- Email: [email protected]
Monohydroxylated polycyclic aromatic hydrocarbons influence spicule formation in the early development of sea urchins (Hemicentrotus pulcherrimus)
Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Monohydroxylated polycyclic aromatic hydrocarbons influence spicule formation in the early development of sea urchins (Hemicentrotus pulcherrimus) Nobuo Suzuki a,⁎, Shouzo Ogiso a, Koji Yachiguchi a, Kimi Kawabe b, Fumiya Makino b, Akira Toriba b, Masato Kiyomoto c, Toshio Sekiguchi a, Yoshiaki Tabuchi d, Takashi Kondo e, Kei-ichiro Kitamura f, Chun-Sang Hong g, Ajai K. Srivastav h, Yuji Oshima i, Atsuhiko Hattori j, Kazuichi Hayakawa b a
Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Housu-gun, Ishikawa 927-0553, Japan Faculty of Pharmaceutical Sciences, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kakuma, Ishikawa 920-1192, Japan c Marine and Coastal Research Center, Ochanomizu University, Tateyama, Chiba 294-0301, Japan d Division of Molecular Genetics Research, Life Science Research Center, University of Toyama, Toyama 930-0194, Japan e Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan f Faculty of Health Sciences, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kanazawa, Ishikawa 920-0942, Japan g Research and Business Foundation, Hankuk University of Foreign Studies, 81, Oedae-ro, Mohyeon-myeon, Cheoin-gu, Yongin-si, Gyeonggi-do 449-791, Republic of Korea h Department of Zoology, D.D.U. Gorakhpur University, Gorakhpur 273-009, India i Faculty of Agriculture, Kyushu University, Hakozaki, Fukuoka 812-8581, Japan j Department of Biology, College of Liberal Arts and Sciences, Tokyo Medical Dental University, Ichikawa, Chiba 272-0827, Japan b
a r t i c l e
i n f o
Article history: Received 11 January 2015 Received in revised form 14 February 2015 Accepted 24 February 2015 Available online 28 February 2015 Keywords: OHPAHs PAHs Spicule formation Sea urchin Embryogenesis
a b s t r a c t We previously demonstrated that monohydroxylated polycyclic aromatic hydrocarbons (OHPAHs), which are metabolites of polycyclic aromatic hydrocarbons (PAHs), act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of teleost fish. The compounds may possibly influence other calcified tissues. Thus, the present study noted the calcified spicules in sea urchins and examined the effect of both PAHs and OHPAHs on spicule formation during the embryogenesis of sea urchins. After fertilization, benz[a]anthracene (BaA) and 4-hydroxybenz[a]anthracene (4-OHBaA) were added to seawater at concentrations of 10−8 and 10−7 M and kept at 18 °C. The influence of the compound was given at the time of the pluteus larva. At this stage, the length of the spicule was significantly suppressed by 4-OHBaA (10−8 and 10−7 M). BaA (10−7 M) decreased the length of the spicule significantly, while the length did not change with BaA (10−8 M). The expression of mRNAs (spicule matrix protein and transcription factors) in the 4-OHBaA (10−7 M)-treated embryos was more strongly inhibited than were those in the BaA (10−7 M)-treated embryos. This is the first study to demonstrate that OHPAHs suppress spicule formation in sea urchins. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Polycyclic aromatic hydrocarbons (PAHs) are widespread environmental contaminants. They are produced by the incomplete combustion
Abbreviations: Hp-alx1, Hemicentrotus pulcherrimus-Aristaless-like homeobox gene 1; Hp-ets1, Hemicentrotus pulcherrimus-E26 transformation-specific gene 1; Hp-mitCOI, Hemicentrotus pulcherrimus-mitochondrial cytochrome C oxidase subunit 1 gene; 4-OHBaA, 4-hydroxybenz[a]anthracene; BaA, benz[a]anthracene; OHPAH, monohydroxylated polycyclic aromatic hydrocarbon; PAH, polycyclic aromatic hydrocarbon; PMC, primary mesenchyme cells; Hp-sm50, Hemicentrotus pulcherrimus-spicule matrix protein 50 gene. ⁎ Corresponding author at: Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Noto-cho, Ishikawa 927-0553, Japan. Tel.: +81 768 74 1151; fax: +81 768 74 1644. E-mail address: [email protected] (N. Suzuki).
http://dx.doi.org/10.1016/j.cbpc.2015.02.004 1532-0456/© 2015 Elsevier Inc. All rights reserved.
