- Email: [email protected]
Molecular, serological and biological characterization of a novel Apple stem pitting virus strain from a local pear variety grown in China
Journal of Integrative Agriculture 2019, 18(11): 2549–2560 Available online at www.sciencedirect.com
ScienceDirect
RESEARCH ARTICLE
Molecular, serological and biological characterization of a novel Apple stem pitting virus strain from a local pear variety grown in China LI Liu1, 2*, ZHENG Meng-meng1, 2*, MA Xiao-fang2, LI Yuan-jun3, LI Qing-yu3, WANG Guo-ping1, 2, HONG Ni1, 2 1
State Key Laboratory of Agromicrobiology, Huazhong Agricultural University, Wuhan 430070, P.R.China Key Laboratory of Crop Disease Monitoring and Safety Control in Hubei Province, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, P.R.China 3 Yantai Academy of Agricultural Science, Yantai 264000, P.R.China 2
Abstract Apple stem pitting virus (ASPV) is an important causal agent of pear diseases. Nowadays, the infection status and molecular characteristics of the virus in old pear trees have never been investigated. In this study, we provide the first complete genome sequence of an ASPV isolate LYC from an over 300-year-old tree of a local Pyrus bretschneideri cultivar ‘Chili’ specifically grown at Laiyang area in China. ASPV-LYC possesses a chimeric genome consisting of 9 273 nucleotides excluding a poly(A) tail at its 3´ end and harboring a recombination region in its open reading frame (ORF1) with Aurora-1 and KL9 identified as the major and minor parents. Western blot analysis with antisera against recombinant coat proteins (CPs) of three ASPV isolates from pear indicates that ASPV-LYC is serologically related to these ASPV isolates, but with differential activities. Further biological tests on indicator plants of Pyronia veitchii show that ASPV-LYC can induce serious leaf and stem symptoms as other ASPV isolates. The results provide an important information for understanding molecular evolution of ASPV and suggest a need to prevent dissemination of the isolate among pear trees. Keywords: pear, apple stem pitting virus, genome, Western blot
1. Introduction
Received 25 September, 2018 Accepted 10 January, 2019 LI Liu, E-mail: [email protected]; ZHENG Meng-meng, E-mail: [email protected]; Correspondence HONG Ni, Tel: +86-27-87281096, Fax: +86-27-87384670, E-mail: whni@mail. hzau.edu.cn * These authors contributed equally to this study. © 2019 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/). doi: 10.1016/S2095-3119(19)62636-5
Apple stem pitting virus (ASPV) is a common virus of apple and pear worldwide (Nemeth 1986; Sutic et al. 1999). Recently, ASPV infection in cherry and sour cherry in India has been reported (Dhir et al. 2010). The virus infection in apple and most pear trees is usually asymptomatic. However, the virus infection can induce leaf vein yellowing (Jelkmann 1994) and red mottling (Desvignes et al. 1999) or necrotic spot (Kishi et al. 1976) and fruit stony pits on susceptible pear trees (Paunovic et al. 1999). The virus is also associated with quince (Cydonia oblonga) fruit deformation disease (Mathioudakis et al. 2006, 2009). Additionally, ASPV induces xylem pits in the stem of Malus
2550
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
pumila ‘Virginia crab’, as well as epinasty and decline of M. domestica ‘Spy227’ (Jelkmann 1994; Brakta et al. 2015). ASPV infection in apple and pear trees occurs frequently in combination with other viruses, including Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), and Apple mosaic virus (ApMV). Mixed infection of ACLSV, ASGV and ASPV causes significant decreases in the quality and quantity of fruits and even induces tree top working disease (Nemeth 1986; Brakta et al. 2013). There is no insect vector reported for ASPV (Martelli and Jelkmann 1998). ASPV is the type species of the genus Foveavirus, family Betaflexiviridae in the order Tymovirales (Adams et al. 2012). The positive-sense single-stranded RNA (+ssRNA) genome of ASPV is approximately 9 300 nucleotides (nts) in length, consists of 5 open reading frames (ORF1–5), 5´ and 3´ untranslated regions (UTRs), as well as the two short intergenic non-coding regions (IG-NCRs) located between ORF1 and ORF2 and between ORF4 and ORF5. ORF1 encodes a viral replicase polyprotein, ORF2–4 encode triple gene block proteins (TGBps) and ORF5 encodes the viral coat protein (CP) (Jelkmann 1994). Previous studies have revealed the remarkable genetic variability among the ASPV isolates (Wu et al. 2010; Liu et al. 2012; Yeon et al. 2014). Until now, complete genome sequences have been available for 17 ASPV isolates, including 12 isolates (PB66, IF38, PA66, Palampur, YL, YT, PM8, Hannover, GA4, GA2, AKS and XC) from apple grown in different countries and five isolates (PR1, HB-HN1, KL9, KL1 and YLX) from pear grown in China (Liu et al. 2012; Ma et al. 2016). Additionally, a virus identified as apple green crinkle associated virus (AGCaV) was molecularly characterized from Aurora Golden Gala apple showing severe symptoms of green crinkle disease, which was considered as a new virus or a novel strain of ASPV (James et al. 2013). More recently, an isolate AGCaV-CYD involved in a severe disease of quince (Cydonia oblonga) was identified and characterized in Italy (Morelli et al. 2017). The two AGCaV isolates have the same genomic structure as that of ASPV isolates, but are molecularly and biologically divergent from the type strain PA66 of ASPV and other ASPV isolates. As one of the most important temperate fruit trees, with the third largest growing area worldwide, pear has a long cultivation history. China is the largest commercial pear fruit producer in the world, and also an important origin center of pears with a long history of pear cultivation (Teng 2011). There are abundant local pear varieties with broad genetic diversities and ecotypes suitable for growing under different ecological conditions in China, but the knowledge on molecular characteristics of ASPV-infecting pear trees is very limited. The pear ‘Chili’ is an old local variety of Pyrus bretschneideri, originated at Laiyang, Chiping and
Muping regions of Shandong Province (Teng 2011). Until now, there are still many old ‘Chili’ trees specially grown at these places. To understand the virus infection statues in old ‘Chili’ trees and virus molecular characteristics, we carried out a molecular detection for three well-known viruses ASGV, ASPV and ACLSV in old ‘Chili’ trees and identified an ASPV (ASPV-LYC) with novel molecular characteristics. This study provided the first complete genome sequence of an ASPV isolate from an over 300-year-old pear tree. The serological relationship of ASPV-LYC with other three ASPV isolates was comparatively evaluated. The obtained results provide important information for understanding the molecular evolution of the virus.
2. Materials and methods 2.1. Sample sources In 2013, young leaves were randomly collected from five trees of pear (P. bretschneideri cv. Chili) grown at Laiyang area, Shandong Province, China. The trees were over 300 years old, without experiencing top-working manipulation, and did not show visible viral disease-like symptom. The leaves from the same pear tree were bulked as one sample and the presence of viruses in each sample was tested by RT-PCR.
2.2. RT-PCR detection Total RNA was extracted from leaves using silica spin column (SSC)-based protocol I (SSC-PI) (Yang et al. 2017). Reverse transcription was performed using Maloney murine leukemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI, USA) and a random primer hexadeoxyribonucleotide mixture pd(N)6 (TaKaRa, Dalian, China) at 37°C for 1.5 h. PCR reaction solution in a final volume of 25 µL contained 2.5 µL of 10× PCR buffer, 2.5 µmol L–1 dNTPs, 0.5 µmol L–1 of each primer, 0.25 U of Taq DNA polymerase (TaKaRa, Dalian, China), and 2 µL of cDNA. PCR reactions were carried out in a Mastercycler (Eppendorf, Hamburg, Germany) using the following conditions: an initial denaturation step at 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 54°C for 30 s, 72°C for 1 min, and a final extension for 10 min at 72°C. The PCR products were separated by electrophoresis on 1.2% agarose gels, stained with ethidium bromide, and visualized under UV light. The primer sets ASPV247-F/ASPV247-R (5´-CAGTAT TGTGCCTTYTAYGCRAAGC-3´/5´-CCATAGAACGGAT GCGGTACATYTG-3´) (Yao et al. 2014) and 370A/370B (5´-ATGTCTGGAACCTCATGCTGCAA-3´/5´-TTGGGAT CAACTTTACTAAAAAGCATAA-3´) (Menzel et al. 2002)
2551
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
targeting to the CP gene of ASPV were utilized for the RTPCR detection of ASPV. Meanwhile, primer pairs ASGV-U/ ASGV-2 (5´-CCCGCTGTTGGATTTGATACACCTC-3´/ 5 ´ - G G A AT T T C A C A C G A C T C C TA A C C C T C C - 3 ´ ) specific for ASGV (James 1999) and ACLSV-52/ ACLSV-53 (5´-CAGACCCTTATTGAAGTCGAA-3´/5´GGCAACCCTGGAACAGA-3´) specific for ACLSV (German et al. 1990) were also included in the assays.
2.3. Determination of complete genome sequence of ASPV Initially, a primer set F7/R7 (5´-CCTTATTACCACCC ATTAGGT-3´/5´-GGGATCAACTTTACTAAAAGCAT-3´) designed basing on multiple alignments of ASPV sequences available in GenBank was used to amplify a 1 317-bp fragment (f7) containing the ASPV CP gene. Then, primer sets used to amplify other 6 fragments (f1–f6) were designed basing on the obtained CP gene sequence and sequences conserved in the genomes of all ASPV isolates available in GenBank (Table 1). To overcame inconvenient associated with intra-isolate sequence diversity and avoid mistakes during sequence assembling, adjacent amplicons were overlapped for more than 150 bp. To obtain the 5´ terminal sequence, primers 5´ RACE Out R1 and 5´ RACE Out R2 were designed based on the obtained sequence of fragment f1 and a random primer
mixture pd(N)6 was used for cDNA synthesis. The 5´ RACE reactions were attempted using an Invitrogen GeneRacer Kit (Invitrogen, USA) according to the manufacturer’s instructions. To obtain the 3´ terminal sequence, primers 3-Out-F1 and 3-Out-F2 were designed based on the obtained sequence of fragment f7. A common primer M4-T (Chen et al. 2002) was used for reverse transcription, primer set 3-Out-F1/M4 was used for the first round of amplification and primer set 3-Out-F2/M4 was used for the second round of amplification in semi-nested PCR reactions. Composition of the PCR reaction mixtures and the associated PCR conditions were similar to those mentioned above. In PCR solutions, LA Taq polymerase (TaKaRa, Dalian, China) was used to facilitate PCR reactions, and 40 µmol L–1 of each dNTP was used in a 25-µL reaction volume. For PCR reactions, the annealing step was performed for 45 s at 54–56°C (depending on the primer set used in each reaction), and the extension step was performed for 3–4 min (depending on the sizes of the PCR products) at 72°C. PCR products were gel-purified, inserted into the vector pMD18-T (TaKaRa, Dalian, China) and transformed into Escherichia coli DH5α following the manufacturer’s instructions. To obtain a view of molecular composition intra the isolate, at least three positive clones of each product were sequenced at a commercial sequencing service (Shanghai Sangon Biological Engineering & Technology and Service Co., Ltd., Shanghai, China). The
Table 1 Primers designed for RT-PCR amplification of Apple stem pitting virus isolate ASPV-LYC genome Fragment f1 f2 f3 f4 f5 f6 f7 3´ UTR
5´ UTR
1)
Primer1) F1 R1 F2 R2 F3 R3 F4 R4 F5 R5 F6 R6 F7 R7 3-Out-F1 3-Out-F2 M4 M4-T 5´ RACE Out F1 5´ RACE Out R1 5´ RACE In F2 5´ RACE In R2
Primer sequence (5´→3´)2) GCAGAGGAAGTAATCGCATC CGGTGAAGTTAACAACATCCC ACTCTTAAGAAGCCAGACCT TGTTGCATAGGCACATGTCA TCCTTATGCCHTTTGGATT ATTTGCTAGTTTTCTTTCCACCAG TAGAGTTTCAAAYAGYGCVA TTTTGCACTTCTAAATCTGT ATTGGAGACATTACTACCGA AGAAACAGTCTGATTCCC CTTGTAATTTTAATAATGGAAACTGTGC AGCAACTGGCGAGCTGGTG CCTTATTACCACCCATTAGGT GGGATCAACTTTACTAAAAGCAT CCTTATTACCACCCATTAGGT AGAACCTGCTGATGGGCTTG GTTTTCCCAGTCACGAC GTTTTCCCAGTCACGAC(T)15 CATGGCTACATGCTGACAGCCTA GCGTTGTGATTCTTCCAGTCCT CGCGGATCCACAGCCTACTGATGATCAGTCGATG TCAAAGCCAGTCCTTCTATCACA
F, forward primer; R, reverse primer. H is A or C or T; R is A or G; V is A or C or G; W is A or T and Y is C or T. 3) The locations refer to nucleotide positions corresponding to the genome sequence of ASPV-LYC. 2)
Location (nt)3) 84–1 479
Product size (bp) 1 396
1 068–2 910
1 843
2 530–4 338
1 809
3 971–5 774
1 804
5 334–7 064
1 731
6 669–8 052
1 384
7 886–9 202
1 317
7 817 8 961
1 489 345
879 830 568 507
2552
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
obtained sequences were assembled into a contiguous sequence at a standard of over 99.9% similarities at each of the overlapped regions.
