- Email: [email protected]
Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method
Food Microbiology 27 (2010) 973e978
Contents lists available at ScienceDirect
Food Microbiology journal homepage: www.elsevier.com/locate/fm
Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method Rocío Fernández-Pérez 1, Carmen Torres, Susana Sanz, Fernanda Ruiz-Larrea*,1 Department of Food and Agriculture, Faculty of Science, University of La Rioja, Av. Madre de Dios 51, 26006 Logroño, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 January 2010 Received in revised form 18 May 2010 Accepted 20 May 2010 Available online 1 June 2010
Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) e PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Acetic acid bacteria Strain identification PFGE (pulsed field gel electrophoresis) ERIC-PCR Vinegar Submerged elaboration method
1. Introduction A variety of vinegars is produced in most Mediterranean countries and extensively used as a condiment and as an efficient acidifying agent for food preservation. Vinegar is produced by two well-defined methods: a slow surface process, in which acetic acid bacteria (AAB) are placed on the aireliquid interface in direct contact with atmospheric oxygen, and a fast submerged process, in which AAB are submerged in the acetifying liquid and a continuous strong aeration is applied to provide the necessary oxygen for acetic fermentation to take place. Generally, the surface process is employed for elaborating traditional vinegars and the submerged process is employed for the elaboration of most commercial vinegars of major consumption. AAB are the microorganisms responsible for the transformation of ethanol into acetic acid, and it should be pointed out that not all the strains of a certain species have the same ability to oxidize ethanol into acetic acid (Gullo and Giudici, 2008). Therefore, discriminating among AAB strains of the same species is important to determine how many strains are involved in a fermentation process and which one is leading the transformation. DNA-based typing methods that have been successfully used for identification to strain level of AAB from a variety of origins are the following: enterobacterial repetitive intergenic consensus sequence
amplification (ERIC-PCR) (González et al., 2004, 2005; Gullo and Giudici, 2008; Gullo et al., 2009; Nanda et al., 2001), random amplified polymorphic DNA (RAPD-PCR) analysis (Nanda et al., 2001; Prieto et al., 2007; Trcek et al., 1997), and pulsed field gel electrophoresis (PFGE) of genomic restriction fragments applied to a wide range of bacterial isolates (López et al., 2007). Microbiological studies reported in the last years have focused on characterisation of AAB from traditional balsamic vinegars (De Vero et al., 2006; Gullo et al., 2006, 2009; Gullo and Giudici, 2008; Ilabaca et al., 2008), rice vinegar (Haruta et al., 2006) and some other vegetable products such as grapes or cocoa beans (De Vuyst et al., 2008; Prieto et al., 2007), and very few reports can be found on strain characterization of AAB from vinegars produced by the submerged method (Callejón et al., 2008; Schüller et al., 2000; Trcek et al., 2000). The objectives of the present study were searching for appropriate and efficient DNA-based molecular methods to type AAB strains, and to characterize up to strain level AAB isolates from vinegars elaborated by the submerged method from cider, wine and spirit ethanol.
2. Materials and methods 2.1. Vinegar sampling
* Corresponding author. Tel.: þ34 941 299749; fax: þ34 941 299721. E-mail address: [email protected] (F. Ruiz-Larrea). 1 Present address: ICVV (UR, CSIC, CAR), Av. Madre de Dios 51, 26006 Logroño, Spain. 0740-0020/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2010.05.020
Vinegar samples were aseptically taken from 30,000 l bioreactors (Frings Xuzhou Bio- and Chemical Technology Co., Ltd.) optimized
974
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
for the submerged production of vinegar, of the company Vinagrerías Riojanas S. A., containing either wine, cider or spirit vinegars in full fermentation (fermentation rate ¼ 0.17e0.25 acetic degrees/ h). A total of 58 samples (34 wine vinegars, 20 cider vinegars and 4 spirit vinegars) were collected during the period from November 2007 to December 2008. Samples of 25 ml were collected in 50 ml sterile tubes and transported with continuous agitation, which favoured aerobic conditions. Samples were rapidly submitted (within 10 min) to microbiological analysis in the laboratory.
González et al. (2004). The amplification products were resolved by electrophoresis in 1.5% (w/v) agarose gels, separated at 80 V for 1 h and 45 min, stained with ethidium bromide and photographed. ERIC-PCR patterns were classified as indistinguishable, closely related or unrelated when they were identical, differed in 1e3 bands, or differed in more than 3 bands respectively.
2.2. Culture media and growth conditions
AAB pure isolates were cultured for 24 h in GY broth with vigorous and continuous shaking to reach an optical density of 0.8e1.2 at 660 nm. Three ml samples of these fresh cultures were centrifuged and cells were washed once with 3 ml sterile saline solution. Cells were resuspended in 100 ml of storage buffer (10 mM Tris/HCl pH 8, 10 mM EDTA pH 8). The suspension was warmed at 50 C and 100 ml of 1% pulse field certified agarose (D-5 Pronadisa Hispanlab S.A., Madrid, Spain) in TBE buffer (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8) at the same temperature was added. The suspension was allowed to solidify in molds and they were treated following the method described by López et al. (2007) for cell lysis and DNA isolation under immobilised conditions. Before restriction enzyme digestion, agarose blocks were cut (slices 1e2 mm) and balanced for 30 min at room temperature in 100 ml of the appropriate restriction enzyme buffer. The following restriction endonucleases were tested: SfiI, XbaI, NotI, AluI, SmaI and SpeI. Digestions with SpeI (New England Biolabs, Beverly, MA) were the most effective and DNAs were incubated with this enzyme for pattern comparison. SpeI digestions were performed overnight at 37 C in a 100 ml total volume of the specific buffer with 5 U of restriction enzyme. Before loading, gel blocks were washed with 1 ml of TBE for 8 min at 52 C. DNA fragments were separated in 1% (wt/vol) agarose (D-5 Pronadisa) in TBE buffer with a CHEF DR II system (Bio-Rad Laboratories, CA, USA). A total of 77 pure isolates were analysed by this PFGE method. Electrophoresis was performed at 14 C at a constant voltage of 4.5 V/cm with a switch time ramped from 5 to 45 s over 24 h period. Gels were stained with ethidium bromide (0.5 mg/ml) and photographed under UV light. Lambda ladder PFG marker (New England Biolabs) was used as molecular size standard. PFGE patterns were classified, like in the case of ERICPCR analyses, as indistinguishable, closely related or unrelated when they were identical, differed in 1e3 bands, or differed in more than 3 bands respectively, according to published criteria for bacterial strain typing (Tenover et al., 1995).