of fossil fuel, wood, and other organic materials (Lima et al., 2003) as well as cigarette smoke (Lee et al., 2002). Increased PAHs have been detected in the aquatic ecosystem; storm water runoff and atmospheric deposition of PAHs are now the largest sources of aquatic PAH contamination (Lima et al., 2003; Li and Dag, 2004). Furthermore, oil spills, such as those from the Deepwater Horizon, the Exxon Valdez, and the Nakhodka, directly induce PAH contamination in a marine environment (Bue et al., 1998; Heintz et al., 2000; Hayakawa et al., 2006; de Soysa et al., 2012). In developing teleosts, it has been reported that PAHs induce spinal deformities in herring, salmon, zebrafish, and sea bass (Barron et al., 2004; Billiard et al., 2006; Danion et al., 2011). For a long time (more than 14 years), the toxicity of PAHs originating from oil spills has affected many marine animals (for a review, see Peterson et al., 2003). In the marine environment, invertebrates have been exposed to PAHs and have accumulated PAHs in
56
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
2.2. Chemicals and solutions
their bodies (for a review, see Meador et al., 1995). In the present study, we noted that the sea urchin is an established experimental animal, and we examined the influence of PAHs on the formation of calcified spicules in sea urchins. We previously indicated that monohydroxylated polycyclic aromatic hydrocarbons (OHPAHs), which are metabolites of PAHs, act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of wrasse (seawater teleosts) as well as goldfish (freshwater teleosts) (Suzuki et al., 2009). The converted enzyme (cytochrome P450) (Billiard et al., 2006; Andreasen et al., 2007; Olsvik et al., 2011) was detected in teleosts, and OHPAHs were synthesized by cytochrome P450 in teleosts as well as in mammals (Breger et al., 1981). In sea urchins, as the cytochrome P450 family was also detected (Goldstone et al., 2007), PAHs might be converted into OHPAHs. Thus, we examined the effects of both PAHs and OHPAHs on spicule formation during the early development of sea urchins. To confirm the influence on spicule formation in sea urchins, we examined the expressions of mRNAs (Hp-sm50: Hemicentrotus pulcherrimus-spicule matrix protein 50 gene; Hp-alx1: Hemicentrotus pulcherrimus-Aristaless-like homeobox gene 1; Hp-ets1: Hemicentrotus pulcherrimus-E26 transformation-specific gene 1) related to spicule formation (Benson et al., 1987; Sucov et al., 1987; Kurokawa et al., 1999; Ettensohn et al., 2003).
Just after fertilization, the eggs were divided into 5 groups: control eggs, benz[a]anthracene (BaA) (10−8 M)-treated eggs, BaA (10−7 M)treated eggs, 4-hydroxybenz[a]anthracene (4-OHBaA) (10−8 M)-treated eggs, and 4-OHBaA (10−7 M)-treated eggs—because the EC50 of PAHs for the sea urchin embryos was around 10−6 M (Pillai et al., 2003). These eggs were kept at 18 °C and mixed lightly. In each stage—blastula, gastrula, prism larva, and pluteus larva—respective groups of embryos were fixed with a 3% formalin solution diluted by 100% sea water. To examine the expressions of mRNAs related to spicule formation, the respective embryos were frozen immediately and kept at − 80 °C until analysis.
2. Materials and methods
2.4. Changes in mRNA expression related to spicule formation in BaA- and 4-OHBaA-treated embryos
2.1. Animals and gametes Adult sea urchins (Hemicentrotus pulcherrimus) were collected from the shore of the Toyama Bay side of the Noto Peninsula. The collected sea urchins were fed marine alga and kept in an aquarium. Spawning was induced by intracoelomic injection of KCl (0.5 M). Eggs and sperm from spawning animals were collected in 50-ml beakers containing filtered seawater (FSW). Prior to fertilization, the eggs were washed twice with FSW. Around 105 sperm per ml were added to the washed eggs in 1.5 L of FSW. The eggs used in the present study reached at least 95% fertilization within 10 min post insemination. The eggs were divided into control and experimental groups.
The BaA and 4-OHBaA were purchased from the NCI Chemical Carcinogen Repository (Kansas City, MO, USA). These chemicals were initially dissolved in ethyl alcohol to obtain the initial stock solution at 1 mM. To obtain the desired final concentrations of the chemicals, the stock solution was added to the fertilized eggs, as the final ethyl alcohol concentration did not exceed 0.1% in any of the treatments. 2.3. Effects of BaA and 4-OHBaA on the early development of sea urchins
Total RNAs were prepared from embryos using a Total RNA Isolation Kit for fibrous tissue (Qiagen GmbH, Hilden, Germany). Complementary DNA synthesis was performed using a kit (Qiagen GmbH). Gene-specific primers for Hp-sm50 (5′: GCAGTCAATCCGGTCAATCA; 3′: TTGCTGGTCC ATTTCCACAA), for Hp-alx1 (5′: GCAGGACTCGACCAACAACA; 3′: TTGG CATCGCTGTCATTCTT) (AB485631), and for Hp-ets1 (5′: CTCGAATCCT CGCCAAACTC; 3′: GTATGGCATGGGAGGGTCAT) (AB008365.1) were used (T. Minokawa, Tohoku Univ., personal communication). Amplification of Hemicentrotus pulcherrimus-mitochondrial cytochrome C oxidase subunit 1 gene (Hp-mitCOI) cDNA using a primer set (5′: CCGCATTCTT GCTCCTTCTT; 3′: TGCTGGGTCGAAGAAAGTTG) (AF525453) was performed. The PCR amplification was analyzed by a real-time PCR
A
B
C
D
E
F
Fig. 1. Normal development of embryos. After fertilization, embryos were kept at 18 °C and mixed lightly. In each stage of morula (6 h after fertilization) (A), blastula (17 h after fertilization) (B), gastrula (24 h after fertilization) (C), prism larva (32 h after fertilization) (D), and pluteus larva (E: 42 h after fertilization; F: 53 h after fertilization), respective groups of embryos were fixed with 3% formalin solution diluted by 100% seawater and observed. Bar: 100 μm.
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
57
A
B
C
Fig. 2. Influences on spicule formation in control (A), BaA (10−7 M)(B)-, and 4-OHBaA (10−7 M)(C)-treated embryos. Arrowheads indicate the spicule in each embryo. Bar: 100 μm.
apparatus (Mx3000p, Agilent Technologies, CA, USA) (Suzuki et al., 2011). The annealing temperature for amplification was 60 °C. The mRNA levels were normalized to the mitCOI mRNA level.
2.6. Statistical analysis Statistical significance was assessed by one-way ANOVA followed by the Bonferroni method. The selected significance level was p b 0.05. All data are expressed as the mean ± standard error of the mean (SEM).