2.4. Sequence analyses Sequences were aligned using Clustal W 2.0 with default settings, and imported into the MEGA 7.0.14 Program. Multiple nucleotide sequence alignments were performed using the MUSCLE algorithm implemented in the MEGA 7.0.14 Program (Kumar et al. 2016). Phylogenetic trees were inferred by using the Maximum Likelihood method packaged in the MEGA 7.0.14 Program with 1 000 bootstrap replicates. The sources and GenBank accession numbers of the genomic sequences of ASPV isolates and two AGCaV isolates referred from the GenBank database (www. ncbi.nlm.nih.gov) were listed in Appendix A. The putative epitopes of ASPV coat protein were analyzed with a Kolaskar and Tongaonkar method (1990). Surface plot and antigenic index analysis packaged in the DNAStar Software (DNAStar, Madison, WI, USA).
2.5. Expression of ASPV CP genes in E. coli and Western blot assay The CP gene of isolate ASPV-LYC was inserted into prokaryotic expression vector pET-28a(+) (Novagen, Madison, WI, USA) for recombinant protein production. Meanwhile, three recombinant prokaryotic expression plasmids containing CP genes of isolates HB-HN6, HB-HN9 and YN-MRS17 (Ma et al. 2016) and the antisera raised against their recombinant coat protein (rCP) (unpublished data) were included in the serological analysis in this study. The recombinant plasmids were denoted as pET-LYC, pET-HN6, pET-HN9, and pET-MRS17 and transformed into E. coli BL-21 (DE3) pLysS competent cells. Protein production was done by adding 0.5 mmol L–1 isopropyl-βD-thiogalactoside (IPTG) into 2-h pre-incubated bacterial culture and inducing at 28°C for 6 h in Luria-Bertani (LB) medium containing 50 mg L–1 kanamycin. The expressed protein was evaluated by 12% SDS-PAGE. Gels were stained with 0.25% Coomassie blue G250 solution. For Western blot, total proteins from induced cells were separated on 12% SDS-PAGE and electro-transferred onto PVDF membranes. Membranes blocked with 5% (w/v) skim milk in PBST (0.01 mol L–1 PBS, 0.05% Tween-20, pH 7.4) were individually incubated with antibodies of HN6, HN9 and MRS17. Alkaline phosphatase-conjugated goat antirabbit IgG diluted at 1:5 000 (Sigma, Germany) was used as the secondary antibody. Antigen-antibody reactions were visualized by incubation in the substrate solution containing 0.35 mg mL–1 nitroblue tetrazolium (NBT) and
0.18 mg mL–1 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (Amresco, USA).
2.6. Biological characterization One-year-old P. betulifolia seedlings were used as root stocks. Each plant was double-grafted (Siebert and Engelbrecht 1981) with a bud from a one-year-old shoot of Pyronia veitchii as an indicator and a bud-chip of ‘Chili’ infected by ASPV-LYC as an inoculum. The inoculation test was triplicated. Three plants mock-inoculated using healthy pear buds as inocula and buds of P. veitchii as indicators were used as negative controls. Symptoms were visualized following sprouting of new leaves during the growing season for three successive years.
3. Results 3.1. Characterization of the genome of ASPV-LYC The primary RT-PCR detection using two sets of ASPVspecific primers ASPV247-F/ASPV247-R and 370A/370B showed that four out of the five ‘Chili’ samples were positive for ASPV. Sequencing for amplified products of ASPV CP gene showed that the ASPV isolates from ‘Chili’ were highly divergent by having low nucleotide sequence similarities (less than 70%) for their partial CP gene with that of other known ASPV isolates, indicating the ASPV isolate from ‘Chili’ might be a novel molecular ASPV variant. Here, it was named as ASPV-LYC based on its geographic and host origins. Thereby, one sample was used for amplifying the complete genome of the ASPV-LYC. The genome of ASPV-LYC (accession no. MG763895.1) was 9 273 nucleotides (nts) long, excluding the poly(A) tail at 3´ end (Table 2). The genomic organization was similar to previously reported ASPV isolates (Jelkmann 1994; Adams et al. 2012). ORF1 (60 to 6 614 nt) encoded a 247-kDa polymerase. The ORF1 contained all domains conserved in RNA polymerases of members in the family Betaflexiviridae (Jelkmann 1994; Zhang et al. 1998; Martelli et al. 2007; Morelli et al. 2011; James et al. 2013). These domains included a methyltransferase at aa 43 to 356, an AlkB-like domain (aa 764 to 854) related to the 2-oxoglutarate- and Fe(II)dependent oxygenase superfamily, a cysteine protease (aa 1 098 to 1 194) homologous to the ovarian tumour (OTU) gene of Drosophila spp., a peptidase (aa 1 200 to 1 287) belonging to the C23 Merops family, a helicase (aa 1 378 to 1 636) and an RNA-dependent RNA-polymerase (RdRp, aa 1 764 to 2 170). Near the C-terminus of the RdRp (aa 2 021 to 2 056), there was the core motif TG(x)3T(x)3NT(x)22GDD conserved in the members of genus Foveavirus (Martelli et al. 2007). ORF2 (672 nts, 6 684 to
2553
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Table 2 Sequence comparison of complete genome and different genomic regions between Apple stem pitting virus isolate ASPV-LYC and 16 ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates (Aurora-1 and CYD) referred from NCBI database Host Pear Apple Quince Apple
Pear
Genome nt % LYC 9 237 – Aurora-1 9 266 79.8 CYD 9 266 76.9 PB66 9 363 77.0 IF38 9 293 73.9 PA66 9 332 76.0 Palampur 9 267 75.5 YL 9 262 75.7 YT 9 270 75.8 PM8 9 284 74.3 Hannover 9 324 73.1 GA2 9 358 78.9 GA4 9 276 77.5 AKS 9 296 76.4 XC 9 286 74.2 KL9 9 265 77.6 KL1 9 265 77.2 HB-HN1 9 270 81.8 YLX 9 291 75.7 Isolate
5´ UTR ORF1 (Rep) ORF2 (TGB1) ORF3 (TGB2) ORF4 (TGB3) nt % nt% aa% nt% aa% nt% aa% nt% aa% 59 – – – – – – – – – 60 100 79.3 92.4 83.8 96.0 84.0 95.0 89.7 87.1 60 95 76.1 80.4 86.0 95.1 81.0 85.8 80.3 74.7 60 98.3 79.9 92.7 77.1 91.0 79.3 89.2 85.1 89.3 60 98.3 76.1 85.1 75.6 89.2 78.5 86.7 85.1 86.7 59 98.3 78.5 91.1 77.4 89.7 81.0 90.0 83.6 85.7 29 82.8 78.4 89.9 75.6 89.2 79.3 88.3 85.1 86.7 33 97.0 77.9 91.6 76.2 90.1 80.2 90.8 86.4 78.7 59 100 78.0 91.2 76.9 89.7 78.8 88.3 84.5 87.1 60 96.6 76.8 86.0 78.4 91.0 79.3 89.2 84.2 82.7 60 94.9 74.3 86.2 79.0 91.9 75.2 85.8 83.6 81.4 60 96.6 80.7 92.8 82.7 96.4 80.2 82.7 86.0 82.7 59 100 79.4 92.6 79.3 91.5 79.3 84.3 84.0 84.3 59 100 78.8 92.1 77.8 91.9 82.6 84.0 83.8 84.0 60 98.3 75.5 88.6 76.8 89.7 79.6 85.0 82.0 82.7 33 100 80.1 92.0 77.8 91.5 77.7 82.5 84.0 81.4 33 100 79.7 91.9 77.4 91.0 79.6 86.7 83.6 84.3 60 98.3 86.0 94.8 76.2 91.0 78.5 87.5 86.0 85.3 27 96.3 77.8 91.0 76.5 90.6 81.0 91.7 85.1 82.7
7 355 nt), ORF3 (363 nts, 7 357 to 7 719 nt) and ORF4 (228 nts, 7 628 to 7 855 nt) consisted of a triple gene block (TGB) and encoded proteins (TGBps 1–3) with molecular masses of 25, 12 and 7 kDa, respectively. ORF5 (1 212 nts, 7 927 to 9 138 nt), encoded a CP with a molecular mass of 42 kDa. Although the CP sizes among ASPV isolates were highly variable, the CP gene of ASPV-LYC had the same size with that of AGCaV isolates Aurora-1 and CYD.
3.2. Sequence comparison between ASPV-LYC and available ASPV and AGCaV isolates The genome sequence of ASPV-LYC was 77% identical to that of ASPV PA66 (size 9 332 nts, accession no. D21829.2), the well-characterized ASPV isolate identified as the type member of the genus (Jelkmann 1994), and shared the highest nucleotide identity of 81.8% with an isolate HBHN1 from pear and the lowest nucleotide identity of 73.1% with isolate Hannover available in GenBank database (Table 2). Its 5´-UTR was highly conserved and its 3´-UTR was divergent by sharing 82.8–100% and 67.9–83.3% nt identities with the corresponding regions of other isolates, respectively (Table 2). Similarly, its ORF1 also showed the highest nucleotide and amino acid sequence identities of 86.0 and 94.8% with HB-HN1 (Table 2). However, its ORF2–5 always showed the highest nucleotide and amino acid identities with that of AGCaV isolates Aurora-1 or CYD (Table 2). Notably, its ORF5 even showed the lowest nucleotide (66.4%) and amino acid sequence (69.3%)
ORF5 (CP) nt% aa% – – 77.4 79.2 74.5 74.2 68.3 73.4 67.2 72.4 67.1 71.4 68.2 72.9 68.3 73.9 68.1 73.1 67.8 72.1 66.9 72.1 69.0 73.1 71.2 72.6 67.2 69.3 67.2 71.4 66.9 71.7 67.3 71.9 66.4 69.3 66.6 68.9
3´ UTR nt % 135 – 131 76.0 132 68.2 135 76.7 132 83.3 132 73.8 135 67.9 132 72.7 122 72.7 131 78.5 132 75.6 134 78.0 134 74.2 128 75.8 132 78.8 130 72.3 130 76.2 129 73.5 133 76.5
identities with that of HB-HN1. Meanwhile, to understand whether the molecular variants of ASPV similar to isolate LYC presented in any other pear trees grown in China, the complete CP genes of ASPV isolates were amplified using primer set F7/R7 from leaf samples of 17 pear trees grown at Hubei, Fujian, Yunnan and Shandong provinces, China. Sequence comparison of CP genes of these isolates together with isolate LYC, 32 ASPV isolates reported previously from our group (Ma et al. 2016) and all ASPV isolates available in GenBank showed that only one isolate from a pear plant grown in Fujian Province, named as FJ-12 (accession no. MG763896.1), had relatively high similarity with the isolate LYC by sharing 84.3% nt and 87.8% aa sequence identities. The result suggested that ASPV isolates with molecular characteristics like ASPV-LYC were rarely found in other cultivated pear plants. Phylogenetic trees were generated from the nucleotide sequences of full genome and ORFs 1–5 of ASPV-LYC and ASPV isolates referred from GenBank (Appendix A). In the full genome-based (Fig. 1-A) and ORF1-based trees (data not shown), ASPV-LYC showed the closest phylogenetic relationship with a pear isolate HB-HN1 (accession no. KU308398.1). The two isolates clustered into the same clade together with isolates KL1 (accession no. JF946775.1) and KL9 (accession no. JF946772.1) from ‘kurle’ pear (P. sinkiangensis), but clearly in two separate sub-clades. In the tree based on the CP gene (ORF5) sequences of ASPV isolates used to generate the full genome-based phylogenetic tree and representative isolates (Fig. 1-B),
2554
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Fig. 1 Phylogenetic analysis of Apple stem pitting virus (ASPV) isolates based on the nucleotide sequences of their genome (A) and coat protein gene (B). All available genome sequences of ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates (Aurora-1 and CYD) are included in the genome-based analysis, and CP sequences of selected ASPV isolates are included in the CP analysis. Sequences previously reported from our group and referred from GenBank are identified by their GenBank accession numbers and hosts following isolate names. Isolates with available full genome sequences are in bold. The isolate LYC sequenced in the present study is indicated by “◆”. Cherry green ring mottle virus (CGRMV) in the genus Foveavirus was as an out group in each tree. The tree was constructed with MEGA 7.0.14 Program using the Maximum Likelihood method (Kumar et al. 2016). The numbers at the nodes indicate the percentage of 1 000 bootstraps occurred in this clade. Values below 60% were suppressed. The bar represents 0.1 substitution per site.
