Monitoring the microbial community during solid-state acetic acid fermentation of Zhenjiang aromatic vinegar

Food Microbiology 28 (2011) 1175e1181

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Monitoring the microbial community during solid-state acetic acid fermentation of Zhenjiang aromatic vinegar Wei Xu a, Zhiyong Huang d, Xiaojun Zhang c, Qi Li b, Zhenming Lu a, Jinsong Shi f, Zhenghong Xu a, b, *, Yanhe Ma e a

Laboratory of Pharmaceutical Engineering, School of Medicine and Pharmaceutics, Jiangnan University, Wuxi 214122, People’s Republic of China The State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, People’s Republic of China Laboratory of Molecular Microbial Ecology and Ecogenomics, College of Life Science and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China d Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, People’s Republic of China e Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, People’s Republic of China f Laboratory of Bioactive Products Process Engineering, School of Medicine and Pharmaceutics, Jiangnan University, Wuxi 214122, People’s Republic of China b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 6 January 2011 Received in revised form 30 March 2011 Accepted 31 March 2011 Available online 15 April 2011

Zhenjiang aromatic vinegar is one of the most famous Chinese traditional vinegars. In this study, change of the microbial community during its fermentation process was investigated. DGGE results showed that microbial community was comparatively stable, and the diversity has a disciplinary series of changes during the fermentation process. It was suggested that domestication of microbes and unique cycleinoculation style used in the fermentation of Zhenjiang aromatic vinegar were responsible for comparatively stable of the microbial community. Furthermore, two clone libraries were constructed. The results showed that bacteria presented in the fermentation belonged to genus Lactobacillus, Acetobacter, Gluconacetobacter, Staphylococcus, Enterobacter, Pseudomonas, Flavobacterium and Sinorhizobium, while the fungi were genus Saccharomyces. DGGE combined with clone library analysis was an effective and credible technique for analyzing the microbial community during the fermentation process of Zhenjiang aromatic vinegar. Real-time PCR results suggested that the biomass showed a “system microbes self-domestication” process in the first 5 days, then reached a higher level at the 7th day before gradually decreasing until the fermentation ended at the 20th day. This is the first report to study the changes of microbial community during fermentation process of Chinese traditional solid-state fermentation of vinegar. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Zhenjiang aromatic vinegar Microbial community DGGE Clone library Real-time PCR

1. Introduction Vinegar has over ten thousand years of historic record. Nowadays, a variety of popular vinegars are widely used around the world, for example, cereal vinegar in China and Japan, wine vinegar in France, malt vinegar in England, persimmon and pineapple vinegar in Southeast Asia, etc. Different from submerged pureculture fermentation techniques for vinegar production in European countries (Tesfaye et al., 2002), semi-solid or solid mix-culture fermentation techniques are widely used in Asian countries.

* Corresponding author. Laboratory of Pharmaceutical Engineering, School of Medicine and Pharmaceutics, Jiangnan University, Wuxi 214122, People’s Republic of China. Tel./fax: þ86 510 8591 8206. E-mail address: [email protected] (Z. Xu). 0740-0020/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2011.03.011

Vinegar fermentation usually includes three steps including starch saccharification, alcohol fermentation, and oxidation of ethanol to acetic acid. In this mixed-culture fermentation process (Haruta et al., 2006; Xu et al., 2007), the coexistence of different microbes could provide numerous enzymes for synthesis of flavor and functional materials, such as organic acids, amino acids, volatile components, and ligustrazine (He et al., 2004). Therefore, the constituents of Chinese vinegars are quite different from those of other vinegars, with unique aroma and many interesting physiological effects. Chinese vinegars are mostly produced by a typical aerobic solidstate fermentation technique, and Zhenjiang aromatic vinegar is the representative product of this technique. It is made from glutinous rice, and the starch saccharification and alcohol fermentation steps are similar to the technique of rice wine in China (Li, 2005), while the solid-state acetic acid fermentation