2.5. Detection of 4-OHBaA in the embryo of sea urchins exposed to BaA To demonstrate that BaA is converted into 4-OHBaA by an enzyme (cytochrome P450), we analyzed embryos exposed to BaA (10−7 M). Methods for detecting 4-OHBaA described in a previous study were used with some modifications (Chetiyanukornkul et al., 2006). The analyte was separated on an ODS column (Inertsil ODS-P, 250 × 4.6 mm i.d., 5 μm; GL Sciences, Tokyo, Japan) with a guard column (Inertsil ODS-P, 10 × 4.0 mm i.d., 5 μm; GL Sciences). Isocratic elution was employed using acetonitrile/water (70/30, v/v) containing 0.1% trifluoroacetic acid. The flow rate was kept at 1.0 ml/min and the column temperature was maintained at 20 °C. Fluorescence detection of 4-OHBaA was carried out at 425 nm with excitation at 282 nm. The concentration of 4-OHBaA was quantified by using deuterated 1hydroxypyrene as an internal standard.
A
3. Results 3.1. Normal development of embryos After fertilization, embryos were kept at 18 °C and mixed lightly. Six hours after fertilization, the embryos entered the morula stage (Fig. 1A). Then, the embryos were hatched at 17 h, and the swimming blastulas were observed (Fig. 1B). The early gastrula embryos were able to see at 24 h (Fig. 1C). Thereafter, prism and pluteus larva were observed at 32 h (Fig. 1D) and 42 h (Fig. 1E), respectively. Spicules are formed in the pluteus larva. In the present study, both body and post oral rods were detected in this stage (Fig. 1E). At 53 h, spicule formation had progressed (Fig. 1F).
B
Fig. 3. Influences of BaA and 4-OHBaA on spicule formation. Spicule length was measured using embryos crushed by a cover glass. The length of spicules in BaA (10−8 M)- and 4OHBaA(10−8 M)-treated embryos (A) and BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos (B) in the pluteus stage (the stage of Fig. 1E). **, ***, and **** indicate statistically significant differences at p b 0.01, p b 0.001, and p b 0.0001 respectively, from the values in the control embryos.
58
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
3.2. Influences of BaA and 4-OHBaA on spicule formation Embryos treated with BaA and 4-OHBaA were compared with control embryos. In the blastula and prism stages, there was no difference regarding external features between the control and experimental groups. In the pluteus stage (the stage of Fig. 1E), remarkable differences were observed (Fig. 2). Spicule length (body rods + post oral rods) was measured using embryos crushed by a cover glass. As a result, the length of the spicules of the 4-OHBaA (10−8 M and 10−7 M)-treated embryos decreased significantly as compared with that of the control embryos (Fig. 3A and B). In the case of BaA (10−7 M), spicule formation was significantly suppressed (Fig. 3B). Spicule length of the embryos treated with BaA (10− 8 M) was almost equal to that of the control embryos (Fig. 3A). 3.3. Changes in mRNA expression related to spicule formation in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos The mRNA expression of Hp-sm50, which is a kind of spicule matrix protein, decreased significantly with 4-OHBaA treatment (Fig. 4). The Hp-sm50 mRNA expression in embryos treated with BaA tended toward downregulation as compared with that in control embryos (Fig. 4). Hp-ets1 and Hp-alx1, which are important transcription factors related to spicule formation, were significantly suppressed with 4-OHBaA (Figs. 5 and 6). With BaA treatment, Hp-ets1 mRNA decreased significantly (Fig. 5), while Hp-alx1 mRNA tended to decrease as compared with that of control embryos (Fig. 6). 3.4. Detection of 4-OHBaA in embryos of sea urchins exposed to BaA After final sampling (53 h), all of embryos treated by BaA (10−7 M) were analyzed by high-performance liquid chromatography with fluorescence detection. As a result, 4-OHBaA (1.55 pmol) was detected in the BaA-treated embryos (Fig. 7). In the control embryos, however, 4OHBaA was not detected. 4. Discussion We demonstrated that 4-OHBaA suppressed the length of spicules in sea urchins and inhibited the expression of mRNAs such as spicule matrix proteins and transcription factors. To the best of our knowledge, this study is the first report on the effects of OHPAHs on spicule formation in
Fig. 4. Expression of Hp-sm50 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. * indicates statistically significant difference at p b 0.05 from the values in the control embryos.
Fig. 5. Expression of Hp-ets1 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. ** and *** indicate statistically significant differences at p b 0.01 and p b 0.001, respectively, from the values in the control embryos.
the sea urchin. After 53 h of incubation, 4-OHBaA was detected in the BaA-treated embryos. As PAHs are converted into OHPAHs by cytochrome P450 (Goldstone et al., 2007), we strongly suggest that 4OHBaA converted from BaA suppresses spicule formation in sea urchins. The EC50 of PAHs for sea urchin embryos was approximately 10−6 M (Pillai et al., 2003). In the present study, we examined the effects of BaA and 4-OHBaA at concentrations of 10−8 and 10−7 M on the early development of sea urchins. During the early development (blastula and prism stages) of sea urchins, we could not observe remarkable changes regarding external features between the control and experimental embryos. However, changes seemed to occur at the molecular level. It has been reported that exogastrulation in sea urchin embryos was induced with high concentrations of PAHs (around 10−6 M) (Pillai et al., 2003). In addition, high levels of nuclear accumulation of β-catenin were observed in the developing embryos with PAH treatment (around 10−6 M) (Pillai et al., 2003). Thus, we noted 2 transcription factors related to β-catenin. One factor related with β-catenin is ets1. It is known that the translocation of β-catenin into the nuclei of micromeres is responsible for the
Fig. 6. Expression of Hp-alx1 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. ** indicates statistically significant difference at p b 0.01 from the values in the control embryos.