ASPV-LYC tightly clustered together with the isolate FJ-12, and the two isolates together with isolates Aurora-1 and CYD formed a clade, which had relatively close phylogenetic
distance with the clade represented by isolates KL1 and KL9, but was distal to HB-HN1. Multiple alignment for CP sequences of ASPV-LYC, FJ-12, other ASPV isolates and
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
two AGCaV isolates obtained from GenBank revealed that
2555
3.3. Recombination detection
the N-terminal part (about 190 aa) of CP was highly variable (Fig. 2) and the reminded region near the C-terminal part
Recombination events occurred frequently in genomes
of CP was relatively conserved (data not shown). Whilst,
of ASPV and other foveaviruses (Boulila 2010; Dhir et al.
it was noticed that as compared with most ASPV isolates, ASPV-LYC, two AGCaV isolates Aurora-1 and CYD, and the isolate FJ-12, shared two common deletions at aa 49–51 and 117–121 (Fig. 2). Additionally, isolates KL9 and YN-MRS had one and two large deletions, respectively (Fig. 2). The trees based on the sequences of ORFs 2–4 (TGB-encoding genes) showed similar topology structures to the CP-based
2011; Villamor and Eastwell 2013). Genome sequences of ASPV-LYC together with AGCaV (Aurora-1 and CYD) and 16 ASPV isolates available in GenBank were scanned and the possible recombination events in ASPV-LYC genome were detected using seven programs implemented in the software RDP version 3.44 (Martin 2009). One recombination event was detected by all seven methods with P-values ranging from 5.137×10–73 to 4.379×10–16 (Table 3). The
tree (data not shown). Based on the genome structure and
recombination junction located at 1 955–2 782 nt of ORF1
phylogenetic position, ASPV-LYC should be considered as
of ASPV-LYC (Appendix B), with Aurora-1 and KL9 identified
a novel ASPV molecular variant.
as the major and minor parents by sharing 80.5 and 96.4%
Fig. 2 Multiple alignment of the amino acid sequences of coat proteins from Apple stem pitting virus (ASPV) isolate ASPV-LYC and selected ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates Aurora-1 and CYD. Rectangles indicate the commonly deleted amino acid sites in ASPV isolates LYC and FJ-12, and two AGCaV isolates Aurora-1 and CYD. Dots indicate identical amino acid residues among all isolates. Consensus sequence was shown in the bottom lane.
2556
LYC HB-HN1 KL9
1)
R 5.083×10–54 3.764×10–24 7.053×10–62
G 6.535×10–68 5.827×10–31 7.449×10–74
B 5.137×10–73 6.548×10–27 9.174×10–06
Av. P-Val1) M 2.658×10–24 2.015×10–20 3.284×10–24 Break point (nt) Start End 2 782 1 955 40 5 696 1 928 2 764 Parental isolate Major Minor Aurora-1 (80.5%) KL9 (96.4%) XC (79.9%) LYC (87.2%) Unknown LYC (96.2%) Recombinant isolate
Table 3 List of putative recombination events in genomes of Apple stem pitting virus (ASPV) isolates LYC, HB-HN1 and KL9
Av. P-Val, the corresponding average P-values for each event; R, RDP; G, GENECONV; B, Bootscan; M, MaxChi; C, Chimaera; S, Siscan; 3S, 3SEQ.
3S 4.379×10–16 3.759×10–49 1.980×10–03
3.4. Serological reactivity of recombinant CP (rCP) of ASPV-LYC with polyclonal antibodies against three ASPV isolates
C 1.080×10–22 2.158×10–07 4.529×10–20
nt similarities (Table 3), respectively. Additionally, a large recombinant origin at the 5´ terminus (40–5 696 nt) of HB-HN1 genome (Appendix C) and a small recombinant origin at 1 928–2 764 nt of genome of isolate KL9 (Appendix D) were detected, with ASPV-LYC as a parent by sharing 87.2 and 96.2% nt similarities, respectively (Table 3).
S 4.659×10–38 1.068×10–53 6.647×10–36
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
To understand the serological relationship of ASPV-LYC and other ASPV isolates from pear, the recombinant CP (rCP) of ASPV-LYC and ASPV isolates HB-HN6, HB-HN9 and YN-MRS (Ma et al. 2016) were expressed in E. coli BL-21 (DE3) pLysS competent cells under the induction of IPTG. SDS-PAGE analysis for the expressed rCPs of the four ASPV isolates revealed different migration rates among these rCPs (Fig. 3-A). The CPs of ASPV-LYC, HB-HN6, HB-HN9 and YN-MRS consisted of 403, 411, 411, and 375 aa with predicted molecular masses of 42.76, 43.27, 43.27, and 39.63 kDa, respectively. Although the CP molecular masses of isolates HBHN9 and HB-HN6 were predicted to be the same, the rCP of HB-HN6 migrated slower than that of HB-HN9 in the SDS-PAGE gel. Similarly, the rCP of YN-MRS had the lowest predicted CP molecular mass of 39.63 kDa, but migrated slower than that of ASPV-LYC. Similar migration patterns were observed in a previous study (Al Rwahnih et al. 2004). The comparative serological reactivity of rCP of ASPV-LYC together with the rCPs of three ASPV isolates HB-HN6, HB-HN9 and YN-MRS was analyzed with Western blot analyzes by using antibodies against the rCPs of HB-HN6, HB-HN9 and YN-MRS, respectively (Fig. 3-B). Since the same amount of each rCP was loaded in the Western blot tests using three antisera, the results indicated that ASPV-LYC was serologically related to other ASPV isolates, but showed differential serological reactivities with antisera raised against the three ASPV isolates from pear (Fig. 3-B). To understand amino acid sites in the CP of tested ASPV isolates possibly involved in the different serological reactivities, the putative epitopes in the CPs of ASPV-LYC, HB-HN6, HB-HN9 and YN-MRS were analyzed by using the method reported by Kolaskar and Tongaonkar (1990). The predicted epitopes showed some variances among these isolates, especially at the region of 1–200 aa near to the N-terminal part of CP (Appendix E). The predicated epitope regions in C-terminal part of the protein were highly conserved among all analyzed isolates. However, the epitope region around aa 401–407 presented only in the isolates LYC and YN-MRS, and was absent in isolates HB-HN6 and HB-HN9. Moreover, ASPV-LYC had two additional epitope regions at aa 178–185 and 278–284. Computer-assisted analysis further revealed the potential reasons for the antigenic differences among these isolates (Fig. 3-C). Isolates LYC and YNMRS had three similar antigenic index peaks (p1, p2 and p3) at the N-terminal part of their CP. Nevertheless, these peaks were absent in HB-HN6, and two peaks p2 and p3 were absent or weak in HB-HN9. Among these predicted epitope index peak positions, p1 and p3 were presumably exposed on the particle surface as indicated by peaks around the aa sites 1 and 80 in surface probability assay (Fig. 3-C).
3.5. The biological characterization of ASPV-LYC Transmission tests were carried out by using P. betulifolia seedlings as rootstocks, P. veitchii scions as indicators and ASPV-LYC infected bud-chips of one-year-old shoots of a ‘Chili’ tree as inocula. Symptom assessments on the indicator plants of P. veitchii were carried out during the growing season in 2015–2017. Downward leaf roll and chlorotic blotches were observed on the newly developed leaves of P. veitchii plants inoculated with ASPV-LYC in the spring in three successive years (Fig. 4-A). At the third year, bark sunken and stem pitting together with necrosis of the corresponding stem bark developed on these plants (Fig. 4-B). RT-PCR detection with two sets of ASPV-specific primers ASPV247-F/ASPV247-R and 370A/370B and sequencing of PCR products confirmed that ASPV-LYC was successfully transmitted into P. veitchii plants.
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
A kDa M CK LYC HN6 HN9 MRS17 55 40
55 40 55 40
C Antigenic index 20 40 p1
60 80 100 120 140 160 180 200 220 240 260 280 300 20 340 360 380 400 p2 p3
LYC HB-HN6
B kDa 55 40
2557
p1
PAb-HN6
HB-HN9 YN-MRS
PAb-HN9
PAb-MRS17
p1
p3
p2
Surface probability LYC HB-HN6
p1
p1
HB-HN9
p1
YN-MRS
p1
p3
p2
p3
p3
Fig. 3 Analyses of expressed recombinant coat proteins (rCPs) of four Apple stem pitting virus (ASPV) isolates. The induced product (CK) from a culture of Escherichia coli BL-21 (DE3) pLysS containing an empty vector and the rCPs of four ASPV isolates separated by 12% SDS-PAGE and stained with 0.25% Coomassie blue G250 solution were used as a loading control (A). Three antibodies PAb-HN6, PAb-HN9 and PAb-MRS17 raised against ASPV isolates HN6, HN9 and MRS17 were used for Western blot analysis (B), respectively. Lane M means molecular weight marker. Epitope predictions of CPs of four ASPV isolates were done by using DNAStar Software (C). p1–p3 indicate three peaks. A
B
4. Discussion
Fig. 4 The biological indexing of ASPV-LYC on indicator plants of Pyronia veitchii. Downward rolling of newly developed leaves (A) and stem pitting (B) on the 1-year-old trunk of P. veitchii are indicated by black bold arrows.
Meanwhile, RT-PCR tests using primer pairs ASGV-U/ ASGV-2 and ACLSV-52/ACLSV-53 revealed the presence of ASGV, but the absence of ACLSV in these plants. The results indicated that ASPV-LYC could induce the typical symptoms as the infection of some other ASPV isolates on P. veitchii plants (Siebert and Engelbrecht 1981).