1176

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

process is unique as shown in Fig. 1. After saccharification and alcohol fermentation through semi-solid culturing, solid-state acetic acid fermentation is conducted by mixing alcohol mash with the wheat bran and rice hull in different pots or ponds. This step generally lasts about 20 days, and the temperature and humidity of fermentation culture is retained at 40e46  C and 60e70%, respectively. An unique cycle-inoculation style that the fermentation culture of the 7th day is used as seed (starter) for the next round inoculation is performed. Since no additional microbes are supplied during the fermentation process, the microbial community and quality of each fermentation circle is supposed to be comparatively stable. Finally, rice hull is mixed with fermentation culture, which is loose and has very large interspace, can hold enough air for the aerobic microbial growth and metabolic activities. The fermentation process of Zhenjiang aromatic vinegar is completed in 25e30 days, after which the fermented liquid is aged for over three months. It is well known that the microbial diversity and its dynamic change affect the quality and characteristics of the fermentation products significantly. Recently, molecular fingerprinting techniques such as DGGE (TGGE) and clone library analysis were widely used to investigate the microbial diversity of plenty of traditional fermentation products, including Korean kimchi (Chang et al., 2008), Japanese rice black-vinegar (Haruta et al., 2006), Portuguese fermented sausage (Albano et al., 2008), Italian cheese (Bonetta et al., 2008; Fontana et al., 2010) and salami (Aquilanti et al., 2007; Silvestri et al., 2007), cocoa (Camu et al., 2007; Nielsen et al., 2008) and fermented seafood (Roh et al., 2010). These studies helped us to understand how a fermentation product was made and the relationship between the microbial diversity, its dynamic change and its special characteristics. However, there is little reference concerning the microbial diversity of traditional Chinese vinegar fermentation. In the last decades, the microbial researches of traditional Chinese fermented vinegar were mainly based on culture-dependent approaches, with the purpose of isolating high-yielding acetic acid bacteria (Cui et al., 2008; Hao et al., 2008; Hu and Hao, 2004; Huang et al., 2006). On the other hand, molecular ecology techniques were introduced by some researchers to study Chinese traditional vinegars. Wu et al. (2010) used enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting to characterize 21 acetic acid bacterium (AAB) strains isolated from Chinese cereal vinegars produced by solid-state fermentation.

This study aimed to investigate the structure and dynamic change of the microbial community during solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar. Firstly, PCRDGGE was applied to investigate the bacterial and fungal community existing in the fermentation process. Secondly, two clone libraries (bacteria and fungi) were constructed to qualitatively study the microbial structure. Thirdly, quantitative real-time PCR analysis was applied to investigate the change of biomass during the fermentation process. 2. Materials and methods 2.1. Sampling The original cultures used in this study were collected in September, 2007 from Jiangsu Hengshun Vinegar Industry Co., located in the eastern coastal province of Jiangsu. Total 3 batches of sample which were always done at the same depth of the fermentation culture (approximately 20 cm from the upper surface) were collected, and every fresh sample (500 g) was laid in a sterile plastic bag on the 1st (humidity, 67.35%; pH, 4.24), 5th (humidity, 66.58%; pH, 4.52), 7th (humidity, 65.62%; pH, 4.13), 10th (humidity, 67.36%; pH, 3.89), 15th (humidity, 68.46%; pH, 3.77) and 20th (humidity, 68.10%; pH, 3.91) day of the solid-state acetic acid fermentation process. After sampling, samples were taken to the lab immediately and stored at 20  C before further analysis. 2.2. The pH measurement and analysis of organic compounds 1 g sample was treated with 30 ml de-ionized water, and the pH of the solution was then measured by a pH meter. Total nine organic acids (oxalic acid, tartaric acid, pyruvic acid, malic acid, lactic acid, acetic acid, citric acid, fumaric acid and succinic acid) were analyzed by HPLC with described approaches by Versari et al. (2008). Amino acids were analyzed according to the methods previously described in detail (Fabiani et al., 2002). 2.3. DNA extraction and PCR amplification 1 g sample was treated with 30 ml de-ionized water, and total nucleic acids were extracted according to the described method (Zoetendal et al., 1998). All DNA concentrations were then determined by using DyNA quant 200 (Hoefer, San Francisco, CA, USA). Two pairs of universal primer were used to amplify bacterial 16S rDNA and fungal 18S rDNA, respectively. Primers P2 (ATT ACC GCG GCT GCT GG) and P3-GC (CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GCC TAC GGG AGG CAG CAG) were performed to amplify bacterial 16S rDNA (Muyzer et al., 1993). Meanwhile, primers NS3-GC (CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GGC AAG TCT GGT GCC AGC AGC C) and YM951r (TTG GCA AAT GCT TTC GC) were used to amplify fungal 18S rDNA (Haruta et al., 2006). The PCR mixture (25 ml) contained 1 U of rTaq polymerase (Takara, Dalian, China), 1 PCR buffer (Mg2þ free), 2 mM MgCl2, 12.5 pM of each primer, and 10 ng of extracted total DNA. The samples were amplified using a PCR Express system (Hybaid Limited, Ashford, UK). For bacterial 16S rDNA and fungal 18S rDNA amplification, a ‘touchdown PCR’ process was applied (Muyzer et al., 1993; DiCello et al., 1997). The sizes of PCR products were assessed by electrophoresis on a 1.2% (wt/vol) agarose gel. 2.4. PCR-DGGE

Fig. 1. Manufacture technique of Zhenjiang aromatic Vinegar. The production of Zhenjiang aromatic vinegar may be divided into three steps, namely alcohol fermentation, acetic acid fermentation, and storing. A unique circular inoculation technique is used during acetic acid fermentation process to keep the microbial flora stabilization.