25 ml samples of wine and cider vinegars were centrifuged at 2100g (Megafuge Heraeus, Thermo Scientific, Wilmington, USA) for 10 min. Cell pellets of approximately 1 ml volume were collected, and 100 ml of each sample were cultivated for 5 days on GY agar plates [5% glucose (Panreac Química S.A., Barcelona, Spain), 1% yeast extract (Scharlau Chemie S A, Barcelona, Spain) and 1.5% agar (BectoneDickinson, Madrid, Spain)] at 30 C under aerobic conditions. 25 ml samples of spirit ethanol vinegars were centrifuged and cell pellets were cultivated in GY broth for 48 h at 30 C with continuous and vigorous agitation in order to adapt AAB cells to growing in the culture medium. These samples were subsequently cultivated on GY agar plates following the same procedure as described for wine and cider vinegars. Colonies were submitted to gram staining and morphological analysis by optical microscopy. Three colonies were randomly taken from each vinegar sample. Isolates thus selected were considered to represent the numerically dominant strains present in the vinegar samples. AAB isolates were sub-cultured to purity on GY agar plates and were typed to species level by sequence analysis of the amplicon obtained by PCR of the 16Se23S intergenic region in a previous study (Fernández-Pérez et al., submitted for publication). A total of 103 pure isolates were recovered and stored in 20% sterile skim milk (BectoneDickinson) at 20 C. 2.3. Strain typing by ERIC (enterobacterial repetitive intergenic consensus) -PCR A total of 90 AAB pure isolates were grown onto GY agar plates at 30 C for 3 days under aerobic conditions for DNA extraction. The DNA extraction method that was carried out was as follows. Cells from this fresh culture were suspended in 200 ml of lysis buffer (50 mM Tris/HCl, pH 8; 10 mM b-mercaptoethanol). Samples were vigorously vortexed and reposed for 15 min at room temperature. They were incubated at 100 C for 10 min, vortexed and frozen to 80 C. Samples were unfrozen and submitted to precipitation (Sambrook et al., 1989). 200 ml of solution II (0.2 N NaOH; 1% SDS) was added over 100 ml of sample, mixed manually and kept on ice for 3 min. 150 ml of solution III (3 M potassium; 5 M acetate) was added to the mix and agitated for 10 s and kept on ice for 3e5 min. The sample was centrifuged at 14,800g (Biofuge Heraeus, Thermo Scientific) for 5 min at 4 C. The supernatant was recovered in a sterile microtube and DNA was precipitated with 2 vol of ethanol (96%) at 4 C and resting on ice for 2 min. The sample was centrifuged at 12,000g at 4 C for 5 min and the supernatant was eliminated. The DNA was dissolved in 50 ml of TE buffer (10 mM Tris/Cl pH 8; 1 mM EDTA pH 8) and DNAses were inactivated by heating in a water bath at 85 C for 15 min. DNA quantification was performed with the apparatus NanoDrop (Thermo Scientific) and adjusted between 80 and 150 ng/ml. The oligonucleotide primers used for the amplification of the ERIC-PCR were those described by Versalovic et al. (1991): ERIC1 (50 ATCGAAGCTCCTGGGGATTCAC30 ) and ERIC2 (50 AAGTAAGTGACTGGGGTGAGCG30 ) (synthesized by Sigma Aldrich, Madrid, Spain). PCR amplification was carried out in a final volume of 50 ml following the conditions described by
2.4. Strain typing by restriction fragment PFGE of total DNA digested with SpeI
2.5. Reproducibility study To determine the percentage of similarity necessary for strain discrimination, reproducibility studies were carried out according to López et al. (2008). The level of similarity obtained between repeats of the same isolate when included within the dendrogram for all strains, established the discriminatory threshold below which patterns were considered to be different. 2.6. Numerical analysis of gel images The GelCompar 2.5 software (Applied Maths, Kortrijd, Belgium) was used for conversion, normalization, and further processing of images. Comparison of the obtained restriction fragment PFGE and ERIC-PCR patterns was performed with Dice coefficient and the Unweighted Pair Group Method using Arithmetic averages (UPGMA). The cophenetic correlation value was calculated for the dendrograms. This parameter is a measure of the reliability of the calculated distances in the dendrogram (Sokal and Rohlf, 1962).
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
The index of strain diversity was evaluated by calculating the following percentage: 100 (number of different patterns/total number of isolates) 3. Results From the total 58 vinegar samples in full fermentation that were collected in this study, a total of 103 AAB isolates were recovered and submitted to genetic typing up to strain level. All the isolates were shown to be gram negative and ellipsoidal to rod shaped. 3.1. AAB strain typing by ERIC-PCR Different protocols were assayed for obtaining total DNA from AAB isolates, and results indicated that the method for DNA extraction was a determinant step for the subsequent ERIC-PCR analysis. Results showed that the method described in Section 2.3, which included two steps for DNA extraction, rendered consistent ERIC-PCR patterns. The time required for the whole analysis of an AAB isolate by this method was one day, in contrast with four days required for the restriction fragment PFGE analysis. Ninety of the 103 AAB isolates were analysed by ERIC-PCR and Table 1 and Fig. 1 show the patterns obtained for isolates recovered from the different types of vinegars, as well as their corresponding species. Table 1 also shows that two closely related (CR) patterns (E3a CR to E3b, and E5a CR to E5b) were obtained for a number of isolates recovered from white wine vinegars. The reproducibility study was carried out by
Table 1 ERIC-PCR patterns obtained from a total of 90 analysed AAB vinegar isolates. Pattern name
Closely related patterns
No. of isolates
Species
Origin of vinegar
E15 E18 E19 E27 E28 E30 E32 E36 E38 E39 E45 E46 E48 E49 E51 E52 E60 E61
7 13 2 2 3 4 3 1 1 1 1 5 2 1 2 1 2 1 2 1 2 2 5
Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus Ga. europaeus Ga. xylinus A. hansenii Ga. europaeus Ga. europaeus Ga. xylinus Ga. europaeus Ga. xylinus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus
E62 E65 E81 E90 E109 E110 E111 E119 E125 E156 31 patterns
4 1 2 2 9 1 2 3 1 1 90 isolates
Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus Ga. xylinus Ga. xylinus Ga. xylinus Ga. xylinus Ga. xylinus Ga. europaeus
White wine White wine White wine White wine Red wine Red wine White wine White wine White wine Cider Cider White wine Cider Cider Cider White wine Cider Cider Cider White wine White wine White wine White wine and spirit White wine White wine White wine Cider Cider Cider Cider Cider Cider Red wine
E1 E3a E3b E5a E5b
2 closely related patterns
975
duplicate with 10 isolates, and the resulting discriminatory threshold for this method was 81%. Cluster analysis using this threshold value and visual inspection of the ERIC-PCR images rendered the dendrogram shown in Fig. 1, which includes a total of 31 unrelated patterns for the 90 AAB isolates of this study. As deduced from the dendrogram, the percentage of similarity between unrelated profiles varied from 31% to 81%. Patterns were classified into two groups with similarity percentages >30% (represented in Fig. 1 with a discontinuous line) within each group. The resulting index of diversity for this typing method was 37% and the cophenetic correlation value calculated for the dendrogram was 60%. Isolates of cider vinegars were not clustered together in the same group with this typing method, which differed from the results obtained with the restriction fragment PFGE typing method shown in Fig. 2. Table 1 shows the unrelated (n ¼ 31) patterns with the number of isolates that presented each pattern, their species identification and the type of vinegar from which isolates were recovered in this series of 90 AAB isolates submitted to ERIC-PCR typing method. 3.2. AAB strain typing by restriction fragment PFGE of SpeI digests of total DNA Seventy seven out of the 103 AAB isolates were typed by restriction fragment PFGE. Among the six tested endonucleases (SfiI, XbaI, NotI, AluI, SmaI and SpeI) SpeI rendered the most discriminating restriction fragments. AAB total DNA digested with SpeI yielded approximately 14 bands in the 25e600 kb size range, suitable for numeration, whereas the other endonucleases yielded either too few bands (NotI, SmaI, AluI) or too many fragments (XbaI) (data not shown). Fig. 2 shows SpeI restriction patterns of the isolates submitted to this analysis. The reproducibility of restriction fragment PFGE analysis was determined analysing by duplicate the macrorestriction patterns of 15 AAB isolates, and a value of 85% for Dice’s coefficient of similarity was obtained, which was a higher value than that obtained for ERIC-PCR analysis. This value was considered as the limit percentage of similarity below which the macrorestriction patterns were considered different and corresponding to distinct strains or genotypes, and above which the grouped isolates were considered identical, multiple copies of the same strain. Cluster analysis using this criteria and visual inspection of the restriction fragment PFGE images rendered the dendrogram shown in Fig. 2, which shows 22 distinct macrorestriction patterns among the 77 AAB isolates of this study. As deduced from the dendrogram, the percentage of similarity between unrelated and closely related profiles varied from 45% to 85% (cophenetic correlation value calculated for the dendrogram 60%). Table 2 shows the unrelated (n ¼ 17) and closely related (n ¼ 5) patterns with the number of isolates that presented each pattern, the species identification and the type of vinegar from which isolates were recovered in this series of 77 AAB isolates. AAB patterns were classified into two groups which are shown in Fig. 2, with coefficients of similarity 45% (this value is indicated in Fig. 2 with a discontinuous line) within each group, Group 1 with coefficient of similarities 45% and Group 2 with 49% of similarity among their corresponding AAB isolates. All the isolates clustered in Group 1 were of the species Gluconacetobacter europaeus and it included all the isolates from spirit vinegars as well as isolates from wine vinegars. All the isolates from cider vinegar were clustered together in Group 2; this group presented the highest variability of species: Acetobacter pasteurianus, Ga. europaeus, Ga. hansenii and Ga. xylinus. The average index of strain diversity calculated from this PFGE typing method, expressed as the ratio of number of different patterns versus total number of analysed isolates, was 28%. As shown in Table 2, the most abundant strain was Ga. europaeus of PFGE pattern R1, which was identified in 25 isolates of different
976
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
Fig. 1. ERIC-PCR distinct patterns and UPGMA dendrogram obtained from 90 AAB isolates.