P. bretschneideri cv. Chili is a local pear cultivar in China, which is well conserved at the original regions. For the first time, this study reported the infection and genomic sequence of an ASPV isolate named as ASPV-LYC from an old pear plant. The overall genomic structure of ASPV-LYC was the same as the typical ASPV isolate (Jelkmann 1994). Whilst, the ASPV-LYC also showed specific molecular features by having a chimeric genome, which possessed a significant recombination event in its ORF1 with Aurora-1 and KL9 identified as major and minor parents. KL9 was identified from a ‘kurle’ pear specifically grown at southern area of Xinjiang Uygur Autonomous Region in Northwest China (Liu et al. 2012). Aurora-1 was associated with an apple crinkle disease (James et al. 2013), which has not been reported in China. Considering that the geographic distances and different genetic backgrounds among the hosts of the three isolates, the real origins of these isolates remain as a mystery. Meanwhile, it was noteworthy that ASPV-LYC had only 80.5% nt similarity with the major parent Aurora-1 as indicated by recombination analysis using RDP3, suggesting the presence of another possible unknown major parent. The recombinant regions identified in the pear ASPV isolates HB-HN1, KL9 and KL1 with LYC as a potential parent was in accordance with the
2558
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
phylogenetic positions of these isolates. Recombination frequently occurs within members of the Betaflexiviridae (Alabi et al. 2010; Boulila 2010). Previously, recombination events were detected in different ASPV isolates (Yoshikawa et al. 2001; Dhir et al. 2011; Komorowska et al. 2011; Ma et al. 2016), and it might also have happened in Aurora-1 (James et al. 2013). Thus, it is complicated to understand the real parents of these recombined progenies. Moreover, the host pear plant of ASPV-LYC was propagated on the seedlings of P. betulifolia, a rootstock species widely used in China, and never experienced other artificial grafting manipulation. Previously, we did extensive molecular characterization of ASPV isolates infecting pear plants in China (Ma et al. 2016). Comparisons of CP sequences of the isolate LYC and all available isolates revealed that LYC shared a relatively high nucleotide similarity of 84.3% with one isolate FJ-12, suggesting that ASPV isolates with molecular characteristics like ASPV-LYC were rarely found in other cultivated pear plants. Then, it seems not possible that the isolate was transmitted from rootstock plants and the evolutionary origin of plant viruses remains unknown. It has been suggested that viruses and their principal host plants often have common centers of origins (Jones 1981; Spetz et al. 2003). China is an important place of pear origin, revealing the molecular characterization of ASPV isolates infecting old wild and domesticated pear plants may offer insights into understanding possible origin of the virus. The CP gene of ASPV has been proved to be the least conserved, showing high size variation among different isolates (Wu et al. 2010). The CP size differentiation and the positions of amino acid insertions or deletions of ASPV isolates seem to be related to the phylogenetic positions of ASPV isolates (Fig. 1-B). In accordance, ASPV-LYC, Aurora-1, CYD and FJ-12 in the same phylogenetic clade also had the same two deletions of multiple amino acid compared to other isolates (Figs. 1-B and 2). Notably, although ASPV-LYC and Aurora-1 phylogenetically located at the same clade, they formed two separated subclades in the CP-based tree, suggesting that the two isolates might represent two different ASPV strains or variants. According to ICTV criteria for species demarcation in the genus Foveavirus, the serological specificity, size and sequence identity of CP gene are important referred data (Adams et al. 2012). Then, it was suggested that AGCaV might be a distinct species or a novel variant of ASPV (James et al. 2013; Morelli et al. 2017). As for isolates Aurora-1 and CYD, ASPV-LYC also met the criteria for a distinct species based on its low CP identity with the type isolate ASPV PA66. Western blot analysis indicated that ASPV-LYC was serologically related to other ASPV isolates, but showed differential serological reactivities with antisera raised against three ASPV isolates from pear. Computational methods
using amino acid sequences are useful tools for predicting potential epitopes and their aa residues involved in different antigens (El-Manzalawy and Honavar 2010). Our primary analysis showed that the aa variations at the N-terminal part of tested ASPV CPs resulted in the differentiation for their antigenic determinants and antigenic index. Further extensive studies will be necessary for comprehensively understanding the epitope structures of ASPV isolates, which can facilitate serological diagnostic methods for highly variable ASPV isolates. ASPV-LYC did not cause visible symptoms on the original pear plants, but induced visible symptoms on leaves and stems of graft-inoculated P. veitchii plants. The downward leaf roll and stem pitting on P. veitchii plants indicated the ASPV infection (Siebert and Engelbrecht 1981; Nemeth 1986; Stouffer and Fridlund 1989). Although the infection of ASGV also occurred in P. veitchii plants, the single infection of the virus usually did not induce visible symptoms in P. veitchii plants. Thus, ASPV-LYC showed the biotype similar to other ASPV isolates (Nemeth 1986). Nowadays, frequent human activity plays important roles in plant virus dissemination, which provides conditions for viruses adapting new hosts (Jones 2009). The mixed infection and interaction of several viruses in a woody plant could greatly increase severity of diseases as previously reported (Susaimuthu et al. 2008; Quito-Avila et al. 2014). As asymptomatic carriers of ASPVLYC, the ‘Chili’ plants seem to be tolerant or resistant to the virus infection. However, cautious evaluation of the effects of the new ASPV isolate on other pear germplasm, especially in case of mixed infection with other viruses, will be necessary to ascertain potential risks. Until now, the molecular mechanism involved in ASPV evolution and pathogenicity is rarely known. Therefore, it is important to have more comparable biological tests and extensive molecular characterization for the virus from different host sources.
5. Conclusion Our results indicate that ASPV-LYC is a novel strain of ASPV, which has unique original source and molecular characteristics, and is serologically and biologically related to known ASPV isolates. ASPV isolates with LYC like molecular characteristics were rarely found in other cultivated pear plants.
Acknowledgements This study was financially supported by the program for the Key International S&T Cooperation Projects (2017YFE0110900), the National Key Research and Developemnt Program of China (2018YFD0201400), the
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Fundamental Research Funds for the Central Universities, China (2662016PY107), and the earmarked fund for the China Agriculture Research System (CARS-28-15). Appendices associated with this paper can be available on http://www.ChinaAgriSci.com/V2/En/appendix.htm
References Adams M J, Candresse T, Hammond J, Kreuze J F, Martelli G P, Namba S, Pearson M N, Ryu K H, Saldarelli P, Yoshikawa N. 2012. Betaflexiviridae. In: King A M Q, Adams M J, Carstens E B, lefkowitz E J, eds., Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier, San Diego. pp. 920–941. Al Rwahnih M, Turturo C, Minafra A, Saldarelli P, Myrta A, Pallás V, Savino V. 2004. Molecular variability of Apple chlorotic leaf spot virus in different hosts and geographical regions. Journal of Plant Pathology, 86, 117–122. Alabi O J, Martin R R, Naidu R A. 2010. Sequence diversity, population genetics and potential recombination events in grapevine rupestris stem pitting-associated virus in Pacific North-West vineyards. Journal of General Virology, 91, 265–276. Boulila M. 2010. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis. Biochemical Genetics, 48, 357–375. Brakta A, Handa A, Thakur P D, Tomar M, Kumar P. 2015. Malus pumila ‘Spy 227’ and Apple stem pitting virus: Graft incompatibility and epinasty. Virus Disease, 26, 92–96. Brakta A, Thakur P D, Handa A. 2013. First report of apple top working disease caused by viruses (Apple stem grooving virus, Apple chlorotic leaf spot virus, and Apple stem pitting virus) in apple in India. Plant Disease, 97, 1001. Chen J, Chen J, Adams M J. 2002. Characterisation of potyviruses from sugarcane and maize in China. Archives of Virology, 147, 1237–1246. Desvignes J C, Boyé R, Cornaggia D, Grasseau N, Hurtt S, Waterworth H. 1999. Virus Diseases of Fruit Trees. CTIFL, Paris, France. Dhir S, Ram R, Hallan V, Zaidi A A. 2011. Molecular characterization of an Indian variant of Apple stem pitting virus: Evidence of recombination. Journal of Plant Pathology, 93, 471–478. Dhir S, Tomar M, Thakur P D, Ram R, Hallan V, Zaidi A A. 2010. Molecular evidence for Apple stem pitting virus infection in India. Plant Pathology, 59, 393. El-Manzalawy Y, Honavar V. 2010. A framework for developing epitope prediction tools. In: Proceedings of the First ACM International Conference on Bioinformatics and Computational Biology. Niagara Falls, NY, USA. pp. 660–662. German S, Candresse T, Lanneau M, Huet J C, Pernollet
2559
J C, Dunez J. 1990. Nucleotide sequence and genomic organization of apple chlorotic leaf spot closterovirus. Virology, 179, 104–112. James D. 1999. A simple and reliable protocol for the detection of apple stem grooving virus by RT-PCR and in a multiplex PCR assay. Journal of Virological Methods, 83, 1–2. James D, Varga A, Jesperson G D, Navratil M, Safarova D, Constable F, Horner M, Eastwell K, Jelkmann W. 2013. Identification and complete genome analysis of a virus variant or putative new foveavirus associated with apple green crinkle disease. Archives of Virology, 158, 1877–1887. Jelkmann W. 1994. Nucleotide sequences of apple stem pitting virus and of the coat protein gene of a similar virus from pear associated with vein yellows disease and their relationship with potex- and carlaviruses. Journal of General Virology, 75, 1535–1542. Jones R A C. 1981. The ecology of viruses infecting wild and cultivated potatoes in the Andean region of South America. In: Thresh J M, ed., Pests, Pathogens and Vegetation. Pitman, London, UK. pp. 89–107. Jones R A C. 2009. Plant virus emergence and evolution: Origins, new encounter scenarios, factors driving emergence, effects of changing world conditions, and prospects for control. Virus Research, 141, 113–130. Kishi K, Takanashi K, Abiko K. 1976. Pear necrotic spot, a new virus disease in Japan. Acta Horticulturae, 67, 269–274. Kolaskar A S, Tongaonkar P C. 1990. A semi-empirical method for prediction of antigenic determinants on protein antigens. Febs Letters, 276, 172–174. Komorowska B, Siedlecki P, Kaczanowski S, Hasiówjaroszewska B, Malinowski T. 2011. Sequence diversity and potential recombination events in the coat protein gene of Apple stem pitting virus. Virus Research, 158, 263–267. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology & Evolution, 33, 1870–1874. Liu N, Niu J, Zhao Y. 2012. Complete genomic sequence analyses of Apple stem pitting virus isolates from China. Virus Genes, 44, 124–130. Ma X, Hong N, Moffett P, Wang G. 2016. Genetic diversity and evolution of Apple stem pitting virus isolates from pear in China. Canadian Journal of Plant Pathology, 38, 218–230. Martelli G P, Jelkmann W. 1998. Foveavirus, a new plant virus genus. Archives of Virology, 143, 1245–1249. Martelli G P, Kreuze A J F, Dolja V V. 2007. Family Flexiviridae: A case study in virion and genome plasticity. Annual Review of Phytopathology, 45, 73–100. Martin D P. 2009. Recombination detection and analysis using RDP3. Methods in Molecular Biology, 537, 185–205. Mathioudakis M M, Maliogka V I, Dovas C I, Paunovic S, Katis N I. 2009. Reliable RT-PCR detection of Apple stem pitting virus in pome fruits and its association with quince fruit deformation disease. Plant Pathology, 58, 228–236. Mathioudakis M M, Maliogka V I, Dovas C I, Vasilakakis M, Katis N I. 2006. First record of the Apple stem pitting virus (ASPV)
2560
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
in quince in Greece. Journal of Plant Pathology, 88, 225. Menzel W, Jelkmann W, Maiss E. 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods, 99, 81–92. Morelli M, Giampetruzzi A, Laghezza L, Catalano L, Savino V N, Saldarelli P. 2017. Identification and characterization of an isolate of apple green crinkle associated virus involved in a severe disease of quince (Cydonia oblonga, Mill.). Archives of Virology, 162, 299–306. Morelli M, Minafra A, Boscia D, Martelli G P. 2011. Complete nucleotide sequence of a new variant of Ggrapevine rupestris stem pitting-associated virus from southern Italy. Archives of Virology, 156, 543–546. Nemeth M. 1986. Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Kluwer Academic Publishers, Dordrecht, The Netherlands. Paunovic S V, Rankovic M, Radovic S. 1999. Characterization of a virus associated with pear stony pit in cv. Württemberg. Journal of Phytopathology, 147, 695–700. Quito-Avila D F, Lightle D, Martin R R. 2014. Effect of Raspberry bushy dwarf virus, Raspberry leaf mottle virus, and Raspberry latent virus on plant growth and fruit crumbliness in ‘Meeker’ red raspberry. Plant Disease, 98, 176–183. Siebert Z V, Engelbrecht D J. 1981. Field and glasshouse evaluation of Pyronia veitchii as an indicator of some apple latent viruses. Phytophylactica, 13, 199–204. Spetz C, Taboada A M, Darwich S, Ramsell J, Salazar L F, Valkonen J P T. 2003. Molecular resolution of a complex of potyviruses infecting solanaceous crops at the centre of origin in Peru. Journal of General Virology, 84, 2565–2578. Stouffer R F, Fridlund P R. 1989. Indexing using woody indicators. In: Virus and Virus-like Diseases of Pome Fruits and Simulating Noninfectious Disorders. Washington State University, Cooperative Extension College, Pullmann, WA,
USA. pp. 255–265. Susaimuthu J, Tzanetakis I E, Gergerich R C, Kim K S, Martin R R. 2008. Viral interactions lead to decline of blackberry plants. Plant Disease, 92, 1288–1292. Sutic D D, Ford E R, Tosic M T. 1999. Virus diseases of fruit trees. In: Handbook of Plant Virus Diseases. CRC Press LLC, Boca Raton. pp. 321–389. Teng Y. 2011. The pear industry and research in China. Acta Horticulturae, 909, 161–170. Villamor D E, Eastwell K C. 2013. Viruses associated with rusty mottle and twisted leaf diseases of sweet cherry are distinct species. Phytopathology, 103, 1287–1295. Wu Z B, Ku H M, Su C C, Chen I Z, Jan F J. 2010. Molecular and biological characterization of an isolate of Apple stem pitting virus causing pear vein yellows disease in Taiwan. Journal of Plant Pathology, 92, 721–728. Yang F, Wang G, Xu W, Hong N. 2017. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses. Journal of Virological Methods, 247, 61–67. Yao B, Wang G, Ma X, Liu W, Tang H, Zhu H, Hong N. 2014. Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. Journal of Virological Methods, 196, 113–119. Yeon Y J, Ho J J, San C K, Seck D K, Cheol L H, Nam C B. 2014. Genetic diversity of a natural population of Apple stem pitting virus isolated from apple in Korea. Plant Pathology Journal, 30, 195–199. Yoshikawa N, Matsuda H, Oda Y, Isogai M, Takahashi T, Ito T, Yoshida K. 2001. Genome heterogeneity of apple stem pitting virus in apple trees. Acta Horticulturae, 550, 285–290. Zhang Y P, Uyemoto J K, Golino D A, Al Rowhani M. 1998. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology, 88, 1231–1237.