DGGE was performed using a Dcode System apparatus (Bio-Rad, Hercules, CA, USA). Before DGGE, each PCR product was reconditioned for five cycles to reduce single-stranded and heteroduplex

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

1177

DNA (DiCello et al., 1997). For bacterial analysis, PCR products (200 ng) were separated on 8% (wt/vol) polyacrylamide gels with a 30e50% denaturant gradient (100% denaturant was 7 M urea and 40% de-ionized formamide). For fungal analysis, PCR products (200 ng) were separated on 8% (wt/vol) polyacrylamide gels with a 10e50% denaturant gradient. Electrophoresis was performed in 1 TriseacetateeEDTA buffer at 200 V (constant voltage) and 60  C for 4 h. The gels were stained with SYBR Green I (Amersco, Solon, Ohio) and were photographed with a UVI gel documentation system (UVItec, Cambridge, United Kingdom).

amplification of the sequence with primers P2eP3. The PCR products were purified using an UltraClean DNA purification kit (MO BIO, Solana Beach, CA), ligated into the pGEM-T Easy vector (Promega, Madison, Wis.), and transformed into competent E. coli DH5a cells. Positive clones were picked randomly, and inserts were amplified and screened to determine their migration positions by DGGE. Clones that migrated to the same positions as the original DGGE bands were sequenced.

2.5. Statistical analysis of DGGE pattern

Real-time PCR amplification and detection were performed in a Chromo4 Real-Time 4-color 96-well PCR system (MJ Geneworks, USA), and mixture commercial kit (SYBR Premix Ex Taq, Takara, Dalian, China). Primers used for quantitative real-time PCR analysis were designed using softwares of Primer Premier 5.0 and Oligo 6.0, and the primers used in our work shown in Table 1. For bacteria, the amplification program consisted of one cycle of 94  C for 10 s, then 40 cycles of 94  C for 5 s, 58  C for 15 s, 72  C for 15 s, and finally one cycle of 72  C for 5 min. And for fungi, the amplification program consisted of one cycle of 94  C for 10 s, then 45 cycles of 94  C for 5 s, 56  C for 15 s, 72  C for 15 s, and finally one cycle of 72  C for 5 min. The fluorescent products were detected at the last step of each cycle. Following amplification, melting curve analysis, which was obtained by slow heating at 0.3  C/s increments from 60 to 94  C with continuous fluorescence collection, was performed to determine the specificity of the PCR products. For determination of the number of bacterial and fungal amount present in each sample, fluorescent signals, detected from 10 times serial dilutions (from 1012 copies/ml to 103 copies/ml) in the linear range of the assay, were averaged and compared to a standard curve generated with standard DNA in the same experiment (Zhang et al., 2008).

To determine the information content of the banding patterns in terms of their structural diversity, the DGGE profile was analyzed with the Quantity One software, Version 4.4.0 (Bio-Rad Laboratories, USA). Dendrograms relating band pattern similarities were automatically calculated with the Dice coefficient, without band weighted (consideration band density) by unweighted pair group method with arithmetic mean (UPGMA) algorithms in the Quantity One software. 2.6. Clone library analysis The 7th and 20th day’s samples were used for the creation of the clone library. For the clone library to analyze the bacterial community, primer P0 (GAG AGT TTG ATC CTG GCT CAG) and P6 (CTA CGG CTA CCT TGT TAC GA) (DiCello et al., 1997; Weisburg et al., 1991) were used to amplify the whole region of bacterial 16S rDNA and produce 1.5 kb PCR products. The amplification was carried out with the following process: 95  C for 4 min; 20 cycles of 95  C for 30 s; 56  C for 30 s; and 72  C for 90 s; and finally 72  C for 8 min. For the clone library to analyze the fungal community, a pair of primer without the GC-clamp NS3 and YM951r was used. The amplification process was: 95  C for 10 min; 20 cycles of 93  C for 1 min; 45  C for 1 min; and 72  C for 3 min; and finally 72  C for 5 min. The sizes of PCR products were both assessed by electrophoresis on a 1.2% (wt/vol) agarose gel. The target bands were excised from the 1.2% agarose gel and purified using DNA gel extraction kit (V-gene, Hangzhou, China) as recommended by the manufacturer. The purified PCR products were ligated into pGEM-T Easy Vector according to the manufacturer’s instructions (Promega, Madison, WI, USA), and then were transformed into Escherichia coli DH5a. For each library, one hundred recombinant clones were randomly selected for analysis. The selected clones were screened by insert length and positive clones were screened out for further analysis. For bacterial analysis, inserts were re-amplified using primers P0 and P6 and then digested with restriction enzymes HinfI and Csp6I (MBI Fermentas, Hanover, MD, USA) in order to determine the number of OTUs (Operational Taxonomic Units). A representative clone of each restriction pattern was selected for further analysis. 2.7. DGGE bands identification To identify each band representative in DGGE profile, the migration positions of the library clones that harbored the 196-bp fragment (bacteria) and the 398-bp fragment (fungi) were compared to the DGGE profile. The sequence of each DGGE band was represented by the sequence of the clones, which have the same migration behavior. For bacterial analysis, DGGE bands with no matching clones in the library were excised from the gel and eluted by incubation in sterile distilled water (50 ml) at 4  C overnight. A 2.5-ml aliquot of the resulting preparation was used as a template for re-