types of wine vinegars (red and white wine vinegars) and spirit vinegar (frequency of appearance: 32% among the total 77 analysed isolates). This strain was found in vinegar samples during a period of seven months. The second most frequently found strain was Ga. europaeus of PFGE pattern R3, which appeared in 12 isolates obtained from white wine vinegars during a period of five months. Spirit vinegars showed pure cultures, and single strains of the species Ga. europaeus were present in these vinegars. It is important to note that isolates from spirit vinegars were difficult to cultivate in the laboratory and required an adaptation period of growing in GY broth before plating out and isolation. Strains of PFGE pattern R1 and R75 that appeared in spirit vinegar samples were also present in wine vinegar samples, which indicates the same origin and an adaptation of these two strains to growing in the highly stressing growth conditions that spirit vinegars posses (14% ethanol). Most wine vinegar samples (73%) showed mixed cultures of at least two different strains, and strain R1 appeared as the leader strain in seven wine vinegar samples and the unique strain in one spirit vinegar, followed by strain R3 which appeared as the leader strain in four wine vinegars. In contrast to spirit vinegars, all cider vinegars showed mixed cultures of different strains (at least two different strains in each vinegar sample) either of the same species or of different species as determined by sequencing of the 16Se23S intergenic region. Cider vinegars showed as well a variety of leader strains, which were not repeated along the time span of this study and which appeared only in one sample. The index of strain diversity in cider vinegars was 75%, whereas the diversity index found in wine vinegars was 17%, which indicates that cider vinegars showed the highest diversity among their strains.
4. Discussion Very few studies on AAB strain typing from vinegars have been reported to date, and genetic differentiation of strains within species has always been a challenge (Bartowsky and Henschke, 2008). A number of authors used ERIC-PCR as the typing method for AAB, and thus this method has been used for strain typing of A. pasteurianus isolates from traditional balsamic vinegars (Gullo et al., 2009) and AAB isolates from rice vinegars (Nanda et al., 2001). Some other authors used RAPD-PCR analysis for strain typing, and thus Bartowsky et al. (2003) typed A. pasteurianus isolates from spoiled bottled red wine, later they reported this technique for typing isolates from different sources, including vinegar, rice vinegar, and spoiled cider (Bartowsky and Henschke, 2008), and more recently this random amplified PCR technique was used to type AAB isolates from Chilean vineyards (Prieto et al., 2007). Some authors have used ERIC-PCR analysis in combination with other techniques, and thus ERIC and REP-PCR were applied to investigate species and strain evolution of the AAB population during wine production (González et al., 2005). REP-PCR has been also applied to identify at strain level AAB isolates from Ghanaian fermented cocoa beans using (GTC)5-REP-PCR fingerprinting (De Vuyst et al., 2008). PFGE of genomic restriction fragments of AAB was reported as a method for strain typing (Sievers and Swings, 2005) and it had been reported as an appropriate tool for strain typing of a wide number of bacterial isolates (López et al., 2008). Our results showed that PFGE of total DNA restriction fragments with the enzyme SpeI gave the most discriminating analysis when compared with other restriction enzymes. Sievers and Swings (2005) based their analysis
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
977
Fig. 2. SpeI PFGE distinct patterns and UPGMA dendrogram obtained from 77 AAB isolates.
on the restriction fragments obtained with the enzyme XbaI, nevertheless, our results showed that the fragments obtained with SpeI were larger that those obtained with XbaI and gave the appropriate number of PFGE bands (around 14 bands) for strain typing, and that the reproducibility of the analysis was high (85%). Many reports agree with our results in that PFGE typing by using the appropriate restriction endonucleases offers the best discriminatory power to differentiate strains of the same species (López et al., 2008; Cleenwerck and De Vos, 2008). Our results showed that the DNA extraction method used for ERIC-PCR analysis was a rapid and efficient method, suitable for this type of analysis. As mentioned above, other authors reported ERICPCR analysis as an appropriate method for strain typing of AAB (Nanda et al., 2001; González et al., 2005; Gullo et al., 2009). Nevertheless, our results showed that the clusters generated by the ERIC-PCR patterns did not correlate either with the isolate origin or the isolate species, whereas both clusters generated from the restriction PFGE patterns correlated with the origin of isolates (Group 1 included isolates from wine and spirit vinegars, belonging exclusively to the species Ga. europaeus, and Group 2 included isolates from cider and wine belonging to a variety of species). These results suggest that PFGE restriction fragment analysis is the method of choice to type AAB strains, nevertheless, this method is more time-consuming than ERIC-PCR, which could be an appropriate method for following the fermentation process of a bioreactor that has been inoculated with a specific AAB strain. The index of diversity shown by the PFGE method (28%) revealed the diversity among the AAB isolates of this study. It should be pointed out that bioreactors (17,000 l of total reaction volume) were inoculated with 12,000 l of white wine vinegar in full fermentation process from an operational tank, therefore, the diversity among isolates was due to the different type and origin of the wines and
ciders used for vinegar elaboration. Strains R1 and R75 were obtained from wine vinegars (red and white wine) and from spirit vinegars. This result indicated that both strains were well adapted (specially R1) to survive under the different conditions of the Table 2 PFGE patterns obtained from SpeI digests of a total of 77 analysed AAB vinegar isolates. Pattern name
Closely related patterns
No. of isolates
Species
Origin of vinegar
R1
25
Ga. europaeus
R3 R6 R28 R30 R33a
12 1 1 1 1 3 1 5 1 2 2 1 2 4 2 2 6 2 1 1 1 77 isolates
Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. xylinus Ga. xylinus Ga. europaeus Ga. hansenii Ga. xylinus Ga. europaeus Ga. xylinus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus
White and red wine and spirit White wine White wine Cider Cider White wine White wine White wine White wine and spirit Cider Cider Cider Cider Cider Cider and white wine Cider and white wine White wine White wine White wine White wine Cider White wine
R33b R33c R33d R35 R36 R39 R41 R46 R48 R49 R54a R54b R55 R70 R90a 17 patterns
R90b 5 closely related patterns
978
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