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
59
Fig. 7. HPLC chromatogram of 4-OHBaA in BaA (10−7 M)-treated embryos. The arrow indicates the peak of 4-OHBaA.
initial specification of a large micromere lineage (for a review, see Brandhorst and Klein, 2002). Large micromeres are autonomously specified and differentiate into skeletogenic primary mesenchyme cells (PMC) that express sm50 (spicule matrix protein) (Benson et al., 1987; Sucov et al., 1987). Overexpression of ets1 enhanced sm50, while expression of a dominant negative ets1 repressed sm50 expression and spicule formation (Kurokawa et al., 1999). In the present study, both Hp-ets1 and Hp-sm50 mRNA expressions in 4-OHBaAtreated embryos decreased significantly. The degree of the restraint is larger in Hp-ets1 than in Hp-sm50, indicating that 4-OHBaA mainly suppressed the transcription factor and inhibited spicule formation. In the case of BaA, Hp-est1 mRNA expression in BaA-treated embryos decreased significantly while Hp-sm50 mRNA expression tended to decrease with BaA treatment. The other transcription factor is alx1. Alx1 protein is required for an early step in the specification of large micromere lineage and for the transfating of non-micromere-derived cells to a PMC fate (Ettensohn et al., 2003). By alx1 knockdowns, PMC-specific mRNAs, including biomineralization genes, were downregulated (Rafiq et al., 2012). In Hp-alx1 as well as in Hp-ets1, mRNA expression in 4-OHBaA-treated embryos decreased significantly. We strongly suggest that 4-OHBaA mainly suppresses the transcription factor and inhibits spicule formation. We previously indicated that OHPAHs act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of wrasse (seawater teleosts) (Suzuki et al., 2009). The present study also demonstrates that the degree of toxicity for sea urchins is higher with OHPAHs than with PAHs. There have been many studies regarding the toxicity of PAHs in marine animals (Meador et al., 1995; Peterson et al., 2003; Barron et al., 2004; Billiard et al., 2006; Danion et al., 2011). However, the toxicity of OHPAHs in marine animals has not been investigated until now. We should pay attention to OHPAHs because marine organisms have been exposed to and accumulated PAHs in their bodies (for a review, see Meador et al., 1995). In the Mediterranean mussel species Mytilus galloprovincialis, it has been reported that the uptake rate constant of BaA is higher than the depuration rate constant (Yakan et al., 2011). The OHPAHs that occurred with accumulated PAHs may have toxic influences on aquatic animals, even though the PAH level in the aquatic environment is low. Acknowledgments We are grateful to Dr. Takuya Minokawa (Research Center for Marine Biology, Graduate School of Life Sciences, Tohoku University) for information regarding PCR primers in the mRNA expression analysis.
This study was supported in part by grants to N.S. (Grant-in-Aid for Scientific Research [C] No. 24620004 by JSPS), to T.S. (Grant-in-Aid for Young Scientists [B] No. 40378568 by JSPS), to Y.T. (Grant-in-Aid for Scientific Research [B] No. 24310046 by JSPS), to K.K. (Grant-in-Aid for Scientific Research [C] No. 24500848 by JSPS), to A.H. (Grant-in-Aid for Scientific Research [C] No. 24570068 by JSPS), and to K.H. (Grantin-Aid for Exploratory Research No. 24651044 by JSPS). This study was performed under the cooperative research program of the Institute of Nature and Environmental Technology, Kanazawa University (Accept No. 1). References Andreasen, E.A., Mathew, L.K., Löhr, C.V., Hasson, R., Tanguay, R.L., 2007. Aryl hydrocarbon receptor activation impairs extracellular matrix remodeling during zebrafish fin regeneration. Toxicol. Sci. 95, 215–226. Barron, M.G., Carls, M.G., Heintz, R., Rice, S.D., 2004. Evaluation of fish early life-stage toxicity models of chronic embryonic exposures to complex polycyclic aromatic hydrocarbon mixtures. Toxicol. Sci. 78, 60–67. Benson, S., Sucov, H., Stephens, L., Davidson, E., Wilt, F., 1987. A lineage-specific gene encoding a major matrix protein of the sea urchin embryo spicule. I. Authentication of the cloned gene and its developmental expression. Dev. Biol. 120, 499–506. Billiard, S.M., Timme-Laragy, A.R., Wassenberg, D.M., Cockman, C., Di Giulio, R.T., 2006. The role of the aryl hydrocarbon receptor pathway in mediating synergistic developmental toxicity of polycyclic aromatic hydrocarbons to zebrafish. Toxicol. Sci. 92, 526–536. Brandhorst, B.P., Klein, W.H., 2002. Molecular patterning along the sea urchin animalvegetal axis. Int. Rev. Cytol. 213, 183–232. Breger, R.K., Franklin, R.B., Lech, J.J., 1981. Metabolism of 2-methylnaphthalene to isomeric dihydrodiols by hepatic microsomes of rat and rainbow trout. Drug Metab. Dispos. 9, 88–93. Bue, B.G., Sharr, S., Seeb, J.E., 1998. Evidence of damage to pink salmon populations inhabiting prince William Sound, Alaska, two generations after the Exxon Valdez oil spill. Trans. Am. Fish. Soc. 127, 35–43. Chetiyanukornkul, T., Toriba, A., Kameda, T., Tang, N., Hayakawa, K., 2006. Simultaneous determination of urinary hydroxylated metabolites of naphthalene, fluorene, phenanthrene, fluoranthene and pyrene as multiple biomarkers of exposure to polycyclic aromatic hydrocarbons. Anal. Bioanal. Chem. 386, 712–718. Danion, M., Deschamps, M.H., Thomas-Guyon, H., Bado-Nilles, A., Le Floch, S., Quentel, C., Sire, J.Y., 2011. Effect of an experimental oil spill on vertebral bone tissue quality in European sea bass (Dicentrarchus labrax L.). Ecotoxicol. Environ. Saf. 74, 1888–1895. de Soysa, T.Y., Ulrich, A., Friedrich, T., Pite, D., Compton, S.L., Ok, D., Bernardos, R.L., Downes, G.B., Hsieh, S., Stein, R., Lagdameo, M.C., Halvorsen, K., Kesich, L.R., Barresi, M.J., 2012. Macondo crude oil from the Deepwater Horizon oil spill disrupts specific developmental processes during zebrafish embryogenesis. BMC Biol. 10, 40. http:// dx.doi.org/10.1186/1741-7007-10-40. Ettensohn, C.A., Illies, M.R., Oliveri, P., De Jong, D.L., 2003. Alx1, a member of the Cart1/ Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo. Development 130, 2917–2928. Goldstone, J.V., Goldstone, H.M.H., Morrison, A.M., Tarrant, A., Kern, S.E., Woodin, B.R., Stegeman, J.J., 2007. Cytochrome P450 1 genes in early deuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog): origin and diversification of the CYP1 gene family. Mol. Biol. Evol. 24, 2619–2631.