2.8. Real-time PCR analysis

2.9. Nucleotide sequence accession numbers For bacterial analysis, the sequences in this study have been deposited in the GenBank database under accession numbers DQ901702 to DQ901729. And for fungal analysis, the accession numbers is EF566877 to EF566881. 3. Results 3.1. Changes of pH and total acid during fermentation Changes of pH and total acid during solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar are shown in Fig. 2. The content of total acids increased rapidly during the fermentation, from 655.7 mg/100 g culture in the fresh culture without inoculation to 6253.1 mg/100 g culture in 20th day’s culture. While after inoculation, pH sharply decreased from 6.82 to 4.24, and then retained a range of 3.8e4.0 until the fermentation

Table 1 The primers for real-time PCR used in this study. Primer

Target

Sequence of primer (50 e 30 )

Length of production (bp)

P1 P2 Ace1 Ace2 Lac1 Lac2 Y1 Y2

Bacteria

CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG CGCAAGGGACCTCTAACACA ACCTGATGGCAACTAAAGATAGGG AGAACACCAGTGGCGAAGG CAGGCGGAGTGCTTAATGC GCGGTAATTCCAGCTCCAATAG GCCACAAGGACTCAAGGTTAG

196

Acetobacter Lactobacillus Fungi

110 174 151

1178

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

bands were detected, and no dramatic changes were observed. Band 3 (Lactobacillus gallinarum) was weakened during the fermentation gradually, and finally disappeared on the 20th day. However, band 12 (Gluconacetobacter intermedius) appeared on the 15th day. Though there was some variation among a few of the faint bands, no evident differences were observed for the other 10 bands (Fig. 3A1). Similarity coefficients among all of the DNA samples reached 69% (Fig. 3A2). The results suggested that the bacterial community during solid-state acetic acid fermentation process was relatively stable, and this can provide microbial guarantee for the stable quality of each batch of final products. 3.3. DGGE profile and clone library analysis of fungal community

Fig. 2. Total acid and pH curve during solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar. Closed square, total acid; open circle, pH.

ended. Total nine organic acids were formed in the fermentation process as indicated by HPLC analysis (Table 2). Acetic acid and lactic acid were two major organic acids, representing more than 70% of the total organic acids. Other organic acids were less in amount, but might relate to the characteristic taste of Zhenjiang aromatic vinegar.

3.2. DGGE profile and clone library analysis of bacterial community The transition and community of bacteria throughout the solidstate acetic acid fermentation process by DGGE and clone library analysis are shown in Fig. 3A and Table 3. Because the microbial community of 3 batches of sample was relatively stable (data not shown), we only show the DGGE profile of one batch of sample in this paper. For clone library construction, 1.5 kb inserts of 16S rDNA fragments were amplified from the sample DNA with primers P0eP6. The recombinant clones in the library were digested with restriction enzymes HinfI and Csp6I (MBI Fermentas, Hanover, MD) in order to determine the number of sequence types present in each OTU, and then amplified with primers P2 and P3 in order to screen for their migrating behavior in DGGE gel. The missed DGGE bands in the library were excised, re-amplified, cloned and sequenced. The results indicated that the bacteria existed during the process of solid-state acetic acid fermentation belonged to the following genus: Lactobacillus, Acetobacter, Gluconacetobacter, Staphylococcus, Enterobacter, Pseudomonas, Flavobacterium and Sinorhizobium. Similarities between one species and the nearest species were from 93.8% to 100% (Table 3). In DGGE profile (Fig. 3A1), a total of 12