acetifying liquid and could constitute excellent starter cultures for these vinegars. Cider vinegars showed the highest variability of species (A. pasteurianus, Ga. xylinus, Ga. hansenii and Ga. europaeus) among its isolates, species identification that was determined by sequencing the 16Se23S intergenic region, and they showed as well the highest diversity of clones and mixed populations of strains (n 2 strains) growing simultaneously in all cider vinegar samples, as mentioned in Results section. This was most probably due to the high sugar content (4%) (Del Campo et al., 2008) and the low content in alcohol (6%) of ciders, whereas wine vinegars (12% ethanol) and spirit vinegars (14% ethanol) offer more stressing conditions for bacterial growth. Summarizing, this study demonstrates that strains of the species Ga. europaeus are the most frequent leader strains of vinegar fermentations by the submerged method in a variety of vinegars (wine, cider and spirit vinegars) and among them strain R1 was predominant. It shows as well that mixed populations (at least two different strains) occur in vinegars from cider and wine, whereas unique strains grow in spirit vinegars, which offer the most stressing conditions for bacterial growth. Efficient strain typing tools are essential for identification of particular strains and for preparing defined starter cultures, and our study shows that PFGE of total DNA restriction fragments with the enzyme SpeI is a reliable and discriminating method for strain typing. Acknowledgments This work was supported by grant OTEM070621 by the company Vinagrerías Riojanas S.A. and grant AGL2007-60504 of the Ministry of Research and Science of Spain and FEDER of the European Community. Rocío Fernández-Pérez was supported by a research fellowship associated to OTEM070621. References Bartowsky, E.J., Henschke, P.A., 2008. Acetic acid bacteria spoilage of bottled red wine; a review. Int. J. Food Microbiol. 125, 60e70. Bartowsky, E.J., Xia, D., Gibson, R.L., Fleet, G.H., Henschke, P.A., 2003. Spoilage of bottled red wine by acetic acid bacteria. Lett. Appl. Microbiol. 36, 307e314. Callejón, R.M., Tesfaye, W., Torija, M.J., Mas, A., Troncoso, A.M., Morales, M.L., 2008. HPLC determination of amino acids with AQC derivatization in vinegars along submerged and surface acetifications and its relation to the microbiota. Eur. Food Res. Technol. 227, 93e102. Cleenwerck, I., De Vos, P., 2008. Polyphasic taxonomy of acetic acid bacteria: an overview of the currently applied methodology. Int. J. Food Microbiol. 125, 2e14. De Vero, L., Gala, E., Gullo, M., Solieri, L., Landi, S., Giudici, P., 2006. Application of denaturing gradient gel electrophoresis (DGGE) analysis to evaluate acetic acid bacteria in traditional balsamic vinegar. Food Microbiol. 23, 809e813. De Vuyst, L., Camu, N., De Vinter, T., Vandemeulebroecke, K., Van de Perre, V., Vacanneyt, M., De Vos, P., Cleenwerck, I., 2008. Validation of the (GTG)(5)-REPPCR fingerprinting technique for rapid classification and identification of acetic acid bacteria, with a focus on isolates from Ghanaian fermented cocoa beans. Int. J. Food Microbiol. 125, 79e90.
Del Campo, G., Berregi, I., Santos, J.I., Dueñas, M., Irastorza, A., 2008. Development of alcoholic and malolactic fermentations in highly acidic and phenolic apple must. Bioresour. Technol., 2854e2863. Fernández-Pérez, R., Torres, C., Sanz, S., Ruiz-Larrea, F. Rapid molecular methods for enumeration and taxonomical identification of acetic acid bacteria responsible for submerged vinegar production, submitted for publication. González, A., Hierro, N., Poblet, M., Mas, A., Guillamón, J.M., 2005. Application of molecular methods to demonstrate species and strain evolution of acetic acid bacteria population during wine production. Int. J. Food Microbiol. 102, 295e304. González, A., Hierro, N., Poblet, M., Rozes, N., Mas, A., Guillamón, J.M., 2004. Application of molecular methods for the differentiation of acetic acid bacteria in a red wine fermentation. J. Appl. Microbiol. 96, 853e860. Gullo, M., Caggia, C., De Vero, L., Giudici, P., 2006. Characterisation of acetic acid bacteria in “traditional balsamic vinegar”. Int. J. Food Microbiol. 106, 209e212. Gullo, M., De Vero, L., Giudici, P., 2009. Succession of selected strains of Acetobacter pasteurianus and other acetic acid bacteria in traditional balsamic vinegar. Appl. Environ. Microbiol. 75, 2585e2589. Gullo, M., Giudici, P., 2008. Acetic acid bacteria in traditional balsamic vinegar: phenotypic traits relevant for starter cultures selection. Int. J. Food Microbiol. 125, 46e53. Haruta, S., Ueno, S., Egawa, I., Hashiguchi, K., Fujii, A., Nagano, M., Ishii, M., Igarashi, Y., 2006. Succession of bacterial and fungal communities during a traditional pot fermentation of rice vinegar assessed by PCR-mediated denaturing gradient gel electrophoresis. Int. J. Food Microbiol. 109, 79e89. Ilabaca, C., Navarrete, P., Mardones, P., Romero, J., Mas, A., 2008. Application of culture-independent molecular biology based methods to evaluate acetic acid bacteria diversity during vinegar processing. Int. J. Food Microbiol. 126, 245e249. López, I., Tenorio, C., Zarazaga, M., Dizy, M., Torres, C., Ruiz-Larrea, F., 2007. Evidence of mixed wild populations of Oenococcus oeni strains during wine spontaneous malolactica fermentations. Eur. Food Res. Technol. 226, 215e223. López, I., Torres, C., Ruiz-Larrea, F., 2008. Genetic typification by pulsed field gel electrophoresis (PFGE) and randomly amplified polymorphic DNA (RAPD) of wild Lactobacillus plantarum and Oenococcus oeni wine strains. Eur. Food Res. Technol. 227, 547e555. Nanda, K., Taniguchi, M., Ujike, S., Ishihara, N., Mori, H., Ono, H., Murooka, Y., 2001. Characterization of acetic acid bacteria in traditional acetic acid fermentation of rice vinegar (komesu) and unpolished rice vinegar (kurosu) produced in Japan. Appl. Environ. Microbiol. 67, 986e990. Prieto, C., Jara, C., Mas, A., Romero, J., 2007. Application of molecular methods for analysing the distribution and diversity of acetic acid bacteria in Chilean vineyards. Int. J. Food Microbiol. 115, 348e355. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. In: Molecular Cloning. A Laboratory Manual, vol. 1. CSH Press, pp. 1.26e1.28. Schüller, G., Hertel, C., Hammes, W.P., 2000. Gluconacetobacter entanii sp. nov., isolated from submerged high-acid industrial vinegar fermentations. Int. J. Syst. Evol. Microbiol. 50, 2013e2020. Sievers, M., Swings, J., 2005. Family Acetobacteraceae. In: Garrity, G.M. (Ed.)Bergey’s Manual of Systematic Bacteriology, second ed., vol. 2. Springer, New York, pp. 41e95 (Part C). Sokal, R.R., Rohlf, F.J., 1962. The comparison of dendrograms by objective methods. Taxon 11, 33e40. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., Swaminathan, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233e2239. Trcek, J., Ramus, J., Raspor, P., 1997. Phenotypic characterization and RAPD-PCR profiling of Acetobacter sp. isolated from spirit vinegar production. Food Technol. Biotechnol. 35, 63e67. Trcek, J., Raspor, P., Teuber, M., 2000. Molecular identification of Acetobacter isolates from submerged vinegar production, sequence analysis of plasmid pJK2-1 and application in the development of a cloning vector. Appl. Microbiol. Biotechnol. 53, 289e295. Versalovic, J., Koeuth, T., Lupski, J.R., 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19, 6823e6831.