60
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
Hayakawa, K., Nomura, M., Nakagawa, T., Oguri, S., Kawanishi, T., Toriba, A., Kizu, R., Sakaguchi, T., Tamiya, E., 2006. Damage to and recovery of coastlines polluted with C-heavy oil spilled from the Nakhodka. Water Res. 40, 981–989. Heintz, R.A., Rice, S.D., Wertheimer, A.C., Bradshaw, R.F., Thrower, F.P., Joyce, J.E., Short, J.W., 2000. Delayed effects on growth and marine survival of pink salmon Oncorhynchus gorbuscha after exposure to crude oil during embryonic development. Mar. Ecol. Prog. Ser. 208, 205–216. Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya, S., Shimada, H., Akasaka, K., 1999. HpEts, an ets-related transcription factor implicated in primary mesenchyme cell differentiation in the sea urchin embryo. Mech. Dev. 80, 41–52. Lee, L.L., Lee, J.S.C., Waldman, S.D., Casper, R.F., Grynpas, M.D., 2002. Polycyclic aromatic hydrocarbons present in cigarette smoke cause bone loss in an ovariectomized rat model. Bone 30, 917–923. Li, D., Dag, D., 2004. Ocean pollution from land-based sources: east China Sea, China. Ambio 33, 107–113. Lima, A.L.C., Eglinton, T.I., Reddy, C.M., 2003. High-resolution record of pyrogenic polycyclic aromatic hydrocarbon deposition during the 20th century. Environ. Sci. Technol. 37, 53–61. Meador, J.P., Stein, J.E., Reichert, W.L., Varanasi, U., 1995. Bioaccumulation of polycyclic aromatic hydrocarbons by marine organisms. Rev. Environ. Contam. Toxicol. 143, 79–165. Olsvik, P.A., Brattås, M., Lie, K.K., Goksøyr, A., 2011. Transcriptional responses in juvenile Atlantic cod (Gadus morhua) after exposure to mercury-contaminated sediments obtained near the wreck of the German WW2 submarine U-864, and from Bergen Harbor, Western Norway. Chemosphere 83, 552–563.
Peterson, C.H., Rice, S.D., Short, J.W., Esler, D., Bodkin, J.L., Ballachey, B.E., Irons, D.B., 2003. Long-term ecosystem response to the Exxon Valdez oil spill. Science 302, 2082–2086. Pillai, M.C., Vines, C.A., Wikramanayake, A.H., Cherr, G.N., 2003. Polycyclic aromatic hydrocarbons disrupt axial development in sea urchin embryos through a β-catenin dependent pathway. Toxicology 186, 93–108. Rafiq, K., Cheers, M.S., Ettensohn, C.A., 2012. The genomic regulatory control of skeletal morphogenesis in the sea urchin. Development 139, 579–590. Sucov, H.M., Benson, S., Robinson, J.J., Britten, R.J., Wilt, F., Davidson, E.H., 1987. A lineagespecific gene encoding a major matrix protein of the sea urchin embryo spicule. II. Structure of the gene and derived sequence of the protein. Dev. Biol. 120, 507–519. Suzuki, N., Hayakawa, K., Kameda, T., Toriba, A., Tang, N., Tabata, M.J., Takada, K., Wada, S., Omori, K., Srivastav, A.K., Mishima, H., Hattori, A., 2009. Monohydroxylated polycyclic aromatic hydrocarbons inhibit both osteoclastic and osteoblastic activities in teleost scales. Life Sci. 84, 482–488. Suzuki, N., Danks, J.A., Maruyama, Y., Ikegame, M., Sasayama, Y., Hattori, A., Nakamura, M., Tabata, M.J., Yamamoto, T., Furuya, R., Saijoh, K., Mishima, H., Srivastav, A.K., Furusawa, Y., Kondo, T., Tabuchi, Y., Takasaki, I., Chowdhury, V.S., Hayakawa, K., Martin, T.J., 2011. Parathyroid hormone 1 (1-34) acts on the scales and involves calcium metabolism in goldfish. Bone 48, 1186–1193. Yakan, S.D., Henkelmann, B., Schramm, K.W., Okay, O.S., 2011. Bioaccumulation depuration kinetics and effects of benzo(a)anthracene on Mytilus galloprovincialis. Mar. Pollut. Bull. 63, 471–476.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Monohydroxylated polycyclic aromatic hydrocarbons influence spicule formation in the early development of sea urchins (Hemicentrotus pulcherrimus) Nobuo Suzuki a,⁎, Shouzo Ogiso a, Koji Yachiguchi a, Kimi Kawabe b, Fumiya Makino b, Akira Toriba b, Masato Kiyomoto c, Toshio Sekiguchi a, Yoshiaki Tabuchi d, Takashi Kondo e, Kei-ichiro Kitamura f, Chun-Sang Hong g, Ajai K. Srivastav h, Yuji Oshima i, Atsuhiko Hattori j, Kazuichi Hayakawa b a
Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Housu-gun, Ishikawa 927-0553, Japan Faculty of Pharmaceutical Sciences, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kakuma, Ishikawa 920-1192, Japan c Marine and Coastal Research Center, Ochanomizu University, Tateyama, Chiba 294-0301, Japan d Division of Molecular Genetics Research, Life Science Research Center, University of Toyama, Toyama 930-0194, Japan e Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan f Faculty of Health Sciences, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kanazawa, Ishikawa 920-0942, Japan g Research and Business Foundation, Hankuk University of Foreign Studies, 81, Oedae-ro, Mohyeon-myeon, Cheoin-gu, Yongin-si, Gyeonggi-do 449-791, Republic of Korea h Department of Zoology, D.D.U. Gorakhpur University, Gorakhpur 273-009, India i Faculty of Agriculture, Kyushu University, Hakozaki, Fukuoka 812-8581, Japan j Department of Biology, College of Liberal Arts and Sciences, Tokyo Medical Dental University, Ichikawa, Chiba 272-0827, Japan b