The transition of the fungal community throughout the solidstate acetic acid fermentation process by DGGE and clone library analysis was shown in Fig. 3B and Table 4. The clone library consists of 398 bp inserts of 18S rDNA fragments that were amplified from the sample DNA with primers NS3-YM951r. The results showed that the fungi presented during the process of solid-state acetic acid fermentation all belonged to genus Saccharomyces, similarities were from 96.84% to 100% (Table 4). We also found in the sequencing results that two species (Saccharomyces cariocanus and Saccharomyces paradoxus) had similar migrating behavior with band 1 in the DGGE profile. The reason might be that these two species had a similar target sequence and denaturalization concentration. In DGGE profile (Fig. 3B1), a total of 4 bands were detected, and the similarity coefficients ranged from 28% to 95% (Fig. 3B2). No dramatic changes were observed for band 1 (S. cariocanus, S. paradoxus) and band 2 (Saccharomyces bayanus) during the fermentation procedure, while band 4 (Saitoella complicata strain IAM 12963) was weakened gradually and disappeared on the 15th day. Band 3 (Saccharomyces cerevisiae) was enhanced during the fermentation. 3.4. The biomass dynamic analysis by quantitative real-time PCR The biomass of bacteria and fungi during solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar was analyzed by real-time PCR, and the results were shown in Fig. 4. The quantity of acetic acid bacteria, lactic acid bacteria, total bacteria and fungi showed a similar trend during the process of solid-state acetic acid fermentation. On the 1st day of fermentation, acetic acid bacteria (1.20E þ 12 copies/g culture), lactic acid bacteria (4.22E þ 12 copies/ g culture), total bacteria (1.27E þ 13 copies/g culture) and fungi (4.73E þ 12 copies/g culture) reached the highest copy number after inoculation. Then, the copy number decreased, and reached a lower point at the 5th day, which the biomass were 2.146.82E þ 11, 1.74, 6.82E þ 11, 6.82E þ 11 and 2.44E þ 11 copies/g

Table 2 Organic acids analysis during solid-state acetic acid fermentation. Days

0d

Acetic acid Lactic acid Succinic acid Tartaric acid Pyruvic acid Oxalic acid Citric acid Malic acid Fumaric acid Total acid (Ace þ Lac)/Total acid

84.3 430.4 2.8 110.6 1.3 12.4 12.0 1.9 e 655.7 78.50

1d        

5.7 61.2 0.7 7. 4 0.2 1.5 1.8 0.4

 71.5  10.20%

1292.1 1335.2 6.1 115.6 22.9 6.4 4.5 1.5 e 2784.3 94.36

5d        

96.0 121.6 1.5 6.2 3.7 0.7 0.6 0.3

 230.6  7.82%

All values are presented as the mean  SD (n ¼ 3) (mg/100 g culture).

1792.7 1569.1 3.4 108.1 17.0 4.2 2.5 1.6 e 3498.6 96.09

7d        

119.1 102.5 1.1 7.1 1.9 0.4 0.5 0.3

 232.9  6.33%

2329.2 1310.9 6.2 138.9 30.7 11.1 2.1 0.3 e 3829.4 95.06

10 d        

151.6 142.4 1.7 9.0 5.0 1.4 0.2 0.1

 311.4  7.68%

4050.0 1096.5 18.4 178.2 51.2 8.6 3.4 1.0 e 5407.3 95.18

15 d        

218.8 82.4 2.9 13.8 8.3 1.3 0.2 0.2

 327.9  5.57%

5436.5 794.9 20.3 157.7 39.7 5.4 6.5 0.6 e 6461.6 96.44

20 d        

244.9 91.7 2.2 10.5 5.5 0.8 1.1 0.1

 356.8  5.21%

5325.1 712.2 26.4 135.3 40.5 6.1 5.6 1.9 e 6253.1 96.55

       

196.3 88.1 3.5 11.4 7.1 1.0 1.4 0.2

 309  4.55%

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

1179

Fig. 3. Monitoring of the bacterial and fungal diversity during solid-state acetic acid fermentation process. (A1, B1) DGGE profiles of the bacterial and fungal group for six culture samples collected from Jiangsu Hengshun Vinegar Co., LTD during a 20 days period. Lane 1 to lane 6 contained the culture samples belonged to 1st day, 5th day, 7th day, 10th day, 15th day, and 20th day, respectively. (A2, B2) Clustering analysis of the DGGE profiles shown in panels A1 and B1.

Table 3 Species of bacteria with sequences most similar to clone libraries. Banda OTU no. Species with most similar sequence Accession no.b Similarity (%) 1 2 3 4 5 6 7 8 9 10 11 12 X1 X2 X3 X4

#8 #4 #5 #6 #16 #3 #9 #7 #15 #1 #2 #14 #10 #12 #11 #13

Staphylococcus gallinarum Lactobacillus acetotolerans Lactobacillus gallinarum Lactobacillus crispatus Flavobacterium sp. Lactobacillus panis Staphylococcus kloosii Lactobacillus pontis Sinorhizobium sp. Acetobacter pomorum Acetobacter pasteurianus Gluconacetobacter intermedius Enterobacter sp. Pseudomonas geniculata Enterobacter sp. Pseudomonas cissicola

AY211158 M58801 AJ853309 AF243150 AJ626986 X94230 DQ093351 X76329 AF285962 AJ419835 AJ419834 AB166739 DQ288160 AB021404 AJ550468 AB021399

100 98.6 99.3 93.8 100 99.4 100 98.8 97.7 99.9 99.4 99.7 97 98.8 98.2 100

a Bands 1e12 were detected by both DGGE and clone library, and bands x1ex4 were only detected by clone library. b Sequences were compared to those in NCBI database.