Contents lists available at ScienceDirect
Food Microbiology journal homepage: www.elsevier.com/locate/fm
Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method Rocío Fernández-Pérez 1, Carmen Torres, Susana Sanz, Fernanda Ruiz-Larrea*,1 Department of Food and Agriculture, Faculty of Science, University of La Rioja, Av. Madre de Dios 51, 26006 Logroño, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 January 2010 Received in revised form 18 May 2010 Accepted 20 May 2010 Available online 1 June 2010
Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) e PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Acetic acid bacteria Strain identification PFGE (pulsed field gel electrophoresis) ERIC-PCR Vinegar Submerged elaboration method
1. Introduction A variety of vinegars is produced in most Mediterranean countries and extensively used as a condiment and as an efficient acidifying agent for food preservation. Vinegar is produced by two well-defined methods: a slow surface process, in which acetic acid bacteria (AAB) are placed on the aireliquid interface in direct contact with atmospheric oxygen, and a fast submerged process, in which AAB are submerged in the acetifying liquid and a continuous strong aeration is applied to provide the necessary oxygen for acetic fermentation to take place. Generally, the surface process is employed for elaborating traditional vinegars and the submerged process is employed for the elaboration of most commercial vinegars of major consumption. AAB are the microorganisms responsible for the transformation of ethanol into acetic acid, and it should be pointed out that not all the strains of a certain species have the same ability to oxidize ethanol into acetic acid (Gullo and Giudici, 2008). Therefore, discriminating among AAB strains of the same species is important to determine how many strains are involved in a fermentation process and which one is leading the transformation. DNA-based typing methods that have been successfully used for identification to strain level of AAB from a variety of origins are the following: enterobacterial repetitive intergenic consensus sequence
amplification (ERIC-PCR) (González et al., 2004, 2005; Gullo and Giudici, 2008; Gullo et al., 2009; Nanda et al., 2001), random amplified polymorphic DNA (RAPD-PCR) analysis (Nanda et al., 2001; Prieto et al., 2007; Trcek et al., 1997), and pulsed field gel electrophoresis (PFGE) of genomic restriction fragments applied to a wide range of bacterial isolates (López et al., 2007). Microbiological studies reported in the last years have focused on characterisation of AAB from traditional balsamic vinegars (De Vero et al., 2006; Gullo et al., 2006, 2009; Gullo and Giudici, 2008; Ilabaca et al., 2008), rice vinegar (Haruta et al., 2006) and some other vegetable products such as grapes or cocoa beans (De Vuyst et al., 2008; Prieto et al., 2007), and very few reports can be found on strain characterization of AAB from vinegars produced by the submerged method (Callejón et al., 2008; Schüller et al., 2000; Trcek et al., 2000). The objectives of the present study were searching for appropriate and efficient DNA-based molecular methods to type AAB strains, and to characterize up to strain level AAB isolates from vinegars elaborated by the submerged method from cider, wine and spirit ethanol.
2. Materials and methods 2.1. Vinegar sampling
* Corresponding author. Tel.: þ34 941 299749; fax: þ34 941 299721. E-mail address: [email protected] (F. Ruiz-Larrea). 1 Present address: ICVV (UR, CSIC, CAR), Av. Madre de Dios 51, 26006 Logroño, Spain. 0740-0020/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2010.05.020
Vinegar samples were aseptically taken from 30,000 l bioreactors (Frings Xuzhou Bio- and Chemical Technology Co., Ltd.) optimized
974
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
for the submerged production of vinegar, of the company Vinagrerías Riojanas S. A., containing either wine, cider or spirit vinegars in full fermentation (fermentation rate ¼ 0.17e0.25 acetic degrees/ h). A total of 58 samples (34 wine vinegars, 20 cider vinegars and 4 spirit vinegars) were collected during the period from November 2007 to December 2008. Samples of 25 ml were collected in 50 ml sterile tubes and transported with continuous agitation, which favoured aerobic conditions. Samples were rapidly submitted (within 10 min) to microbiological analysis in the laboratory.
González et al. (2004). The amplification products were resolved by electrophoresis in 1.5% (w/v) agarose gels, separated at 80 V for 1 h and 45 min, stained with ethidium bromide and photographed. ERIC-PCR patterns were classified as indistinguishable, closely related or unrelated when they were identical, differed in 1e3 bands, or differed in more than 3 bands respectively.
2.2. Culture media and growth conditions
AAB pure isolates were cultured for 24 h in GY broth with vigorous and continuous shaking to reach an optical density of 0.8e1.2 at 660 nm. Three ml samples of these fresh cultures were centrifuged and cells were washed once with 3 ml sterile saline solution. Cells were resuspended in 100 ml of storage buffer (10 mM Tris/HCl pH 8, 10 mM EDTA pH 8). The suspension was warmed at 50 C and 100 ml of 1% pulse field certified agarose (D-5 Pronadisa Hispanlab S.A., Madrid, Spain) in TBE buffer (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8) at the same temperature was added. The suspension was allowed to solidify in molds and they were treated following the method described by López et al. (2007) for cell lysis and DNA isolation under immobilised conditions. Before restriction enzyme digestion, agarose blocks were cut (slices 1e2 mm) and balanced for 30 min at room temperature in 100 ml of the appropriate restriction enzyme buffer. The following restriction endonucleases were tested: SfiI, XbaI, NotI, AluI, SmaI and SpeI. Digestions with SpeI (New England Biolabs, Beverly, MA) were the most effective and DNAs were incubated with this enzyme for pattern comparison. SpeI digestions were performed overnight at 37 C in a 100 ml total volume of the specific buffer with 5 U of restriction enzyme. Before loading, gel blocks were washed with 1 ml of TBE for 8 min at 52 C. DNA fragments were separated in 1% (wt/vol) agarose (D-5 Pronadisa) in TBE buffer with a CHEF DR II system (Bio-Rad Laboratories, CA, USA). A total of 77 pure isolates were analysed by this PFGE method. Electrophoresis was performed at 14 C at a constant voltage of 4.5 V/cm with a switch time ramped from 5 to 45 s over 24 h period. Gels were stained with ethidium bromide (0.5 mg/ml) and photographed under UV light. Lambda ladder PFG marker (New England Biolabs) was used as molecular size standard. PFGE patterns were classified, like in the case of ERICPCR analyses, as indistinguishable, closely related or unrelated when they were identical, differed in 1e3 bands, or differed in more than 3 bands respectively, according to published criteria for bacterial strain typing (Tenover et al., 1995).