a r t i c l e
i n f o
Article history: Received 11 January 2015 Received in revised form 14 February 2015 Accepted 24 February 2015 Available online 28 February 2015 Keywords: OHPAHs PAHs Spicule formation Sea urchin Embryogenesis
a b s t r a c t We previously demonstrated that monohydroxylated polycyclic aromatic hydrocarbons (OHPAHs), which are metabolites of polycyclic aromatic hydrocarbons (PAHs), act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of teleost fish. The compounds may possibly influence other calcified tissues. Thus, the present study noted the calcified spicules in sea urchins and examined the effect of both PAHs and OHPAHs on spicule formation during the embryogenesis of sea urchins. After fertilization, benz[a]anthracene (BaA) and 4-hydroxybenz[a]anthracene (4-OHBaA) were added to seawater at concentrations of 10−8 and 10−7 M and kept at 18 °C. The influence of the compound was given at the time of the pluteus larva. At this stage, the length of the spicule was significantly suppressed by 4-OHBaA (10−8 and 10−7 M). BaA (10−7 M) decreased the length of the spicule significantly, while the length did not change with BaA (10−8 M). The expression of mRNAs (spicule matrix protein and transcription factors) in the 4-OHBaA (10−7 M)-treated embryos was more strongly inhibited than were those in the BaA (10−7 M)-treated embryos. This is the first study to demonstrate that OHPAHs suppress spicule formation in sea urchins. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Polycyclic aromatic hydrocarbons (PAHs) are widespread environmental contaminants. They are produced by the incomplete combustion
Abbreviations: Hp-alx1, Hemicentrotus pulcherrimus-Aristaless-like homeobox gene 1; Hp-ets1, Hemicentrotus pulcherrimus-E26 transformation-specific gene 1; Hp-mitCOI, Hemicentrotus pulcherrimus-mitochondrial cytochrome C oxidase subunit 1 gene; 4-OHBaA, 4-hydroxybenz[a]anthracene; BaA, benz[a]anthracene; OHPAH, monohydroxylated polycyclic aromatic hydrocarbon; PAH, polycyclic aromatic hydrocarbon; PMC, primary mesenchyme cells; Hp-sm50, Hemicentrotus pulcherrimus-spicule matrix protein 50 gene. ⁎ Corresponding author at: Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Noto-cho, Ishikawa 927-0553, Japan. Tel.: +81 768 74 1151; fax: +81 768 74 1644. E-mail address: [email protected] (N. Suzuki).
http://dx.doi.org/10.1016/j.cbpc.2015.02.004 1532-0456/© 2015 Elsevier Inc. All rights reserved.
of fossil fuel, wood, and other organic materials (Lima et al., 2003) as well as cigarette smoke (Lee et al., 2002). Increased PAHs have been detected in the aquatic ecosystem; storm water runoff and atmospheric deposition of PAHs are now the largest sources of aquatic PAH contamination (Lima et al., 2003; Li and Dag, 2004). Furthermore, oil spills, such as those from the Deepwater Horizon, the Exxon Valdez, and the Nakhodka, directly induce PAH contamination in a marine environment (Bue et al., 1998; Heintz et al., 2000; Hayakawa et al., 2006; de Soysa et al., 2012). In developing teleosts, it has been reported that PAHs induce spinal deformities in herring, salmon, zebrafish, and sea bass (Barron et al., 2004; Billiard et al., 2006; Danion et al., 2011). For a long time (more than 14 years), the toxicity of PAHs originating from oil spills has affected many marine animals (for a review, see Peterson et al., 2003). In the marine environment, invertebrates have been exposed to PAHs and have accumulated PAHs in
56
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
2.2. Chemicals and solutions
their bodies (for a review, see Meador et al., 1995). In the present study, we noted that the sea urchin is an established experimental animal, and we examined the influence of PAHs on the formation of calcified spicules in sea urchins. We previously indicated that monohydroxylated polycyclic aromatic hydrocarbons (OHPAHs), which are metabolites of PAHs, act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of wrasse (seawater teleosts) as well as goldfish (freshwater teleosts) (Suzuki et al., 2009). The converted enzyme (cytochrome P450) (Billiard et al., 2006; Andreasen et al., 2007; Olsvik et al., 2011) was detected in teleosts, and OHPAHs were synthesized by cytochrome P450 in teleosts as well as in mammals (Breger et al., 1981). In sea urchins, as the cytochrome P450 family was also detected (Goldstone et al., 2007), PAHs might be converted into OHPAHs. Thus, we examined the effects of both PAHs and OHPAHs on spicule formation during the early development of sea urchins. To confirm the influence on spicule formation in sea urchins, we examined the expressions of mRNAs (Hp-sm50: Hemicentrotus pulcherrimus-spicule matrix protein 50 gene; Hp-alx1: Hemicentrotus pulcherrimus-Aristaless-like homeobox gene 1; Hp-ets1: Hemicentrotus pulcherrimus-E26 transformation-specific gene 1) related to spicule formation (Benson et al., 1987; Sucov et al., 1987; Kurokawa et al., 1999; Ettensohn et al., 2003).