Executive Editor-in-Chief WAN Fang-hao Managing editor ZHANG Juan
ScienceDirect
RESEARCH ARTICLE
Molecular, serological and biological characterization of a novel Apple stem pitting virus strain from a local pear variety grown in China LI Liu1, 2*, ZHENG Meng-meng1, 2*, MA Xiao-fang2, LI Yuan-jun3, LI Qing-yu3, WANG Guo-ping1, 2, HONG Ni1, 2 1
State Key Laboratory of Agromicrobiology, Huazhong Agricultural University, Wuhan 430070, P.R.China Key Laboratory of Crop Disease Monitoring and Safety Control in Hubei Province, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, P.R.China 3 Yantai Academy of Agricultural Science, Yantai 264000, P.R.China 2
Abstract Apple stem pitting virus (ASPV) is an important causal agent of pear diseases. Nowadays, the infection status and molecular characteristics of the virus in old pear trees have never been investigated. In this study, we provide the first complete genome sequence of an ASPV isolate LYC from an over 300-year-old tree of a local Pyrus bretschneideri cultivar ‘Chili’ specifically grown at Laiyang area in China. ASPV-LYC possesses a chimeric genome consisting of 9 273 nucleotides excluding a poly(A) tail at its 3´ end and harboring a recombination region in its open reading frame (ORF1) with Aurora-1 and KL9 identified as the major and minor parents. Western blot analysis with antisera against recombinant coat proteins (CPs) of three ASPV isolates from pear indicates that ASPV-LYC is serologically related to these ASPV isolates, but with differential activities. Further biological tests on indicator plants of Pyronia veitchii show that ASPV-LYC can induce serious leaf and stem symptoms as other ASPV isolates. The results provide an important information for understanding molecular evolution of ASPV and suggest a need to prevent dissemination of the isolate among pear trees. Keywords: pear, apple stem pitting virus, genome, Western blot
1. Introduction
Received 25 September, 2018 Accepted 10 January, 2019 LI Liu, E-mail: [email protected]; ZHENG Meng-meng, E-mail: [email protected]; Correspondence HONG Ni, Tel: +86-27-87281096, Fax: +86-27-87384670, E-mail: whni@mail. hzau.edu.cn * These authors contributed equally to this study. © 2019 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/). doi: 10.1016/S2095-3119(19)62636-5
Apple stem pitting virus (ASPV) is a common virus of apple and pear worldwide (Nemeth 1986; Sutic et al. 1999). Recently, ASPV infection in cherry and sour cherry in India has been reported (Dhir et al. 2010). The virus infection in apple and most pear trees is usually asymptomatic. However, the virus infection can induce leaf vein yellowing (Jelkmann 1994) and red mottling (Desvignes et al. 1999) or necrotic spot (Kishi et al. 1976) and fruit stony pits on susceptible pear trees (Paunovic et al. 1999). The virus is also associated with quince (Cydonia oblonga) fruit deformation disease (Mathioudakis et al. 2006, 2009). Additionally, ASPV induces xylem pits in the stem of Malus
2550
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
pumila ‘Virginia crab’, as well as epinasty and decline of M. domestica ‘Spy227’ (Jelkmann 1994; Brakta et al. 2015). ASPV infection in apple and pear trees occurs frequently in combination with other viruses, including Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), and Apple mosaic virus (ApMV). Mixed infection of ACLSV, ASGV and ASPV causes significant decreases in the quality and quantity of fruits and even induces tree top working disease (Nemeth 1986; Brakta et al. 2013). There is no insect vector reported for ASPV (Martelli and Jelkmann 1998). ASPV is the type species of the genus Foveavirus, family Betaflexiviridae in the order Tymovirales (Adams et al. 2012). The positive-sense single-stranded RNA (+ssRNA) genome of ASPV is approximately 9 300 nucleotides (nts) in length, consists of 5 open reading frames (ORF1–5), 5´ and 3´ untranslated regions (UTRs), as well as the two short intergenic non-coding regions (IG-NCRs) located between ORF1 and ORF2 and between ORF4 and ORF5. ORF1 encodes a viral replicase polyprotein, ORF2–4 encode triple gene block proteins (TGBps) and ORF5 encodes the viral coat protein (CP) (Jelkmann 1994). Previous studies have revealed the remarkable genetic variability among the ASPV isolates (Wu et al. 2010; Liu et al. 2012; Yeon et al. 2014). Until now, complete genome sequences have been available for 17 ASPV isolates, including 12 isolates (PB66, IF38, PA66, Palampur, YL, YT, PM8, Hannover, GA4, GA2, AKS and XC) from apple grown in different countries and five isolates (PR1, HB-HN1, KL9, KL1 and YLX) from pear grown in China (Liu et al. 2012; Ma et al. 2016). Additionally, a virus identified as apple green crinkle associated virus (AGCaV) was molecularly characterized from Aurora Golden Gala apple showing severe symptoms of green crinkle disease, which was considered as a new virus or a novel strain of ASPV (James et al. 2013). More recently, an isolate AGCaV-CYD involved in a severe disease of quince (Cydonia oblonga) was identified and characterized in Italy (Morelli et al. 2017). The two AGCaV isolates have the same genomic structure as that of ASPV isolates, but are molecularly and biologically divergent from the type strain PA66 of ASPV and other ASPV isolates. As one of the most important temperate fruit trees, with the third largest growing area worldwide, pear has a long cultivation history. China is the largest commercial pear fruit producer in the world, and also an important origin center of pears with a long history of pear cultivation (Teng 2011). There are abundant local pear varieties with broad genetic diversities and ecotypes suitable for growing under different ecological conditions in China, but the knowledge on molecular characteristics of ASPV-infecting pear trees is very limited. The pear ‘Chili’ is an old local variety of Pyrus bretschneideri, originated at Laiyang, Chiping and
Muping regions of Shandong Province (Teng 2011). Until now, there are still many old ‘Chili’ trees specially grown at these places. To understand the virus infection statues in old ‘Chili’ trees and virus molecular characteristics, we carried out a molecular detection for three well-known viruses ASGV, ASPV and ACLSV in old ‘Chili’ trees and identified an ASPV (ASPV-LYC) with novel molecular characteristics. This study provided the first complete genome sequence of an ASPV isolate from an over 300-year-old pear tree. The serological relationship of ASPV-LYC with other three ASPV isolates was comparatively evaluated. The obtained results provide important information for understanding the molecular evolution of the virus.
2. Materials and methods 2.1. Sample sources In 2013, young leaves were randomly collected from five trees of pear (P. bretschneideri cv. Chili) grown at Laiyang area, Shandong Province, China. The trees were over 300 years old, without experiencing top-working manipulation, and did not show visible viral disease-like symptom. The leaves from the same pear tree were bulked as one sample and the presence of viruses in each sample was tested by RT-PCR.
2.2. RT-PCR detection Total RNA was extracted from leaves using silica spin column (SSC)-based protocol I (SSC-PI) (Yang et al. 2017). Reverse transcription was performed using Maloney murine leukemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI, USA) and a random primer hexadeoxyribonucleotide mixture pd(N)6 (TaKaRa, Dalian, China) at 37°C for 1.5 h. PCR reaction solution in a final volume of 25 µL contained 2.5 µL of 10× PCR buffer, 2.5 µmol L–1 dNTPs, 0.5 µmol L–1 of each primer, 0.25 U of Taq DNA polymerase (TaKaRa, Dalian, China), and 2 µL of cDNA. PCR reactions were carried out in a Mastercycler (Eppendorf, Hamburg, Germany) using the following conditions: an initial denaturation step at 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 54°C for 30 s, 72°C for 1 min, and a final extension for 10 min at 72°C. The PCR products were separated by electrophoresis on 1.2% agarose gels, stained with ethidium bromide, and visualized under UV light. The primer sets ASPV247-F/ASPV247-R (5´-CAGTAT TGTGCCTTYTAYGCRAAGC-3´/5´-CCATAGAACGGAT GCGGTACATYTG-3´) (Yao et al. 2014) and 370A/370B (5´-ATGTCTGGAACCTCATGCTGCAA-3´/5´-TTGGGAT CAACTTTACTAAAAAGCATAA-3´) (Menzel et al. 2002)
2551
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
targeting to the CP gene of ASPV were utilized for the RTPCR detection of ASPV. Meanwhile, primer pairs ASGV-U/ ASGV-2 (5´-CCCGCTGTTGGATTTGATACACCTC-3´/ 5 ´ - G G A AT T T C A C A C G A C T C C TA A C C C T C C - 3 ´ ) specific for ASGV (James 1999) and ACLSV-52/ ACLSV-53 (5´-CAGACCCTTATTGAAGTCGAA-3´/5´GGCAACCCTGGAACAGA-3´) specific for ACLSV (German et al. 1990) were also included in the assays.
2.3. Determination of complete genome sequence of ASPV Initially, a primer set F7/R7 (5´-CCTTATTACCACCC ATTAGGT-3´/5´-GGGATCAACTTTACTAAAAGCAT-3´) designed basing on multiple alignments of ASPV sequences available in GenBank was used to amplify a 1 317-bp fragment (f7) containing the ASPV CP gene. Then, primer sets used to amplify other 6 fragments (f1–f6) were designed basing on the obtained CP gene sequence and sequences conserved in the genomes of all ASPV isolates available in GenBank (Table 1). To overcame inconvenient associated with intra-isolate sequence diversity and avoid mistakes during sequence assembling, adjacent amplicons were overlapped for more than 150 bp. To obtain the 5´ terminal sequence, primers 5´ RACE Out R1 and 5´ RACE Out R2 were designed based on the obtained sequence of fragment f1 and a random primer
mixture pd(N)6 was used for cDNA synthesis. The 5´ RACE reactions were attempted using an Invitrogen GeneRacer Kit (Invitrogen, USA) according to the manufacturer’s instructions. To obtain the 3´ terminal sequence, primers 3-Out-F1 and 3-Out-F2 were designed based on the obtained sequence of fragment f7. A common primer M4-T (Chen et al. 2002) was used for reverse transcription, primer set 3-Out-F1/M4 was used for the first round of amplification and primer set 3-Out-F2/M4 was used for the second round of amplification in semi-nested PCR reactions. Composition of the PCR reaction mixtures and the associated PCR conditions were similar to those mentioned above. In PCR solutions, LA Taq polymerase (TaKaRa, Dalian, China) was used to facilitate PCR reactions, and 40 µmol L–1 of each dNTP was used in a 25-µL reaction volume. For PCR reactions, the annealing step was performed for 45 s at 54–56°C (depending on the primer set used in each reaction), and the extension step was performed for 3–4 min (depending on the sizes of the PCR products) at 72°C. PCR products were gel-purified, inserted into the vector pMD18-T (TaKaRa, Dalian, China) and transformed into Escherichia coli DH5α following the manufacturer’s instructions. To obtain a view of molecular composition intra the isolate, at least three positive clones of each product were sequenced at a commercial sequencing service (Shanghai Sangon Biological Engineering & Technology and Service Co., Ltd., Shanghai, China). The
Table 1 Primers designed for RT-PCR amplification of Apple stem pitting virus isolate ASPV-LYC genome Fragment f1 f2 f3 f4 f5 f6 f7 3´ UTR
5´ UTR
1)
Primer1) F1 R1 F2 R2 F3 R3 F4 R4 F5 R5 F6 R6 F7 R7 3-Out-F1 3-Out-F2 M4 M4-T 5´ RACE Out F1 5´ RACE Out R1 5´ RACE In F2 5´ RACE In R2
Primer sequence (5´→3´)2) GCAGAGGAAGTAATCGCATC CGGTGAAGTTAACAACATCCC ACTCTTAAGAAGCCAGACCT TGTTGCATAGGCACATGTCA TCCTTATGCCHTTTGGATT ATTTGCTAGTTTTCTTTCCACCAG TAGAGTTTCAAAYAGYGCVA TTTTGCACTTCTAAATCTGT ATTGGAGACATTACTACCGA AGAAACAGTCTGATTCCC CTTGTAATTTTAATAATGGAAACTGTGC AGCAACTGGCGAGCTGGTG CCTTATTACCACCCATTAGGT GGGATCAACTTTACTAAAAGCAT CCTTATTACCACCCATTAGGT AGAACCTGCTGATGGGCTTG GTTTTCCCAGTCACGAC GTTTTCCCAGTCACGAC(T)15 CATGGCTACATGCTGACAGCCTA GCGTTGTGATTCTTCCAGTCCT CGCGGATCCACAGCCTACTGATGATCAGTCGATG TCAAAGCCAGTCCTTCTATCACA
F, forward primer; R, reverse primer. H is A or C or T; R is A or G; V is A or C or G; W is A or T and Y is C or T. 3) The locations refer to nucleotide positions corresponding to the genome sequence of ASPV-LYC. 2)
Location (nt)3) 84–1 479
Product size (bp) 1 396
1 068–2 910
1 843
2 530–4 338
1 809
3 971–5 774
1 804
5 334–7 064
1 731
6 669–8 052
1 384
7 886–9 202
1 317
7 817 8 961
1 489 345
879 830 568 507
2552
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
obtained sequences were assembled into a contiguous sequence at a standard of over 99.9% similarities at each of the overlapped regions.