25 ml samples of wine and cider vinegars were centrifuged at 2100g (Megafuge Heraeus, Thermo Scientific, Wilmington, USA) for 10 min. Cell pellets of approximately 1 ml volume were collected, and 100 ml of each sample were cultivated for 5 days on GY agar plates [5% glucose (Panreac Química S.A., Barcelona, Spain), 1% yeast extract (Scharlau Chemie S A, Barcelona, Spain) and 1.5% agar (BectoneDickinson, Madrid, Spain)] at 30 C under aerobic conditions. 25 ml samples of spirit ethanol vinegars were centrifuged and cell pellets were cultivated in GY broth for 48 h at 30 C with continuous and vigorous agitation in order to adapt AAB cells to growing in the culture medium. These samples were subsequently cultivated on GY agar plates following the same procedure as described for wine and cider vinegars. Colonies were submitted to gram staining and morphological analysis by optical microscopy. Three colonies were randomly taken from each vinegar sample. Isolates thus selected were considered to represent the numerically dominant strains present in the vinegar samples. AAB isolates were sub-cultured to purity on GY agar plates and were typed to species level by sequence analysis of the amplicon obtained by PCR of the 16Se23S intergenic region in a previous study (Fernández-Pérez et al., submitted for publication). A total of 103 pure isolates were recovered and stored in 20% sterile skim milk (BectoneDickinson) at 20 C. 2.3. Strain typing by ERIC (enterobacterial repetitive intergenic consensus) -PCR A total of 90 AAB pure isolates were grown onto GY agar plates at 30 C for 3 days under aerobic conditions for DNA extraction. The DNA extraction method that was carried out was as follows. Cells from this fresh culture were suspended in 200 ml of lysis buffer (50 mM Tris/HCl, pH 8; 10 mM b-mercaptoethanol). Samples were vigorously vortexed and reposed for 15 min at room temperature. They were incubated at 100 C for 10 min, vortexed and frozen to 80 C. Samples were unfrozen and submitted to precipitation (Sambrook et al., 1989). 200 ml of solution II (0.2 N NaOH; 1% SDS) was added over 100 ml of sample, mixed manually and kept on ice for 3 min. 150 ml of solution III (3 M potassium; 5 M acetate) was added to the mix and agitated for 10 s and kept on ice for 3e5 min. The sample was centrifuged at 14,800g (Biofuge Heraeus, Thermo Scientific) for 5 min at 4 C. The supernatant was recovered in a sterile microtube and DNA was precipitated with 2 vol of ethanol (96%) at 4 C and resting on ice for 2 min. The sample was centrifuged at 12,000g at 4 C for 5 min and the supernatant was eliminated. The DNA was dissolved in 50 ml of TE buffer (10 mM Tris/Cl pH 8; 1 mM EDTA pH 8) and DNAses were inactivated by heating in a water bath at 85 C for 15 min. DNA quantification was performed with the apparatus NanoDrop (Thermo Scientific) and adjusted between 80 and 150 ng/ml. The oligonucleotide primers used for the amplification of the ERIC-PCR were those described by Versalovic et al. (1991): ERIC1 (50 ATCGAAGCTCCTGGGGATTCAC30 ) and ERIC2 (50 AAGTAAGTGACTGGGGTGAGCG30 ) (synthesized by Sigma Aldrich, Madrid, Spain). PCR amplification was carried out in a final volume of 50 ml following the conditions described by
2.4. Strain typing by restriction fragment PFGE of total DNA digested with SpeI
2.5. Reproducibility study To determine the percentage of similarity necessary for strain discrimination, reproducibility studies were carried out according to López et al. (2008). The level of similarity obtained between repeats of the same isolate when included within the dendrogram for all strains, established the discriminatory threshold below which patterns were considered to be different. 2.6. Numerical analysis of gel images The GelCompar 2.5 software (Applied Maths, Kortrijd, Belgium) was used for conversion, normalization, and further processing of images. Comparison of the obtained restriction fragment PFGE and ERIC-PCR patterns was performed with Dice coefficient and the Unweighted Pair Group Method using Arithmetic averages (UPGMA). The cophenetic correlation value was calculated for the dendrograms. This parameter is a measure of the reliability of the calculated distances in the dendrogram (Sokal and Rohlf, 1962).
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
The index of strain diversity was evaluated by calculating the following percentage: 100 (number of different patterns/total number of isolates) 3. Results From the total 58 vinegar samples in full fermentation that were collected in this study, a total of 103 AAB isolates were recovered and submitted to genetic typing up to strain level. All the isolates were shown to be gram negative and ellipsoidal to rod shaped. 3.1. AAB strain typing by ERIC-PCR Different protocols were assayed for obtaining total DNA from AAB isolates, and results indicated that the method for DNA extraction was a determinant step for the subsequent ERIC-PCR analysis. Results showed that the method described in Section 2.3, which included two steps for DNA extraction, rendered consistent ERIC-PCR patterns. The time required for the whole analysis of an AAB isolate by this method was one day, in contrast with four days required for the restriction fragment PFGE analysis. Ninety of the 103 AAB isolates were analysed by ERIC-PCR and Table 1 and Fig. 1 show the patterns obtained for isolates recovered from the different types of vinegars, as well as their corresponding species. Table 1 also shows that two closely related (CR) patterns (E3a CR to E3b, and E5a CR to E5b) were obtained for a number of isolates recovered from white wine vinegars. The reproducibility study was carried out by
Table 1 ERIC-PCR patterns obtained from a total of 90 analysed AAB vinegar isolates. Pattern name
Closely related patterns
No. of isolates
Species
Origin of vinegar
E15 E18 E19 E27 E28 E30 E32 E36 E38 E39 E45 E46 E48 E49 E51 E52 E60 E61
7 13 2 2 3 4 3 1 1 1 1 5 2 1 2 1 2 1 2 1 2 2 5
Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus Ga. europaeus Ga. xylinus A. hansenii Ga. europaeus Ga. europaeus Ga. xylinus Ga. europaeus Ga. xylinus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus
E62 E65 E81 E90 E109 E110 E111 E119 E125 E156 31 patterns
4 1 2 2 9 1 2 3 1 1 90 isolates
Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus Ga. xylinus Ga. xylinus Ga. xylinus Ga. xylinus Ga. xylinus Ga. europaeus
White wine White wine White wine White wine Red wine Red wine White wine White wine White wine Cider Cider White wine Cider Cider Cider White wine Cider Cider Cider White wine White wine White wine White wine and spirit White wine White wine White wine Cider Cider Cider Cider Cider Cider Red wine
E1 E3a E3b E5a E5b
2 closely related patterns
975
duplicate with 10 isolates, and the resulting discriminatory threshold for this method was 81%. Cluster analysis using this threshold value and visual inspection of the ERIC-PCR images rendered the dendrogram shown in Fig. 1, which includes a total of 31 unrelated patterns for the 90 AAB isolates of this study. As deduced from the dendrogram, the percentage of similarity between unrelated profiles varied from 31% to 81%. Patterns were classified into two groups with similarity percentages >30% (represented in Fig. 1 with a discontinuous line) within each group. The resulting index of diversity for this typing method was 37% and the cophenetic correlation value calculated for the dendrogram was 60%. Isolates of cider vinegars were not clustered together in the same group with this typing method, which differed from the results obtained with the restriction fragment PFGE typing method shown in Fig. 2. Table 1 shows the unrelated (n ¼ 31) patterns with the number of isolates that presented each pattern, their species identification and the type of vinegar from which isolates were recovered in this series of 90 AAB isolates submitted to ERIC-PCR typing method. 3.2. AAB strain typing by restriction fragment PFGE of SpeI digests of total DNA Seventy seven out of the 103 AAB isolates were typed by restriction fragment PFGE. Among the six tested endonucleases (SfiI, XbaI, NotI, AluI, SmaI and SpeI) SpeI rendered the most discriminating restriction fragments. AAB total DNA digested with SpeI yielded approximately 14 bands in the 25e600 kb size range, suitable for numeration, whereas the other endonucleases yielded either too few bands (NotI, SmaI, AluI) or too many fragments (XbaI) (data not shown). Fig. 2 shows SpeI restriction patterns of the isolates submitted to this analysis. The reproducibility of restriction fragment PFGE analysis was determined analysing by duplicate the macrorestriction patterns of 15 AAB isolates, and a value of 85% for Dice’s coefficient of similarity was obtained, which was a higher value than that obtained for ERIC-PCR analysis. This value was considered as the limit percentage of similarity below which the macrorestriction patterns were considered different and corresponding to distinct strains or genotypes, and above which the grouped isolates were considered identical, multiple copies of the same strain. Cluster analysis using this criteria and visual inspection of the restriction fragment PFGE images rendered the dendrogram shown in Fig. 2, which shows 22 distinct macrorestriction patterns among the 77 AAB isolates of this study. As deduced from the dendrogram, the percentage of similarity between unrelated and closely related profiles varied from 45% to 85% (cophenetic correlation value calculated for the dendrogram 60%). Table 2 shows the unrelated (n ¼ 17) and closely related (n ¼ 5) patterns with the number of isolates that presented each pattern, the species identification and the type of vinegar from which isolates were recovered in this series of 77 AAB isolates. AAB patterns were classified into two groups which are shown in Fig. 2, with coefficients of similarity 45% (this value is indicated in Fig. 2 with a discontinuous line) within each group, Group 1 with coefficient of similarities 45% and Group 2 with 49% of similarity among their corresponding AAB isolates. All the isolates clustered in Group 1 were of the species Gluconacetobacter europaeus and it included all the isolates from spirit vinegars as well as isolates from wine vinegars. All the isolates from cider vinegar were clustered together in Group 2; this group presented the highest variability of species: Acetobacter pasteurianus, Ga. europaeus, Ga. hansenii and Ga. xylinus. The average index of strain diversity calculated from this PFGE typing method, expressed as the ratio of number of different patterns versus total number of analysed isolates, was 28%. As shown in Table 2, the most abundant strain was Ga. europaeus of PFGE pattern R1, which was identified in 25 isolates of different
976
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
Fig. 1. ERIC-PCR distinct patterns and UPGMA dendrogram obtained from 90 AAB isolates.
