 200  C) leads to the complete destruction of DNA (Threadgold and Brown, 2003). This might be our case, because the specimens from Sammardenchia showed the presence of whitish halos in the gels, suggesting the presence of unidentified substances, probably produced during the carbonization process. Threadgold and Brown (2003), in their charring tests of modern kernels, noticed halos in gels with completely degraded DNA and identified them as products of the Maillard reaction. Interestingly, Maillard products are well known polymerase inhibitors (Tebbe and Vahjen, 1993).

The charred kernels from La Marmotta, instead, did not present traces of aDNA or of unknown substances. The different behaviour of the samples from the two sites is probably related to the different preservation conditions: while in Sammardenchia the kernels were retrieved from closed underground pits, the La Marmotta site was completely under water. Examples of remains preservation in strongly hydrated environment are the mummified corpses recovered by the English and Danish peat bogs (Tollund man, Lindow man). Analyses executed on the Lindow man showed that the DNA was completely degraded although the anoxic conditions, the relatively low temperature and the reduced microbial activity concurred to the corpse preservation (Hughes et al., 1986). The results of aDNA extractions from charred grains suggest that the samples from Sammardenchia, and even more the samples from La Marmotta, underwent deep alterations during the carbonization processes and then during the preservation, making the recovery of aDNA improbable. The presence of Maillard products or of other unknown polymerisation-antagonistic substances cannot be completely excluded, although the trials carried out with increasingly diluted samples seem to rule it out. 5. Conclusions The morphometric analysis of charred kernels and spikelet bases recovered in the two examined archaeological sites led

246

P. Boscato et al. / Journal of Archaeological Science 35 (2008) 239e246

to the identification, among the specimens from Sammardenchia, of several kernels attributable to the ‘‘new’’ wheat type as described by Kohler-Schneider (2003). The ribosomal (ITS1 and ITS2) and nuclear (AcCoA) primers selected for PCR amplification clearly discriminated modern T. timopheevii from T. dicoccum. However, they failed to amplify DNA fragments from archaeological samples, because the DNA in the charred kernels was too degraded. References Allaby, R.G., Jones, M.K., Brown, T.A., 1994. DNA in charred wheat grains from the Iron Age hill fort at Danebury, England. Antiquity 68, 126e 132. Blatter, R.H.E., Jacomet, S., Schlumbaum, A., 2002. Little evidence for the presence of a single-copy gene in charred archaeological wheat. Ancient Biomolecules 4 (2), 65e77. Brown, T.A., 1999. How ancient DNA may help in understanding the origin and spread of agriculture. Philosophical Transactions of the Royal Society B: Biological Sciences 354, 89e98. Goloubinoff, P., Pa¨a¨bo, S., Wilson, A.C., 1993. Evolution of maize inferred from sequence diversity of an Adh2 gene segment from archaeological specimens. Proceedings of the National Academy of Sciences of the United States of America 90, 1997e2001. Hagelberg, E., Clegg, J.B., 1991. Isolation and characterization of DNA from archaeological bone. Proceedings of the Royal Society B: Biological Sciences 244, 45e50. Hanni, C., Laudet, V., Sarra, M., Begue, A., Stehelin, D., 1990. Amplification of mitochondrial DNA fragments from ancient human teeth and bones. Comptes Rendus de l’Acade´mie des Sciences, Paris, Serie III 310, 365e370. Hillman, G.C., Mason, S., de Moulins, D., Nesbitt, M., 1996. Identification of archaeological remains of wheat: the 1992 London workshop. Circaea 12 (2), 195e209. Horai, S., Hayasaka, K., Murayama, K., Wate, N., Koike, H., Nakai, N., 1989. DNA Amplification from ancient human skeletal remains and their sequence analysis. Proceedings of the Japan Academy, Series B 65, 229e233. Horai, S., Kondo, R., Murayama, K., Hayashi, S., Koike, H., Nakai, N., 1991. Phylogenetic affiliation of ancient and contemporary humans inferred from mitochondrial DNA. Philosophical Transactions of the Royal Society B: Biological Sciences 333, 409e417. Hughes, M.A., Jones, D.S., Connolly, R.C., 1986. Body in the bog but no DNA. Nature 323, p. 208. Kohler-Schneider, M., 2003. Contents of a storage pit from late Bronze Age Stillfried, Austria: another record of the ‘‘new’’ glume wheat. Vegetation History and Archaeobotany 12, 105e111. Kushnir, U., Halloran, G.M., 1983. Evidence on the G genome in wheat: the description of a Triticum timopheevii-like mutant. Annals of Botany 51, 561e569. Jones, G., Valamoti, S., Charles, M., 2000. Early crop diversity: a ‘‘new’’ glume wheat from northern Greece. Vegetation History and Archaeobotany 9, 133e146.