2.4. Sequence analyses Sequences were aligned using Clustal W 2.0 with default settings, and imported into the MEGA 7.0.14 Program. Multiple nucleotide sequence alignments were performed using the MUSCLE algorithm implemented in the MEGA 7.0.14 Program (Kumar et al. 2016). Phylogenetic trees were inferred by using the Maximum Likelihood method packaged in the MEGA 7.0.14 Program with 1 000 bootstrap replicates. The sources and GenBank accession numbers of the genomic sequences of ASPV isolates and two AGCaV isolates referred from the GenBank database (www. ncbi.nlm.nih.gov) were listed in Appendix A. The putative epitopes of ASPV coat protein were analyzed with a Kolaskar and Tongaonkar method (1990). Surface plot and antigenic index analysis packaged in the DNAStar Software (DNAStar, Madison, WI, USA).
2.5. Expression of ASPV CP genes in E. coli and Western blot assay The CP gene of isolate ASPV-LYC was inserted into prokaryotic expression vector pET-28a(+) (Novagen, Madison, WI, USA) for recombinant protein production. Meanwhile, three recombinant prokaryotic expression plasmids containing CP genes of isolates HB-HN6, HB-HN9 and YN-MRS17 (Ma et al. 2016) and the antisera raised against their recombinant coat protein (rCP) (unpublished data) were included in the serological analysis in this study. The recombinant plasmids were denoted as pET-LYC, pET-HN6, pET-HN9, and pET-MRS17 and transformed into E. coli BL-21 (DE3) pLysS competent cells. Protein production was done by adding 0.5 mmol L–1 isopropyl-βD-thiogalactoside (IPTG) into 2-h pre-incubated bacterial culture and inducing at 28°C for 6 h in Luria-Bertani (LB) medium containing 50 mg L–1 kanamycin. The expressed protein was evaluated by 12% SDS-PAGE. Gels were stained with 0.25% Coomassie blue G250 solution. For Western blot, total proteins from induced cells were separated on 12% SDS-PAGE and electro-transferred onto PVDF membranes. Membranes blocked with 5% (w/v) skim milk in PBST (0.01 mol L–1 PBS, 0.05% Tween-20, pH 7.4) were individually incubated with antibodies of HN6, HN9 and MRS17. Alkaline phosphatase-conjugated goat antirabbit IgG diluted at 1:5 000 (Sigma, Germany) was used as the secondary antibody. Antigen-antibody reactions were visualized by incubation in the substrate solution containing 0.35 mg mL–1 nitroblue tetrazolium (NBT) and
0.18 mg mL–1 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (Amresco, USA).
2.6. Biological characterization One-year-old P. betulifolia seedlings were used as root stocks. Each plant was double-grafted (Siebert and Engelbrecht 1981) with a bud from a one-year-old shoot of Pyronia veitchii as an indicator and a bud-chip of ‘Chili’ infected by ASPV-LYC as an inoculum. The inoculation test was triplicated. Three plants mock-inoculated using healthy pear buds as inocula and buds of P. veitchii as indicators were used as negative controls. Symptoms were visualized following sprouting of new leaves during the growing season for three successive years.
3. Results 3.1. Characterization of the genome of ASPV-LYC The primary RT-PCR detection using two sets of ASPVspecific primers ASPV247-F/ASPV247-R and 370A/370B showed that four out of the five ‘Chili’ samples were positive for ASPV. Sequencing for amplified products of ASPV CP gene showed that the ASPV isolates from ‘Chili’ were highly divergent by having low nucleotide sequence similarities (less than 70%) for their partial CP gene with that of other known ASPV isolates, indicating the ASPV isolate from ‘Chili’ might be a novel molecular ASPV variant. Here, it was named as ASPV-LYC based on its geographic and host origins. Thereby, one sample was used for amplifying the complete genome of the ASPV-LYC. The genome of ASPV-LYC (accession no. MG763895.1) was 9 273 nucleotides (nts) long, excluding the poly(A) tail at 3´ end (Table 2). The genomic organization was similar to previously reported ASPV isolates (Jelkmann 1994; Adams et al. 2012). ORF1 (60 to 6 614 nt) encoded a 247-kDa polymerase. The ORF1 contained all domains conserved in RNA polymerases of members in the family Betaflexiviridae (Jelkmann 1994; Zhang et al. 1998; Martelli et al. 2007; Morelli et al. 2011; James et al. 2013). These domains included a methyltransferase at aa 43 to 356, an AlkB-like domain (aa 764 to 854) related to the 2-oxoglutarate- and Fe(II)dependent oxygenase superfamily, a cysteine protease (aa 1 098 to 1 194) homologous to the ovarian tumour (OTU) gene of Drosophila spp., a peptidase (aa 1 200 to 1 287) belonging to the C23 Merops family, a helicase (aa 1 378 to 1 636) and an RNA-dependent RNA-polymerase (RdRp, aa 1 764 to 2 170). Near the C-terminus of the RdRp (aa 2 021 to 2 056), there was the core motif TG(x)3T(x)3NT(x)22GDD conserved in the members of genus Foveavirus (Martelli et al. 2007). ORF2 (672 nts, 6 684 to
2553
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Table 2 Sequence comparison of complete genome and different genomic regions between Apple stem pitting virus isolate ASPV-LYC and 16 ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates (Aurora-1 and CYD) referred from NCBI database Host Pear Apple Quince Apple
Pear
Genome nt % LYC 9 237 – Aurora-1 9 266 79.8 CYD 9 266 76.9 PB66 9 363 77.0 IF38 9 293 73.9 PA66 9 332 76.0 Palampur 9 267 75.5 YL 9 262 75.7 YT 9 270 75.8 PM8 9 284 74.3 Hannover 9 324 73.1 GA2 9 358 78.9 GA4 9 276 77.5 AKS 9 296 76.4 XC 9 286 74.2 KL9 9 265 77.6 KL1 9 265 77.2 HB-HN1 9 270 81.8 YLX 9 291 75.7 Isolate
5´ UTR ORF1 (Rep) ORF2 (TGB1) ORF3 (TGB2) ORF4 (TGB3) nt % nt% aa% nt% aa% nt% aa% nt% aa% 59 – – – – – – – – – 60 100 79.3 92.4 83.8 96.0 84.0 95.0 89.7 87.1 60 95 76.1 80.4 86.0 95.1 81.0 85.8 80.3 74.7 60 98.3 79.9 92.7 77.1 91.0 79.3 89.2 85.1 89.3 60 98.3 76.1 85.1 75.6 89.2 78.5 86.7 85.1 86.7 59 98.3 78.5 91.1 77.4 89.7 81.0 90.0 83.6 85.7 29 82.8 78.4 89.9 75.6 89.2 79.3 88.3 85.1 86.7 33 97.0 77.9 91.6 76.2 90.1 80.2 90.8 86.4 78.7 59 100 78.0 91.2 76.9 89.7 78.8 88.3 84.5 87.1 60 96.6 76.8 86.0 78.4 91.0 79.3 89.2 84.2 82.7 60 94.9 74.3 86.2 79.0 91.9 75.2 85.8 83.6 81.4 60 96.6 80.7 92.8 82.7 96.4 80.2 82.7 86.0 82.7 59 100 79.4 92.6 79.3 91.5 79.3 84.3 84.0 84.3 59 100 78.8 92.1 77.8 91.9 82.6 84.0 83.8 84.0 60 98.3 75.5 88.6 76.8 89.7 79.6 85.0 82.0 82.7 33 100 80.1 92.0 77.8 91.5 77.7 82.5 84.0 81.4 33 100 79.7 91.9 77.4 91.0 79.6 86.7 83.6 84.3 60 98.3 86.0 94.8 76.2 91.0 78.5 87.5 86.0 85.3 27 96.3 77.8 91.0 76.5 90.6 81.0 91.7 85.1 82.7
7 355 nt), ORF3 (363 nts, 7 357 to 7 719 nt) and ORF4 (228 nts, 7 628 to 7 855 nt) consisted of a triple gene block (TGB) and encoded proteins (TGBps 1–3) with molecular masses of 25, 12 and 7 kDa, respectively. ORF5 (1 212 nts, 7 927 to 9 138 nt), encoded a CP with a molecular mass of 42 kDa. Although the CP sizes among ASPV isolates were highly variable, the CP gene of ASPV-LYC had the same size with that of AGCaV isolates Aurora-1 and CYD.
3.2. Sequence comparison between ASPV-LYC and available ASPV and AGCaV isolates The genome sequence of ASPV-LYC was 77% identical to that of ASPV PA66 (size 9 332 nts, accession no. D21829.2), the well-characterized ASPV isolate identified as the type member of the genus (Jelkmann 1994), and shared the highest nucleotide identity of 81.8% with an isolate HBHN1 from pear and the lowest nucleotide identity of 73.1% with isolate Hannover available in GenBank database (Table 2). Its 5´-UTR was highly conserved and its 3´-UTR was divergent by sharing 82.8–100% and 67.9–83.3% nt identities with the corresponding regions of other isolates, respectively (Table 2). Similarly, its ORF1 also showed the highest nucleotide and amino acid sequence identities of 86.0 and 94.8% with HB-HN1 (Table 2). However, its ORF2–5 always showed the highest nucleotide and amino acid identities with that of AGCaV isolates Aurora-1 or CYD (Table 2). Notably, its ORF5 even showed the lowest nucleotide (66.4%) and amino acid sequence (69.3%)
ORF5 (CP) nt% aa% – – 77.4 79.2 74.5 74.2 68.3 73.4 67.2 72.4 67.1 71.4 68.2 72.9 68.3 73.9 68.1 73.1 67.8 72.1 66.9 72.1 69.0 73.1 71.2 72.6 67.2 69.3 67.2 71.4 66.9 71.7 67.3 71.9 66.4 69.3 66.6 68.9
3´ UTR nt % 135 – 131 76.0 132 68.2 135 76.7 132 83.3 132 73.8 135 67.9 132 72.7 122 72.7 131 78.5 132 75.6 134 78.0 134 74.2 128 75.8 132 78.8 130 72.3 130 76.2 129 73.5 133 76.5
identities with that of HB-HN1. Meanwhile, to understand whether the molecular variants of ASPV similar to isolate LYC presented in any other pear trees grown in China, the complete CP genes of ASPV isolates were amplified using primer set F7/R7 from leaf samples of 17 pear trees grown at Hubei, Fujian, Yunnan and Shandong provinces, China. Sequence comparison of CP genes of these isolates together with isolate LYC, 32 ASPV isolates reported previously from our group (Ma et al. 2016) and all ASPV isolates available in GenBank showed that only one isolate from a pear plant grown in Fujian Province, named as FJ-12 (accession no. MG763896.1), had relatively high similarity with the isolate LYC by sharing 84.3% nt and 87.8% aa sequence identities. The result suggested that ASPV isolates with molecular characteristics like ASPV-LYC were rarely found in other cultivated pear plants. Phylogenetic trees were generated from the nucleotide sequences of full genome and ORFs 1–5 of ASPV-LYC and ASPV isolates referred from GenBank (Appendix A). In the full genome-based (Fig. 1-A) and ORF1-based trees (data not shown), ASPV-LYC showed the closest phylogenetic relationship with a pear isolate HB-HN1 (accession no. KU308398.1). The two isolates clustered into the same clade together with isolates KL1 (accession no. JF946775.1) and KL9 (accession no. JF946772.1) from ‘kurle’ pear (P. sinkiangensis), but clearly in two separate sub-clades. In the tree based on the CP gene (ORF5) sequences of ASPV isolates used to generate the full genome-based phylogenetic tree and representative isolates (Fig. 1-B),
2554
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Fig. 1 Phylogenetic analysis of Apple stem pitting virus (ASPV) isolates based on the nucleotide sequences of their genome (A) and coat protein gene (B). All available genome sequences of ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates (Aurora-1 and CYD) are included in the genome-based analysis, and CP sequences of selected ASPV isolates are included in the CP analysis. Sequences previously reported from our group and referred from GenBank are identified by their GenBank accession numbers and hosts following isolate names. Isolates with available full genome sequences are in bold. The isolate LYC sequenced in the present study is indicated by “◆”. Cherry green ring mottle virus (CGRMV) in the genus Foveavirus was as an out group in each tree. The tree was constructed with MEGA 7.0.14 Program using the Maximum Likelihood method (Kumar et al. 2016). The numbers at the nodes indicate the percentage of 1 000 bootstraps occurred in this clade. Values below 60% were suppressed. The bar represents 0.1 substitution per site.