types of wine vinegars (red and white wine vinegars) and spirit vinegar (frequency of appearance: 32% among the total 77 analysed isolates). This strain was found in vinegar samples during a period of seven months. The second most frequently found strain was Ga. europaeus of PFGE pattern R3, which appeared in 12 isolates obtained from white wine vinegars during a period of five months. Spirit vinegars showed pure cultures, and single strains of the species Ga. europaeus were present in these vinegars. It is important to note that isolates from spirit vinegars were difficult to cultivate in the laboratory and required an adaptation period of growing in GY broth before plating out and isolation. Strains of PFGE pattern R1 and R75 that appeared in spirit vinegar samples were also present in wine vinegar samples, which indicates the same origin and an adaptation of these two strains to growing in the highly stressing growth conditions that spirit vinegars posses (14% ethanol). Most wine vinegar samples (73%) showed mixed cultures of at least two different strains, and strain R1 appeared as the leader strain in seven wine vinegar samples and the unique strain in one spirit vinegar, followed by strain R3 which appeared as the leader strain in four wine vinegars. In contrast to spirit vinegars, all cider vinegars showed mixed cultures of different strains (at least two different strains in each vinegar sample) either of the same species or of different species as determined by sequencing of the 16Se23S intergenic region. Cider vinegars showed as well a variety of leader strains, which were not repeated along the time span of this study and which appeared only in one sample. The index of strain diversity in cider vinegars was 75%, whereas the diversity index found in wine vinegars was 17%, which indicates that cider vinegars showed the highest diversity among their strains.
4. Discussion Very few studies on AAB strain typing from vinegars have been reported to date, and genetic differentiation of strains within species has always been a challenge (Bartowsky and Henschke, 2008). A number of authors used ERIC-PCR as the typing method for AAB, and thus this method has been used for strain typing of A. pasteurianus isolates from traditional balsamic vinegars (Gullo et al., 2009) and AAB isolates from rice vinegars (Nanda et al., 2001). Some other authors used RAPD-PCR analysis for strain typing, and thus Bartowsky et al. (2003) typed A. pasteurianus isolates from spoiled bottled red wine, later they reported this technique for typing isolates from different sources, including vinegar, rice vinegar, and spoiled cider (Bartowsky and Henschke, 2008), and more recently this random amplified PCR technique was used to type AAB isolates from Chilean vineyards (Prieto et al., 2007). Some authors have used ERIC-PCR analysis in combination with other techniques, and thus ERIC and REP-PCR were applied to investigate species and strain evolution of the AAB population during wine production (González et al., 2005). REP-PCR has been also applied to identify at strain level AAB isolates from Ghanaian fermented cocoa beans using (GTC)5-REP-PCR fingerprinting (De Vuyst et al., 2008). PFGE of genomic restriction fragments of AAB was reported as a method for strain typing (Sievers and Swings, 2005) and it had been reported as an appropriate tool for strain typing of a wide number of bacterial isolates (López et al., 2008). Our results showed that PFGE of total DNA restriction fragments with the enzyme SpeI gave the most discriminating analysis when compared with other restriction enzymes. Sievers and Swings (2005) based their analysis
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
977
Fig. 2. SpeI PFGE distinct patterns and UPGMA dendrogram obtained from 77 AAB isolates.
on the restriction fragments obtained with the enzyme XbaI, nevertheless, our results showed that the fragments obtained with SpeI were larger that those obtained with XbaI and gave the appropriate number of PFGE bands (around 14 bands) for strain typing, and that the reproducibility of the analysis was high (85%). Many reports agree with our results in that PFGE typing by using the appropriate restriction endonucleases offers the best discriminatory power to differentiate strains of the same species (López et al., 2008; Cleenwerck and De Vos, 2008). Our results showed that the DNA extraction method used for ERIC-PCR analysis was a rapid and efficient method, suitable for this type of analysis. As mentioned above, other authors reported ERICPCR analysis as an appropriate method for strain typing of AAB (Nanda et al., 2001; González et al., 2005; Gullo et al., 2009). Nevertheless, our results showed that the clusters generated by the ERIC-PCR patterns did not correlate either with the isolate origin or the isolate species, whereas both clusters generated from the restriction PFGE patterns correlated with the origin of isolates (Group 1 included isolates from wine and spirit vinegars, belonging exclusively to the species Ga. europaeus, and Group 2 included isolates from cider and wine belonging to a variety of species). These results suggest that PFGE restriction fragment analysis is the method of choice to type AAB strains, nevertheless, this method is more time-consuming than ERIC-PCR, which could be an appropriate method for following the fermentation process of a bioreactor that has been inoculated with a specific AAB strain. The index of diversity shown by the PFGE method (28%) revealed the diversity among the AAB isolates of this study. It should be pointed out that bioreactors (17,000 l of total reaction volume) were inoculated with 12,000 l of white wine vinegar in full fermentation process from an operational tank, therefore, the diversity among isolates was due to the different type and origin of the wines and
ciders used for vinegar elaboration. Strains R1 and R75 were obtained from wine vinegars (red and white wine) and from spirit vinegars. This result indicated that both strains were well adapted (specially R1) to survive under the different conditions of the Table 2 PFGE patterns obtained from SpeI digests of a total of 77 analysed AAB vinegar isolates. Pattern name
Closely related patterns
No. of isolates
Species
Origin of vinegar
R1
25
Ga. europaeus
R3 R6 R28 R30 R33a
12 1 1 1 1 3 1 5 1 2 2 1 2 4 2 2 6 2 1 1 1 77 isolates
Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus Ga. xylinus Ga. xylinus Ga. europaeus Ga. hansenii Ga. xylinus Ga. europaeus Ga. xylinus Ga. europaeus Ga. europaeus Ga. europaeus Ga. europaeus A. pasteurianus A. pasteurianus
White and red wine and spirit White wine White wine Cider Cider White wine White wine White wine White wine and spirit Cider Cider Cider Cider Cider Cider and white wine Cider and white wine White wine White wine White wine White wine Cider White wine
R33b R33c R33d R35 R36 R39 R41 R46 R48 R49 R54a R54b R55 R70 R90a 17 patterns
R90b 5 closely related patterns
978
R. Fernández-Pérez et al. / Food Microbiology 27 (2010) 973e978