culture for acetic acid bacteria, lactic acid bacteria, total bacteria and fungi, respectively. After this a raised process was shown, the copy number reached a higher level at the 7th day (1.67E þ 12, 1.22E þ 12, 4.81E þ 12 and 1.38E þ 12 copies/g culture) before a gradually decrease process until the fermentation ended at the 20th day (1.39E þ 11, 0.48E þ 11, 2.31E þ 11 and 0.30E þ 11 copies/g culture). 4. Discussion The diversity and succession of microbes involved in traditional vinegar fermentation are of considerable interest for understanding the microbiological processes and controlling vinegar quality. Only a small number of molecular microbial ecological studies using culture-independent approach have been performed to investigate the processes of Japanese vinegar and shouchu (a distilled spirit) (Endo and Okada, 2005; Haruta et al., 2006). To date, no studies have been reported to investigate the succession of bacterial and fungal communities during fermentation processes of Chinese vinegar, wine, soy and other related products.

1180

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

Table 4 Species of fungi with sequences most similar to clone libraries. Band

OTU no.

Species with most similar sequence

Accession no.a

Similarity (%)

1 1 2 3 4

#1 #10 #2 #3 #4

Saccharomyces cariocanus Saccharomyces paradoxus Saccharomyces bayanus Saccharomyces cerevisiae Saitoella complicata

AY046224 X97806 AY046227 AY251636 AY548297

100 100 99.5 99.5 96.8

a

Sequences were compared to those in NCBI database.

PCR-DGGE is a powerful technique used for analysis of microbial diversity in a wide range of environment samples without cultivation (Muyzer and Smalla, 1998; Pang et al., 2005). Haruta et al. (2006) successfully applied this technique to study the succession of bacteria and fungal communities during the traditional Japanese vinegar fermentation process. The results showed that the primary bacteria existed during the fermentation process belonged to genus Acetobacter and Lactobacillus, and the fungi belonged to genus Saccharomyces and Aspergillus. Although this technique has advantages such as high throughput, reliability and reproducibility (Muyzer, 1999), it still has some limitations including incomplete DNA extraction, PCR biases, co-migration, and resolution problem for low abundance microbes (Muyzer and Smalla, 1998). For instance, in soil samples, there might be as many as 104 different genomes (Torsvik et al., 1990). Generally, only the bacterial populations that make up 1% or more of the total community might be detected by DGGE (Weisburg et al., 1991). Thus it is possible that the DGGE fingerprinting might mask organisms’ community perturbations of low abundance members in our study, i.e., Pseudomonas cissicola, Pseudomonas geniculata, Enterobacteriaceae bacterium, and Enterobacter sp. To overcome this problem, clone library analysis was combined with PCR-DGGE in this study. Indeed, our PCR-DGGE results showed that there were 6 genera of bacteria existing in the fermentation process, i.e., genus Acetobacter, Lactobacillus, Staphylococcus, Gluconacetobacter, Pseudomonas and Flavobacterium. Among them, genus Acetobacter and Lactobacillus were two primary microbes which was similar to the results of Haruta et al. (2006), while genus Staphyloccus is the main group of bacteria that are considered technologically important in the fermentation and ripening of sausages (Rantsiou and Cocolin, 2006). However, bacteria Enterobacteriaceae bacterium, Enterobacter sp., Pseudomonas geniculata and Pseudomonas cissicola were not detected by DGGE, but detected by clone library analysis, suggesting these species only represent small proportions in the sample (<1%). For fungal community analysis, no difference was found between the PCR-DGGE and clone library