ASPV-LYC tightly clustered together with the isolate FJ-12, and the two isolates together with isolates Aurora-1 and CYD formed a clade, which had relatively close phylogenetic
distance with the clade represented by isolates KL1 and KL9, but was distal to HB-HN1. Multiple alignment for CP sequences of ASPV-LYC, FJ-12, other ASPV isolates and
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
two AGCaV isolates obtained from GenBank revealed that
2555
3.3. Recombination detection
the N-terminal part (about 190 aa) of CP was highly variable (Fig. 2) and the reminded region near the C-terminal part
Recombination events occurred frequently in genomes
of CP was relatively conserved (data not shown). Whilst,
of ASPV and other foveaviruses (Boulila 2010; Dhir et al.
it was noticed that as compared with most ASPV isolates, ASPV-LYC, two AGCaV isolates Aurora-1 and CYD, and the isolate FJ-12, shared two common deletions at aa 49–51 and 117–121 (Fig. 2). Additionally, isolates KL9 and YN-MRS had one and two large deletions, respectively (Fig. 2). The trees based on the sequences of ORFs 2–4 (TGB-encoding genes) showed similar topology structures to the CP-based
2011; Villamor and Eastwell 2013). Genome sequences of ASPV-LYC together with AGCaV (Aurora-1 and CYD) and 16 ASPV isolates available in GenBank were scanned and the possible recombination events in ASPV-LYC genome were detected using seven programs implemented in the software RDP version 3.44 (Martin 2009). One recombination event was detected by all seven methods with P-values ranging from 5.137×10–73 to 4.379×10–16 (Table 3). The
tree (data not shown). Based on the genome structure and
recombination junction located at 1 955–2 782 nt of ORF1
phylogenetic position, ASPV-LYC should be considered as
of ASPV-LYC (Appendix B), with Aurora-1 and KL9 identified
a novel ASPV molecular variant.
as the major and minor parents by sharing 80.5 and 96.4%
Fig. 2 Multiple alignment of the amino acid sequences of coat proteins from Apple stem pitting virus (ASPV) isolate ASPV-LYC and selected ASPV isolates and two apple green crinkle associated virus (AGCaV) isolates Aurora-1 and CYD. Rectangles indicate the commonly deleted amino acid sites in ASPV isolates LYC and FJ-12, and two AGCaV isolates Aurora-1 and CYD. Dots indicate identical amino acid residues among all isolates. Consensus sequence was shown in the bottom lane.
2556
LYC HB-HN1 KL9
1)
R 5.083×10–54 3.764×10–24 7.053×10–62
G 6.535×10–68 5.827×10–31 7.449×10–74
B 5.137×10–73 6.548×10–27 9.174×10–06
Av. P-Val1) M 2.658×10–24 2.015×10–20 3.284×10–24 Break point (nt) Start End 2 782 1 955 40 5 696 1 928 2 764 Parental isolate Major Minor Aurora-1 (80.5%) KL9 (96.4%) XC (79.9%) LYC (87.2%) Unknown LYC (96.2%) Recombinant isolate
Table 3 List of putative recombination events in genomes of Apple stem pitting virus (ASPV) isolates LYC, HB-HN1 and KL9
Av. P-Val, the corresponding average P-values for each event; R, RDP; G, GENECONV; B, Bootscan; M, MaxChi; C, Chimaera; S, Siscan; 3S, 3SEQ.
3S 4.379×10–16 3.759×10–49 1.980×10–03
3.4. Serological reactivity of recombinant CP (rCP) of ASPV-LYC with polyclonal antibodies against three ASPV isolates
C 1.080×10–22 2.158×10–07 4.529×10–20
nt similarities (Table 3), respectively. Additionally, a large recombinant origin at the 5´ terminus (40–5 696 nt) of HB-HN1 genome (Appendix C) and a small recombinant origin at 1 928–2 764 nt of genome of isolate KL9 (Appendix D) were detected, with ASPV-LYC as a parent by sharing 87.2 and 96.2% nt similarities, respectively (Table 3).
S 4.659×10–38 1.068×10–53 6.647×10–36
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
To understand the serological relationship of ASPV-LYC and other ASPV isolates from pear, the recombinant CP (rCP) of ASPV-LYC and ASPV isolates HB-HN6, HB-HN9 and YN-MRS (Ma et al. 2016) were expressed in E. coli BL-21 (DE3) pLysS competent cells under the induction of IPTG. SDS-PAGE analysis for the expressed rCPs of the four ASPV isolates revealed different migration rates among these rCPs (Fig. 3-A). The CPs of ASPV-LYC, HB-HN6, HB-HN9 and YN-MRS consisted of 403, 411, 411, and 375 aa with predicted molecular masses of 42.76, 43.27, 43.27, and 39.63 kDa, respectively. Although the CP molecular masses of isolates HBHN9 and HB-HN6 were predicted to be the same, the rCP of HB-HN6 migrated slower than that of HB-HN9 in the SDS-PAGE gel. Similarly, the rCP of YN-MRS had the lowest predicted CP molecular mass of 39.63 kDa, but migrated slower than that of ASPV-LYC. Similar migration patterns were observed in a previous study (Al Rwahnih et al. 2004). The comparative serological reactivity of rCP of ASPV-LYC together with the rCPs of three ASPV isolates HB-HN6, HB-HN9 and YN-MRS was analyzed with Western blot analyzes by using antibodies against the rCPs of HB-HN6, HB-HN9 and YN-MRS, respectively (Fig. 3-B). Since the same amount of each rCP was loaded in the Western blot tests using three antisera, the results indicated that ASPV-LYC was serologically related to other ASPV isolates, but showed differential serological reactivities with antisera raised against the three ASPV isolates from pear (Fig. 3-B). To understand amino acid sites in the CP of tested ASPV isolates possibly involved in the different serological reactivities, the putative epitopes in the CPs of ASPV-LYC, HB-HN6, HB-HN9 and YN-MRS were analyzed by using the method reported by Kolaskar and Tongaonkar (1990). The predicted epitopes showed some variances among these isolates, especially at the region of 1–200 aa near to the N-terminal part of CP (Appendix E). The predicated epitope regions in C-terminal part of the protein were highly conserved among all analyzed isolates. However, the epitope region around aa 401–407 presented only in the isolates LYC and YN-MRS, and was absent in isolates HB-HN6 and HB-HN9. Moreover, ASPV-LYC had two additional epitope regions at aa 178–185 and 278–284. Computer-assisted analysis further revealed the potential reasons for the antigenic differences among these isolates (Fig. 3-C). Isolates LYC and YNMRS had three similar antigenic index peaks (p1, p2 and p3) at the N-terminal part of their CP. Nevertheless, these peaks were absent in HB-HN6, and two peaks p2 and p3 were absent or weak in HB-HN9. Among these predicted epitope index peak positions, p1 and p3 were presumably exposed on the particle surface as indicated by peaks around the aa sites 1 and 80 in surface probability assay (Fig. 3-C).
3.5. The biological characterization of ASPV-LYC Transmission tests were carried out by using P. betulifolia seedlings as rootstocks, P. veitchii scions as indicators and ASPV-LYC infected bud-chips of one-year-old shoots of a ‘Chili’ tree as inocula. Symptom assessments on the indicator plants of P. veitchii were carried out during the growing season in 2015–2017. Downward leaf roll and chlorotic blotches were observed on the newly developed leaves of P. veitchii plants inoculated with ASPV-LYC in the spring in three successive years (Fig. 4-A). At the third year, bark sunken and stem pitting together with necrosis of the corresponding stem bark developed on these plants (Fig. 4-B). RT-PCR detection with two sets of ASPV-specific primers ASPV247-F/ASPV247-R and 370A/370B and sequencing of PCR products confirmed that ASPV-LYC was successfully transmitted into P. veitchii plants.
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
A kDa M CK LYC HN6 HN9 MRS17 55 40
55 40 55 40
C Antigenic index 20 40 p1
60 80 100 120 140 160 180 200 220 240 260 280 300 20 340 360 380 400 p2 p3
LYC HB-HN6
B kDa 55 40
2557
p1
PAb-HN6
HB-HN9 YN-MRS
PAb-HN9
PAb-MRS17
p1
p3
p2
Surface probability LYC HB-HN6
p1
p1
HB-HN9
p1
YN-MRS
p1
p3
p2
p3
p3
Fig. 3 Analyses of expressed recombinant coat proteins (rCPs) of four Apple stem pitting virus (ASPV) isolates. The induced product (CK) from a culture of Escherichia coli BL-21 (DE3) pLysS containing an empty vector and the rCPs of four ASPV isolates separated by 12% SDS-PAGE and stained with 0.25% Coomassie blue G250 solution were used as a loading control (A). Three antibodies PAb-HN6, PAb-HN9 and PAb-MRS17 raised against ASPV isolates HN6, HN9 and MRS17 were used for Western blot analysis (B), respectively. Lane M means molecular weight marker. Epitope predictions of CPs of four ASPV isolates were done by using DNAStar Software (C). p1–p3 indicate three peaks. A
B
4. Discussion
Fig. 4 The biological indexing of ASPV-LYC on indicator plants of Pyronia veitchii. Downward rolling of newly developed leaves (A) and stem pitting (B) on the 1-year-old trunk of P. veitchii are indicated by black bold arrows.
Meanwhile, RT-PCR tests using primer pairs ASGV-U/ ASGV-2 and ACLSV-52/ACLSV-53 revealed the presence of ASGV, but the absence of ACLSV in these plants. The results indicated that ASPV-LYC could induce the typical symptoms as the infection of some other ASPV isolates on P. veitchii plants (Siebert and Engelbrecht 1981).