acetifying liquid and could constitute excellent starter cultures for these vinegars. Cider vinegars showed the highest variability of species (A. pasteurianus, Ga. xylinus, Ga. hansenii and Ga. europaeus) among its isolates, species identification that was determined by sequencing the 16Se23S intergenic region, and they showed as well the highest diversity of clones and mixed populations of strains (n 2 strains) growing simultaneously in all cider vinegar samples, as mentioned in Results section. This was most probably due to the high sugar content (4%) (Del Campo et al., 2008) and the low content in alcohol (6%) of ciders, whereas wine vinegars (12% ethanol) and spirit vinegars (14% ethanol) offer more stressing conditions for bacterial growth. Summarizing, this study demonstrates that strains of the species Ga. europaeus are the most frequent leader strains of vinegar fermentations by the submerged method in a variety of vinegars (wine, cider and spirit vinegars) and among them strain R1 was predominant. It shows as well that mixed populations (at least two different strains) occur in vinegars from cider and wine, whereas unique strains grow in spirit vinegars, which offer the most stressing conditions for bacterial growth. Efficient strain typing tools are essential for identification of particular strains and for preparing defined starter cultures, and our study shows that PFGE of total DNA restriction fragments with the enzyme SpeI is a reliable and discriminating method for strain typing. Acknowledgments This work was supported by grant OTEM070621 by the company Vinagrerías Riojanas S.A. and grant AGL2007-60504 of the Ministry of Research and Science of Spain and FEDER of the European Community. Rocío Fernández-Pérez was supported by a research fellowship associated to OTEM070621. References Bartowsky, E.J., Henschke, P.A., 2008. Acetic acid bacteria spoilage of bottled red wine; a review. Int. J. Food Microbiol. 125, 60e70. Bartowsky, E.J., Xia, D., Gibson, R.L., Fleet, G.H., Henschke, P.A., 2003. Spoilage of bottled red wine by acetic acid bacteria. Lett. Appl. Microbiol. 36, 307e314. Callejón, R.M., Tesfaye, W., Torija, M.J., Mas, A., Troncoso, A.M., Morales, M.L., 2008. HPLC determination of amino acids with AQC derivatization in vinegars along submerged and surface acetifications and its relation to the microbiota. Eur. Food Res. Technol. 227, 93e102. Cleenwerck, I., De Vos, P., 2008. Polyphasic taxonomy of acetic acid bacteria: an overview of the currently applied methodology. Int. J. Food Microbiol. 125, 2e14. De Vero, L., Gala, E., Gullo, M., Solieri, L., Landi, S., Giudici, P., 2006. Application of denaturing gradient gel electrophoresis (DGGE) analysis to evaluate acetic acid bacteria in traditional balsamic vinegar. Food Microbiol. 23, 809e813. De Vuyst, L., Camu, N., De Vinter, T., Vandemeulebroecke, K., Van de Perre, V., Vacanneyt, M., De Vos, P., Cleenwerck, I., 2008. Validation of the (GTG)(5)-REPPCR fingerprinting technique for rapid classification and identification of acetic acid bacteria, with a focus on isolates from Ghanaian fermented cocoa beans. Int. J. Food Microbiol. 125, 79e90.
Del Campo, G., Berregi, I., Santos, J.I., Dueñas, M., Irastorza, A., 2008. Development of alcoholic and malolactic fermentations in highly acidic and phenolic apple must. Bioresour. Technol., 2854e2863. Fernández-Pérez, R., Torres, C., Sanz, S., Ruiz-Larrea, F. Rapid molecular methods for enumeration and taxonomical identification of acetic acid bacteria responsible for submerged vinegar production, submitted for publication. González, A., Hierro, N., Poblet, M., Mas, A., Guillamón, J.M., 2005. Application of molecular methods to demonstrate species and strain evolution of acetic acid bacteria population during wine production. Int. J. Food Microbiol. 102, 295e304. González, A., Hierro, N., Poblet, M., Rozes, N., Mas, A., Guillamón, J.M., 2004. Application of molecular methods for the differentiation of acetic acid bacteria in a red wine fermentation. J. Appl. Microbiol. 96, 853e860. Gullo, M., Caggia, C., De Vero, L., Giudici, P., 2006. Characterisation of acetic acid bacteria in “traditional balsamic vinegar”. Int. J. Food Microbiol. 106, 209e212. Gullo, M., De Vero, L., Giudici, P., 2009. Succession of selected strains of Acetobacter pasteurianus and other acetic acid bacteria in traditional balsamic vinegar. Appl. Environ. Microbiol. 75, 2585e2589. Gullo, M., Giudici, P., 2008. Acetic acid bacteria in traditional balsamic vinegar: phenotypic traits relevant for starter cultures selection. Int. J. Food Microbiol. 125, 46e53. Haruta, S., Ueno, S., Egawa, I., Hashiguchi, K., Fujii, A., Nagano, M., Ishii, M., Igarashi, Y., 2006. Succession of bacterial and fungal communities during a traditional pot fermentation of rice vinegar assessed by PCR-mediated denaturing gradient gel electrophoresis. Int. J. Food Microbiol. 109, 79e89. Ilabaca, C., Navarrete, P., Mardones, P., Romero, J., Mas, A., 2008. Application of culture-independent molecular biology based methods to evaluate acetic acid bacteria diversity during vinegar processing. Int. J. Food Microbiol. 126, 245e249. López, I., Tenorio, C., Zarazaga, M., Dizy, M., Torres, C., Ruiz-Larrea, F., 2007. Evidence of mixed wild populations of Oenococcus oeni strains during wine spontaneous malolactica fermentations. Eur. Food Res. Technol. 226, 215e223. López, I., Torres, C., Ruiz-Larrea, F., 2008. Genetic typification by pulsed field gel electrophoresis (PFGE) and randomly amplified polymorphic DNA (RAPD) of wild Lactobacillus plantarum and Oenococcus oeni wine strains. Eur. Food Res. Technol. 227, 547e555. Nanda, K., Taniguchi, M., Ujike, S., Ishihara, N., Mori, H., Ono, H., Murooka, Y., 2001. Characterization of acetic acid bacteria in traditional acetic acid fermentation of rice vinegar (komesu) and unpolished rice vinegar (kurosu) produced in Japan. Appl. Environ. Microbiol. 67, 986e990. Prieto, C., Jara, C., Mas, A., Romero, J., 2007. Application of molecular methods for analysing the distribution and diversity of acetic acid bacteria in Chilean vineyards. Int. J. Food Microbiol. 115, 348e355. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. In: Molecular Cloning. A Laboratory Manual, vol. 1. CSH Press, pp. 1.26e1.28. Schüller, G., Hertel, C., Hammes, W.P., 2000. Gluconacetobacter entanii sp. nov., isolated from submerged high-acid industrial vinegar fermentations. Int. J. Syst. Evol. Microbiol. 50, 2013e2020. Sievers, M., Swings, J., 2005. Family Acetobacteraceae. In: Garrity, G.M. (Ed.)Bergey’s Manual of Systematic Bacteriology, second ed., vol. 2. Springer, New York, pp. 41e95 (Part C). Sokal, R.R., Rohlf, F.J., 1962. The comparison of dendrograms by objective methods. Taxon 11, 33e40. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., Swaminathan, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233e2239. Trcek, J., Ramus, J., Raspor, P., 1997. Phenotypic characterization and RAPD-PCR profiling of Acetobacter sp. isolated from spirit vinegar production. Food Technol. Biotechnol. 35, 63e67. Trcek, J., Raspor, P., Teuber, M., 2000. Molecular identification of Acetobacter isolates from submerged vinegar production, sequence analysis of plasmid pJK2-1 and application in the development of a cloning vector. Appl. Microbiol. Biotechnol. 53, 289e295. Versalovic, J., Koeuth, T., Lupski, J.R., 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19, 6823e6831.