Just after fertilization, the eggs were divided into 5 groups: control eggs, benz[a]anthracene (BaA) (10−8 M)-treated eggs, BaA (10−7 M)treated eggs, 4-hydroxybenz[a]anthracene (4-OHBaA) (10−8 M)-treated eggs, and 4-OHBaA (10−7 M)-treated eggs—because the EC50 of PAHs for the sea urchin embryos was around 10−6 M (Pillai et al., 2003). These eggs were kept at 18 °C and mixed lightly. In each stage—blastula, gastrula, prism larva, and pluteus larva—respective groups of embryos were fixed with a 3% formalin solution diluted by 100% sea water. To examine the expressions of mRNAs related to spicule formation, the respective embryos were frozen immediately and kept at − 80 °C until analysis.
2. Materials and methods
2.4. Changes in mRNA expression related to spicule formation in BaA- and 4-OHBaA-treated embryos
2.1. Animals and gametes Adult sea urchins (Hemicentrotus pulcherrimus) were collected from the shore of the Toyama Bay side of the Noto Peninsula. The collected sea urchins were fed marine alga and kept in an aquarium. Spawning was induced by intracoelomic injection of KCl (0.5 M). Eggs and sperm from spawning animals were collected in 50-ml beakers containing filtered seawater (FSW). Prior to fertilization, the eggs were washed twice with FSW. Around 105 sperm per ml were added to the washed eggs in 1.5 L of FSW. The eggs used in the present study reached at least 95% fertilization within 10 min post insemination. The eggs were divided into control and experimental groups.
The BaA and 4-OHBaA were purchased from the NCI Chemical Carcinogen Repository (Kansas City, MO, USA). These chemicals were initially dissolved in ethyl alcohol to obtain the initial stock solution at 1 mM. To obtain the desired final concentrations of the chemicals, the stock solution was added to the fertilized eggs, as the final ethyl alcohol concentration did not exceed 0.1% in any of the treatments. 2.3. Effects of BaA and 4-OHBaA on the early development of sea urchins
Total RNAs were prepared from embryos using a Total RNA Isolation Kit for fibrous tissue (Qiagen GmbH, Hilden, Germany). Complementary DNA synthesis was performed using a kit (Qiagen GmbH). Gene-specific primers for Hp-sm50 (5′: GCAGTCAATCCGGTCAATCA; 3′: TTGCTGGTCC ATTTCCACAA), for Hp-alx1 (5′: GCAGGACTCGACCAACAACA; 3′: TTGG CATCGCTGTCATTCTT) (AB485631), and for Hp-ets1 (5′: CTCGAATCCT CGCCAAACTC; 3′: GTATGGCATGGGAGGGTCAT) (AB008365.1) were used (T. Minokawa, Tohoku Univ., personal communication). Amplification of Hemicentrotus pulcherrimus-mitochondrial cytochrome C oxidase subunit 1 gene (Hp-mitCOI) cDNA using a primer set (5′: CCGCATTCTT GCTCCTTCTT; 3′: TGCTGGGTCGAAGAAAGTTG) (AF525453) was performed. The PCR amplification was analyzed by a real-time PCR
A
B
C
D
E
F
Fig. 1. Normal development of embryos. After fertilization, embryos were kept at 18 °C and mixed lightly. In each stage of morula (6 h after fertilization) (A), blastula (17 h after fertilization) (B), gastrula (24 h after fertilization) (C), prism larva (32 h after fertilization) (D), and pluteus larva (E: 42 h after fertilization; F: 53 h after fertilization), respective groups of embryos were fixed with 3% formalin solution diluted by 100% seawater and observed. Bar: 100 μm.
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
57
A
B
C
Fig. 2. Influences on spicule formation in control (A), BaA (10−7 M)(B)-, and 4-OHBaA (10−7 M)(C)-treated embryos. Arrowheads indicate the spicule in each embryo. Bar: 100 μm.
apparatus (Mx3000p, Agilent Technologies, CA, USA) (Suzuki et al., 2011). The annealing temperature for amplification was 60 °C. The mRNA levels were normalized to the mitCOI mRNA level.
2.6. Statistical analysis Statistical significance was assessed by one-way ANOVA followed by the Bonferroni method. The selected significance level was p b 0.05. All data are expressed as the mean ± standard error of the mean (SEM).