analysis. Nevertheless, DGGE could detect as much as 75% of the total population using primer P2eP3 mentioned above, indicating DGGE could represent the majority of the population composition. We suggest that DGGE combined with clone library analysis is an effective and credible technique for monitoring and analyzing the microbial community in the solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar. Interestingly, we found several suspected novel strains which had the similarity lower than 98% (Tables 3 and 4). A pure-culture method was used to isolate the strains from the fermentation culture. Fortunately, we got two isolates that might be novel strains. Through blasting in NCBI, they might belong to genus Paenibacillus, and had the characteristic for organic acids production. Other physiology and biochemistry identification work are being carried on. In the results of clone library (Tables 3 and 4), we also found that Lactobacillus and Saccharomyces were both anaerobes with high abundance during the aerobic fermentation process, which may due to the unique aerobic solid-fermentation technique adopted for Zhenjiang aromatic vinegar production. In most European countries, submerged pure-culture fermentation techniques were widely used for vinegar production (Tesfaye et al., 2002). The fermentation is primarily carried out in fermentor which has high degree of automation and oxygen uptake efficiency, so the major microbe existed during the fermentation process is Acetobacter. But in most Northeast Asian countries, especially in China and Japan, solid or semi-solid mix-culture state fermentation is widely used for vinegar fermentation. The microbial community is more abundant, and except for Acetobacter, many other species of anaerobes, e.g., Lactobacillus and Saccharomyces, were also found because of insufficient oxygen uptaking (Haruta et al., 2006; Xu et al., 2007). The solid-state acetic acid fermentation layer of Zhenjiang aromatic vinegar is normally about 1 m thick. Oxygen is abundant in the upper region, while the lower region may be a micro-aerobic or even a partial anaerobic environment. All the fermentation material is stirred once a day. This may be one of the primary reasons why there are many species of Lactobacillus and Saccharomyces during the fermentation period. Except for abundant Lactobacillus and Acetobacter, many other microbes, such as Sinorhizobium, Enterobacter, and Gluconacetobacter also played a very important role during the fermentation process. Sinorhizobium, Enterobacter and Gluconacetobacter all have the function of nitrogen fixation, it may supply the nitrogen resource of raw material, which can provide necessary energy for the metabolism of the functional bacteria, e.g., Acetobacter. In the result of real-time PCR (Fig. 4), we also found that the biomass of microbes reached the highest after inoculation at the 1st day, then decreased rapidly with the fermentation, and reached a lower point at the 5th day. After this a raised process was shown, the biomass reached a higher level at the 7th day before a gradually decrease process until the solid-state acetic acid fermentation ended at the 20th day. It was suggested that the rice husk and bran brought in a mass of intrinsic microbes, and also the microbes from the 7th day’s inoculation culture (extrinsic microbes) together caused biomass rapidly increasing in the 1st day. But with the fermentation performed, some inherent functional microbes, such as Acetobacter and Lactobacillus, might secrete abundant organic acids and make change of the culture environment (temperature, pH), which killed most of extrinsic microbes, and presented a “system microbes self-domestication” function. Acknowledgements

Fig. 4. Quantitative real-time PCR results for bacteria and fungi during solid-state acetic acid fermentation process of Zhenjiang aromatic vinegar. Closed triangle, total bacteria; closed square, total fungi; asterisk, Lactobacillus; open triangle, Acetobacter.

This work was supported by a grant from the High Tech Development Program of China (863 Project) (No. 2007AA02Z203), a grant from the National Natural Science Foundation of China

W. Xu et al. / Food Microbiology 28 (2011) 1175e1181

(No.30600013), and two grants from National Key Technology R&D Program in the 11th Five year Plan of China (No. 2008BAI63B06 and No.2006BAD27B09-3), and a grant from the State Key Laboratory of Food Science and Technology, Jiangnan University (No. SKLF-MB200801).

References Albano, H., Henriques, I., Correia, A., Hogg, T., Teixeira, P., 2008. Characterization of microbial population of ‘Alheira’ (a traditional Portuguese fermented sausage) by PCR-DGGE and traditional cultural microbiological methods. Journal of Applied Microbiology 105, 2187e2194. Aquilanti, L., Santarelli, S., Silvestri, G., Osimani, A., Petruzzelli, A., Clementi, F., 2007. The microbial ecology of a typical Italian salami during its natural fermentation. International Journal of Food Microbiology 120, 136e145. Bonetta, S., Bonetta, S., Carraro, E., Rantsiou, K., Cocolin, L., 2008. Microbiological characterisation of Robiola di Roccaverano cheese using PCR-DGGE. Food Microbiology 25, 786e792. Camu, N., De Winter, T., Verbrugghe, K., Cleenwerck, I., Vandamme, P., Takrama, J.S., Vancanneyt, M., De Vuyst, L., 2007. Dynamics and biodiversity of populations of lactic acid bacteria and acetic acid bacteria involved in spontaneous heap fermentation of cocoa beans in Ghana. Applied and Environmental Microbiology 73, 1809e1824. Chang, H.W., Kim, K.H., Nam, Y.D., Roh, S.W., Kim, M.S., Jeon, C.O., Oh, H.M., Bae, J.W., 2008. Analysis of yeast and archaeal population dynamics in kimchi using denaturing gradient gel electrophoresis. International Journal of Food Microbiology 126, 159e166. Cui, Y., Lu, H.M., Zhang, Y.M., Liu, J., 2008. Microbial separation and identification in the vinegar. Chinese Brewing 22, 29e31. DiCello, F., Bevivino, A., Chiarini, L., Fani, R., Paffetti, D., Tabacchioni, S., Dalmastri, C., 1997. Biodiversity of a Burkholderia cepacia population isolated from the maize rhizosphere at different plant growth stages. Applied and Environmental Microbiology 63, 4485e4493. Endo, A., Okada, S., 2005. Monitoring the lactic acid bacterial diversity during shochu fermentation by PCR-denaturing gradient gel electrophoresis. Journal of Bioscience and Bioengineering 99, 216e221. Fabiani, A., Versari, A., Parpinello, G.P., Castellari, M., Galassi, S., 2002. Highperformance liquid chromatographic analysis of free amino acids in fruit juices using derivatization with 9-fluorenylmethyl-chloroformate. Journal of Chromatographic Science 40, 14e18. Fontana, C., Cappa, F., Rebecchi, A., Cocconcelli, P.S., 2010. Surface microbiota analysis of Taleggio, Gorgonzola, Casera, Scimudin and Formaggio di Fossa Italian cheeses. International Journal of Food Microbiology 138, 205e211. Hao, L., Yang, N., Hu, H.P., Bai, R.H., Qin, N., 2008. Isolation and identification of acetic acid bacteria from Shanxi superior mature vinegar in China. American Laboratory 40, 20e21. Haruta, S., Ueno, S., Egawa, I., Hashiguchi, K., Fujii, A., Nagano, M., Ishii, M., Igarashi, Y., 2006. Succession of bacterial and fungal communities during a traditional pot fermentation of rice vinegar assessed by PCR-mediated denaturing gradient gel electrophoresis. International Journal of Food Microbiology 109, 79e87. He, Z.Y., Ao, Z.H., Wu, Y., Li, G.Q., Tao, W.Y., 2004. Determination and generant mechanism of tetramethylpyrazine in Zhenjiang vinegar. China Condiment 300, 36e39.