Leonard, J.A., Wayne, R.K., Copper, A., 2000. Population genetics of Ice Age brown bears. Proceedings of the National Academy of Sciences of the United States of America 97, 1651e1654. Loreille, O., Orlando, L., Patou-Mathis, M., Philippe, M., Taberlet, P., Hanni, C., 2001. Ancient DNA analysis reveals divergence of the cave bear, Ursus spelaeus, and brown bear, Ursus arctos, lineages. Current Biology 11, 200e203. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., Erlich, H., 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symposium in Quantitative Biology 51, 263e273. ¨ ber den Nackweis von DNA in alta¨gyptischen Mummien. Pa¨a¨bo, S., 1984. U Das Altertum 30, 213e218. Pa¨a¨bo, S., 1985. Molecular cloning of Ancient Egyptian mummy DNA. Nature 314, 644e645. Pa¨a¨bo, S., Wilson, A.C., 1991. Miocene DNA sequences: a dream comes true? Current Biology 1, 45e64. Rollo, F., Amici, F.A., Salvi, R., Garbuglia, A., 1988. Short but faithful pieces of ancient DNA. Nature 335, p. 774. Rottoli, M., 1993. Analisi paletnobotaniche: prime risultanze, ‘‘La Marmotta’’, Anguillara Sabazia (RM), Scavi 1989, Appendice 1, Un abitato perilacustre di eta` neolitica. Bullettino di Paletnologia Italiana, Roma, Nuova Serie II 84, 305e315. Rottoli, M., 2004. Un nuovo frumento vestito nei siti neolitici del FriuliVenezia Giulia (Italia nord orientale). Gortania 26, 67e78. Tebbe, C.C., Vahjen, W., 1993. Interference of humic acids and DNA extracted directly from soil in detection and transformation of recombinant DNA from bacteria and a yeast. Applied and Environmental Microbiology 59, 2657e2665. Schlumbaum, A., Neuhaus, J.M., Jacomet, S., 1998. Coexistence of tetraploid and hexaploid naked wheat in a Neolithic lake dwelling of central Europe: evidence from morphology and ancient DNA. Journal of Archaeological Science 25, 1111e1118. Threadgold, J., Brown, T.A., 2003. Degradation of DNA in artificially charred wheat seeds. Journal of Archaeological Science 30, 1067e1076. Thuesen, I., Engberg, J., 1990. Recovery and analysis of human genetic material from mummified tissue bone. Journal of Archaeological Science 17, 679e689. Vila`, C., Leonard, J.A., Go¨therstro¨m, A., Marklund, S., Sandberg, K., Lide´n, K., Wayne, R.K., Ellegren, H., 2001. Widespread origins of domestic horse lineages. Science 291, 474e477. Wang, H.-L., Yan, Z.-L., Jin, D.-Y., 1997. Reanalysis of published DNA sequence amplified from Cretaceous dinosaur egg fossil. Molecular Biology and Evolution 14, 589e591. Young, D.L., Huyen, Y., Allard, M.W., 1995. Testing the validity of the cytochrome B sequence from Cretaceous period bone fragments as dinosaur DNA. Cladistics 11, 199e209. Younsten, A.A., Rippere, K.E., 1997. DNA similarity analysis of a putative ancient bacterial isolate obtained from amber. FEMS Microbiology Letters 152, 345e347. Zischler, H., Hoss, M., Handt, O., von Haeseler, A., van der Kuyl, A.C., Goudsmit, J., 1995. Detecting dinosaur DNA. Science 268, 1192e1193. Zohary, D., Hopf, M., 2000. Domestication of Plants in the Old World. The Origin and Spread of Cultivated Plants in West Asia, Europe and the Nile Valley, third ed. Oxford University Press, London.