P. bretschneideri cv. Chili is a local pear cultivar in China, which is well conserved at the original regions. For the first time, this study reported the infection and genomic sequence of an ASPV isolate named as ASPV-LYC from an old pear plant. The overall genomic structure of ASPV-LYC was the same as the typical ASPV isolate (Jelkmann 1994). Whilst, the ASPV-LYC also showed specific molecular features by having a chimeric genome, which possessed a significant recombination event in its ORF1 with Aurora-1 and KL9 identified as major and minor parents. KL9 was identified from a ‘kurle’ pear specifically grown at southern area of Xinjiang Uygur Autonomous Region in Northwest China (Liu et al. 2012). Aurora-1 was associated with an apple crinkle disease (James et al. 2013), which has not been reported in China. Considering that the geographic distances and different genetic backgrounds among the hosts of the three isolates, the real origins of these isolates remain as a mystery. Meanwhile, it was noteworthy that ASPV-LYC had only 80.5% nt similarity with the major parent Aurora-1 as indicated by recombination analysis using RDP3, suggesting the presence of another possible unknown major parent. The recombinant regions identified in the pear ASPV isolates HB-HN1, KL9 and KL1 with LYC as a potential parent was in accordance with the
2558
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
phylogenetic positions of these isolates. Recombination frequently occurs within members of the Betaflexiviridae (Alabi et al. 2010; Boulila 2010). Previously, recombination events were detected in different ASPV isolates (Yoshikawa et al. 2001; Dhir et al. 2011; Komorowska et al. 2011; Ma et al. 2016), and it might also have happened in Aurora-1 (James et al. 2013). Thus, it is complicated to understand the real parents of these recombined progenies. Moreover, the host pear plant of ASPV-LYC was propagated on the seedlings of P. betulifolia, a rootstock species widely used in China, and never experienced other artificial grafting manipulation. Previously, we did extensive molecular characterization of ASPV isolates infecting pear plants in China (Ma et al. 2016). Comparisons of CP sequences of the isolate LYC and all available isolates revealed that LYC shared a relatively high nucleotide similarity of 84.3% with one isolate FJ-12, suggesting that ASPV isolates with molecular characteristics like ASPV-LYC were rarely found in other cultivated pear plants. Then, it seems not possible that the isolate was transmitted from rootstock plants and the evolutionary origin of plant viruses remains unknown. It has been suggested that viruses and their principal host plants often have common centers of origins (Jones 1981; Spetz et al. 2003). China is an important place of pear origin, revealing the molecular characterization of ASPV isolates infecting old wild and domesticated pear plants may offer insights into understanding possible origin of the virus. The CP gene of ASPV has been proved to be the least conserved, showing high size variation among different isolates (Wu et al. 2010). The CP size differentiation and the positions of amino acid insertions or deletions of ASPV isolates seem to be related to the phylogenetic positions of ASPV isolates (Fig. 1-B). In accordance, ASPV-LYC, Aurora-1, CYD and FJ-12 in the same phylogenetic clade also had the same two deletions of multiple amino acid compared to other isolates (Figs. 1-B and 2). Notably, although ASPV-LYC and Aurora-1 phylogenetically located at the same clade, they formed two separated subclades in the CP-based tree, suggesting that the two isolates might represent two different ASPV strains or variants. According to ICTV criteria for species demarcation in the genus Foveavirus, the serological specificity, size and sequence identity of CP gene are important referred data (Adams et al. 2012). Then, it was suggested that AGCaV might be a distinct species or a novel variant of ASPV (James et al. 2013; Morelli et al. 2017). As for isolates Aurora-1 and CYD, ASPV-LYC also met the criteria for a distinct species based on its low CP identity with the type isolate ASPV PA66. Western blot analysis indicated that ASPV-LYC was serologically related to other ASPV isolates, but showed differential serological reactivities with antisera raised against three ASPV isolates from pear. Computational methods
using amino acid sequences are useful tools for predicting potential epitopes and their aa residues involved in different antigens (El-Manzalawy and Honavar 2010). Our primary analysis showed that the aa variations at the N-terminal part of tested ASPV CPs resulted in the differentiation for their antigenic determinants and antigenic index. Further extensive studies will be necessary for comprehensively understanding the epitope structures of ASPV isolates, which can facilitate serological diagnostic methods for highly variable ASPV isolates. ASPV-LYC did not cause visible symptoms on the original pear plants, but induced visible symptoms on leaves and stems of graft-inoculated P. veitchii plants. The downward leaf roll and stem pitting on P. veitchii plants indicated the ASPV infection (Siebert and Engelbrecht 1981; Nemeth 1986; Stouffer and Fridlund 1989). Although the infection of ASGV also occurred in P. veitchii plants, the single infection of the virus usually did not induce visible symptoms in P. veitchii plants. Thus, ASPV-LYC showed the biotype similar to other ASPV isolates (Nemeth 1986). Nowadays, frequent human activity plays important roles in plant virus dissemination, which provides conditions for viruses adapting new hosts (Jones 2009). The mixed infection and interaction of several viruses in a woody plant could greatly increase severity of diseases as previously reported (Susaimuthu et al. 2008; Quito-Avila et al. 2014). As asymptomatic carriers of ASPVLYC, the ‘Chili’ plants seem to be tolerant or resistant to the virus infection. However, cautious evaluation of the effects of the new ASPV isolate on other pear germplasm, especially in case of mixed infection with other viruses, will be necessary to ascertain potential risks. Until now, the molecular mechanism involved in ASPV evolution and pathogenicity is rarely known. Therefore, it is important to have more comparable biological tests and extensive molecular characterization for the virus from different host sources.
5. Conclusion Our results indicate that ASPV-LYC is a novel strain of ASPV, which has unique original source and molecular characteristics, and is serologically and biologically related to known ASPV isolates. ASPV isolates with LYC like molecular characteristics were rarely found in other cultivated pear plants.
Acknowledgements This study was financially supported by the program for the Key International S&T Cooperation Projects (2017YFE0110900), the National Key Research and Developemnt Program of China (2018YFD0201400), the
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
Fundamental Research Funds for the Central Universities, China (2662016PY107), and the earmarked fund for the China Agriculture Research System (CARS-28-15). Appendices associated with this paper can be available on http://www.ChinaAgriSci.com/V2/En/appendix.htm
References Adams M J, Candresse T, Hammond J, Kreuze J F, Martelli G P, Namba S, Pearson M N, Ryu K H, Saldarelli P, Yoshikawa N. 2012. Betaflexiviridae. In: King A M Q, Adams M J, Carstens E B, lefkowitz E J, eds., Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier, San Diego. pp. 920–941. Al Rwahnih M, Turturo C, Minafra A, Saldarelli P, Myrta A, Pallás V, Savino V. 2004. Molecular variability of Apple chlorotic leaf spot virus in different hosts and geographical regions. Journal of Plant Pathology, 86, 117–122. Alabi O J, Martin R R, Naidu R A. 2010. Sequence diversity, population genetics and potential recombination events in grapevine rupestris stem pitting-associated virus in Pacific North-West vineyards. Journal of General Virology, 91, 265–276. Boulila M. 2010. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis. Biochemical Genetics, 48, 357–375. Brakta A, Handa A, Thakur P D, Tomar M, Kumar P. 2015. Malus pumila ‘Spy 227’ and Apple stem pitting virus: Graft incompatibility and epinasty. Virus Disease, 26, 92–96. Brakta A, Thakur P D, Handa A. 2013. First report of apple top working disease caused by viruses (Apple stem grooving virus, Apple chlorotic leaf spot virus, and Apple stem pitting virus) in apple in India. Plant Disease, 97, 1001. Chen J, Chen J, Adams M J. 2002. Characterisation of potyviruses from sugarcane and maize in China. Archives of Virology, 147, 1237–1246. Desvignes J C, Boyé R, Cornaggia D, Grasseau N, Hurtt S, Waterworth H. 1999. Virus Diseases of Fruit Trees. CTIFL, Paris, France. Dhir S, Ram R, Hallan V, Zaidi A A. 2011. Molecular characterization of an Indian variant of Apple stem pitting virus: Evidence of recombination. Journal of Plant Pathology, 93, 471–478. Dhir S, Tomar M, Thakur P D, Ram R, Hallan V, Zaidi A A. 2010. Molecular evidence for Apple stem pitting virus infection in India. Plant Pathology, 59, 393. El-Manzalawy Y, Honavar V. 2010. A framework for developing epitope prediction tools. In: Proceedings of the First ACM International Conference on Bioinformatics and Computational Biology. Niagara Falls, NY, USA. pp. 660–662. German S, Candresse T, Lanneau M, Huet J C, Pernollet
2559
J C, Dunez J. 1990. Nucleotide sequence and genomic organization of apple chlorotic leaf spot closterovirus. Virology, 179, 104–112. James D. 1999. A simple and reliable protocol for the detection of apple stem grooving virus by RT-PCR and in a multiplex PCR assay. Journal of Virological Methods, 83, 1–2. James D, Varga A, Jesperson G D, Navratil M, Safarova D, Constable F, Horner M, Eastwell K, Jelkmann W. 2013. Identification and complete genome analysis of a virus variant or putative new foveavirus associated with apple green crinkle disease. Archives of Virology, 158, 1877–1887. Jelkmann W. 1994. Nucleotide sequences of apple stem pitting virus and of the coat protein gene of a similar virus from pear associated with vein yellows disease and their relationship with potex- and carlaviruses. Journal of General Virology, 75, 1535–1542. Jones R A C. 1981. The ecology of viruses infecting wild and cultivated potatoes in the Andean region of South America. In: Thresh J M, ed., Pests, Pathogens and Vegetation. Pitman, London, UK. pp. 89–107. Jones R A C. 2009. Plant virus emergence and evolution: Origins, new encounter scenarios, factors driving emergence, effects of changing world conditions, and prospects for control. Virus Research, 141, 113–130. Kishi K, Takanashi K, Abiko K. 1976. Pear necrotic spot, a new virus disease in Japan. Acta Horticulturae, 67, 269–274. Kolaskar A S, Tongaonkar P C. 1990. A semi-empirical method for prediction of antigenic determinants on protein antigens. Febs Letters, 276, 172–174. Komorowska B, Siedlecki P, Kaczanowski S, Hasiówjaroszewska B, Malinowski T. 2011. Sequence diversity and potential recombination events in the coat protein gene of Apple stem pitting virus. Virus Research, 158, 263–267. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology & Evolution, 33, 1870–1874. Liu N, Niu J, Zhao Y. 2012. Complete genomic sequence analyses of Apple stem pitting virus isolates from China. Virus Genes, 44, 124–130. Ma X, Hong N, Moffett P, Wang G. 2016. Genetic diversity and evolution of Apple stem pitting virus isolates from pear in China. Canadian Journal of Plant Pathology, 38, 218–230. Martelli G P, Jelkmann W. 1998. Foveavirus, a new plant virus genus. Archives of Virology, 143, 1245–1249. Martelli G P, Kreuze A J F, Dolja V V. 2007. Family Flexiviridae: A case study in virion and genome plasticity. Annual Review of Phytopathology, 45, 73–100. Martin D P. 2009. Recombination detection and analysis using RDP3. Methods in Molecular Biology, 537, 185–205. Mathioudakis M M, Maliogka V I, Dovas C I, Paunovic S, Katis N I. 2009. Reliable RT-PCR detection of Apple stem pitting virus in pome fruits and its association with quince fruit deformation disease. Plant Pathology, 58, 228–236. Mathioudakis M M, Maliogka V I, Dovas C I, Vasilakakis M, Katis N I. 2006. First record of the Apple stem pitting virus (ASPV)
2560
LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560
in quince in Greece. Journal of Plant Pathology, 88, 225. Menzel W, Jelkmann W, Maiss E. 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods, 99, 81–92. Morelli M, Giampetruzzi A, Laghezza L, Catalano L, Savino V N, Saldarelli P. 2017. Identification and characterization of an isolate of apple green crinkle associated virus involved in a severe disease of quince (Cydonia oblonga, Mill.). Archives of Virology, 162, 299–306. Morelli M, Minafra A, Boscia D, Martelli G P. 2011. Complete nucleotide sequence of a new variant of Ggrapevine rupestris stem pitting-associated virus from southern Italy. Archives of Virology, 156, 543–546. Nemeth M. 1986. Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Kluwer Academic Publishers, Dordrecht, The Netherlands. Paunovic S V, Rankovic M, Radovic S. 1999. Characterization of a virus associated with pear stony pit in cv. Württemberg. Journal of Phytopathology, 147, 695–700. Quito-Avila D F, Lightle D, Martin R R. 2014. Effect of Raspberry bushy dwarf virus, Raspberry leaf mottle virus, and Raspberry latent virus on plant growth and fruit crumbliness in ‘Meeker’ red raspberry. Plant Disease, 98, 176–183. Siebert Z V, Engelbrecht D J. 1981. Field and glasshouse evaluation of Pyronia veitchii as an indicator of some apple latent viruses. Phytophylactica, 13, 199–204. Spetz C, Taboada A M, Darwich S, Ramsell J, Salazar L F, Valkonen J P T. 2003. Molecular resolution of a complex of potyviruses infecting solanaceous crops at the centre of origin in Peru. Journal of General Virology, 84, 2565–2578. Stouffer R F, Fridlund P R. 1989. Indexing using woody indicators. In: Virus and Virus-like Diseases of Pome Fruits and Simulating Noninfectious Disorders. Washington State University, Cooperative Extension College, Pullmann, WA,
USA. pp. 255–265. Susaimuthu J, Tzanetakis I E, Gergerich R C, Kim K S, Martin R R. 2008. Viral interactions lead to decline of blackberry plants. Plant Disease, 92, 1288–1292. Sutic D D, Ford E R, Tosic M T. 1999. Virus diseases of fruit trees. In: Handbook of Plant Virus Diseases. CRC Press LLC, Boca Raton. pp. 321–389. Teng Y. 2011. The pear industry and research in China. Acta Horticulturae, 909, 161–170. Villamor D E, Eastwell K C. 2013. Viruses associated with rusty mottle and twisted leaf diseases of sweet cherry are distinct species. Phytopathology, 103, 1287–1295. Wu Z B, Ku H M, Su C C, Chen I Z, Jan F J. 2010. Molecular and biological characterization of an isolate of Apple stem pitting virus causing pear vein yellows disease in Taiwan. Journal of Plant Pathology, 92, 721–728. Yang F, Wang G, Xu W, Hong N. 2017. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses. Journal of Virological Methods, 247, 61–67. Yao B, Wang G, Ma X, Liu W, Tang H, Zhu H, Hong N. 2014. Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. Journal of Virological Methods, 196, 113–119. Yeon Y J, Ho J J, San C K, Seck D K, Cheol L H, Nam C B. 2014. Genetic diversity of a natural population of Apple stem pitting virus isolated from apple in Korea. Plant Pathology Journal, 30, 195–199. Yoshikawa N, Matsuda H, Oda Y, Isogai M, Takahashi T, Ito T, Yoshida K. 2001. Genome heterogeneity of apple stem pitting virus in apple trees. Acta Horticulturae, 550, 285–290. Zhang Y P, Uyemoto J K, Golino D A, Al Rowhani M. 1998. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology, 88, 1231–1237.
Executive Editor-in-Chief WAN Fang-hao Managing editor ZHANG Juan