1181

Hu, H.P., Hao, L., 2004. Separation and identification of superior Acetobacter acetic from Shanxi super-mature vinegar. Journal of Shanxi Agricultural University 24, 283e285 (in Chinese). Huang, Q., Ma, C.J., Yu, J., OuYang, H., Zhang, Y.K., Gao, Y.F., 2006. Study on the screening of superior Acetobacter from Hexi savory vinegar. Chinese Condiment 7, 19e24. Li, J.R., 2005. Current situation and developing prospect of yellow rice wine. Liquor Making 1, 2e4 (in Chinese). Muyzer, G., Dewaal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59, 695e700. Muyzer, G., Smalla, K., 1998. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek 73, 127e141. Muyzer, G., 1999. DGGE/TGGE a method for identifying genes from natural ecosystems. Current Opinion in Microbiology 2, 317e322. Nielsen, D.S., Snitkjaer, P., van den Berg, F., 2008. Investigating the fermentation of cocoa by correlating denaturing gradient gel electrophoresis profiles and near infrared spectra. International Journal of Food Microbiology 125, 133e140. Pang, X.Y., Ding, D.Z., Wei, G.F., Zhang, M.L., Wang, L.H., Zhao, L.P., 2005. Molecular profiling of Bacteroides spp. in human feces by PCR-temperature gradient gel electrophoresis. Journal of Microbiological Methods 61, 413e417. Rantsiou, K., Cocolin, L., 2006. New developments in the study of the microbiota of naturally fermented sausages as determined by molecular methods: a review. International Journal of Food Microbiology 108, 255e267. Roh, S.W., Kim, K.H., Nam, Y.D., Chang, H.W., Park, E.J., Bae, J.W., 2010. Investigation of archaeal and bacterial diversity in fermented seafood using barcoded pyrosequencing. ISME Journal 4, 1e16. Silvestri, G., Santarelli, S., Aquilanti, L., Beccaceci, A., Osimani, A., Tonucci, F., Clementi, F., 2007. Investigation of the microbial ecology of Clauscolo, a traditional Italian salami, by culture-dependent techniques and PCR-DGGE. Meat Science 77, 413e423. Tesfaye, W., Morales, M.L., Garcia-Parrilla, M.C., Troncoso, A.M., 2002. Wine vinegar: technology, authenticity and quality evaluation. Trends in Food Science and Technology 13, 12e21. Torsvik, V., Goksoyr, J., Daae, F.L., 1990. High diversity in DNA of soil bacteria. Applied and Environmental Microbiology 56, 782e787. Versari, A., Parpinello, G.P., Mattioli, A.U., Galassi, S., 2008. Characterisation of Italian commercial apricot juices by high-performance liquid chromatography analysis and multivariate analysis. Food Chemistry 108, 334e340. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173, 697e703. Wu, J.J., Gullo, M., Chen, F.S., Giudici, P., 2010. Diversity of Acetobacter pasteurianus strains isolated from solid-state fermentation of cereal vinegars. Current Microbiology 60, 280e286. Xu, W., Zhang, X.J., Xu, H.Y., Xu, Z.H., Zhao, L.P., 2007. Analysis of bacterial communities in aerobic solid-fermentation culture of Zhenjiang Hengshun vinegar. Microbiology 34, 646e649 (in Chinese). Zhang, G.S., Tian, J.Q., Jiang, N., Guo, X.P., Wang, Y.F., Dong, X.Z., 2008. Methanogen community in Zoige wetland of Tibetan plateau and phenotypic characterization of a dominant uncultured methanogen cluster ZC-I. Environmental Microbiology 10, 1850e1860. Zoetendal, E.G., Akkermans, A.D.L., De Vos, W.M., 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria. Applied and Environmental Microbiology 64, 3854e3859.