2.5. Detection of 4-OHBaA in the embryo of sea urchins exposed to BaA To demonstrate that BaA is converted into 4-OHBaA by an enzyme (cytochrome P450), we analyzed embryos exposed to BaA (10−7 M). Methods for detecting 4-OHBaA described in a previous study were used with some modifications (Chetiyanukornkul et al., 2006). The analyte was separated on an ODS column (Inertsil ODS-P, 250 × 4.6 mm i.d., 5 μm; GL Sciences, Tokyo, Japan) with a guard column (Inertsil ODS-P, 10 × 4.0 mm i.d., 5 μm; GL Sciences). Isocratic elution was employed using acetonitrile/water (70/30, v/v) containing 0.1% trifluoroacetic acid. The flow rate was kept at 1.0 ml/min and the column temperature was maintained at 20 °C. Fluorescence detection of 4-OHBaA was carried out at 425 nm with excitation at 282 nm. The concentration of 4-OHBaA was quantified by using deuterated 1hydroxypyrene as an internal standard.
A
3. Results 3.1. Normal development of embryos After fertilization, embryos were kept at 18 °C and mixed lightly. Six hours after fertilization, the embryos entered the morula stage (Fig. 1A). Then, the embryos were hatched at 17 h, and the swimming blastulas were observed (Fig. 1B). The early gastrula embryos were able to see at 24 h (Fig. 1C). Thereafter, prism and pluteus larva were observed at 32 h (Fig. 1D) and 42 h (Fig. 1E), respectively. Spicules are formed in the pluteus larva. In the present study, both body and post oral rods were detected in this stage (Fig. 1E). At 53 h, spicule formation had progressed (Fig. 1F).
B
Fig. 3. Influences of BaA and 4-OHBaA on spicule formation. Spicule length was measured using embryos crushed by a cover glass. The length of spicules in BaA (10−8 M)- and 4OHBaA(10−8 M)-treated embryos (A) and BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos (B) in the pluteus stage (the stage of Fig. 1E). **, ***, and **** indicate statistically significant differences at p b 0.01, p b 0.001, and p b 0.0001 respectively, from the values in the control embryos.
58
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
3.2. Influences of BaA and 4-OHBaA on spicule formation Embryos treated with BaA and 4-OHBaA were compared with control embryos. In the blastula and prism stages, there was no difference regarding external features between the control and experimental groups. In the pluteus stage (the stage of Fig. 1E), remarkable differences were observed (Fig. 2). Spicule length (body rods + post oral rods) was measured using embryos crushed by a cover glass. As a result, the length of the spicules of the 4-OHBaA (10−8 M and 10−7 M)-treated embryos decreased significantly as compared with that of the control embryos (Fig. 3A and B). In the case of BaA (10−7 M), spicule formation was significantly suppressed (Fig. 3B). Spicule length of the embryos treated with BaA (10− 8 M) was almost equal to that of the control embryos (Fig. 3A). 3.3. Changes in mRNA expression related to spicule formation in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos The mRNA expression of Hp-sm50, which is a kind of spicule matrix protein, decreased significantly with 4-OHBaA treatment (Fig. 4). The Hp-sm50 mRNA expression in embryos treated with BaA tended toward downregulation as compared with that in control embryos (Fig. 4). Hp-ets1 and Hp-alx1, which are important transcription factors related to spicule formation, were significantly suppressed with 4-OHBaA (Figs. 5 and 6). With BaA treatment, Hp-ets1 mRNA decreased significantly (Fig. 5), while Hp-alx1 mRNA tended to decrease as compared with that of control embryos (Fig. 6). 3.4. Detection of 4-OHBaA in embryos of sea urchins exposed to BaA After final sampling (53 h), all of embryos treated by BaA (10−7 M) were analyzed by high-performance liquid chromatography with fluorescence detection. As a result, 4-OHBaA (1.55 pmol) was detected in the BaA-treated embryos (Fig. 7). In the control embryos, however, 4OHBaA was not detected. 4. Discussion We demonstrated that 4-OHBaA suppressed the length of spicules in sea urchins and inhibited the expression of mRNAs such as spicule matrix proteins and transcription factors. To the best of our knowledge, this study is the first report on the effects of OHPAHs on spicule formation in
Fig. 4. Expression of Hp-sm50 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. * indicates statistically significant difference at p b 0.05 from the values in the control embryos.
Fig. 5. Expression of Hp-ets1 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. ** and *** indicate statistically significant differences at p b 0.01 and p b 0.001, respectively, from the values in the control embryos.
the sea urchin. After 53 h of incubation, 4-OHBaA was detected in the BaA-treated embryos. As PAHs are converted into OHPAHs by cytochrome P450 (Goldstone et al., 2007), we strongly suggest that 4OHBaA converted from BaA suppresses spicule formation in sea urchins. The EC50 of PAHs for sea urchin embryos was approximately 10−6 M (Pillai et al., 2003). In the present study, we examined the effects of BaA and 4-OHBaA at concentrations of 10−8 and 10−7 M on the early development of sea urchins. During the early development (blastula and prism stages) of sea urchins, we could not observe remarkable changes regarding external features between the control and experimental embryos. However, changes seemed to occur at the molecular level. It has been reported that exogastrulation in sea urchin embryos was induced with high concentrations of PAHs (around 10−6 M) (Pillai et al., 2003). In addition, high levels of nuclear accumulation of β-catenin were observed in the developing embryos with PAH treatment (around 10−6 M) (Pillai et al., 2003). Thus, we noted 2 transcription factors related to β-catenin. One factor related with β-catenin is ets1. It is known that the translocation of β-catenin into the nuclei of micromeres is responsible for the
Fig. 6. Expression of Hp-alx1 mRNA in BaA (10−7 M)- and 4-OHBaA (10−7 M)-treated embryos of sea urchins. ** indicates statistically significant difference at p b 0.01 from the values in the control embryos.
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
59
Fig. 7. HPLC chromatogram of 4-OHBaA in BaA (10−7 M)-treated embryos. The arrow indicates the peak of 4-OHBaA.
initial specification of a large micromere lineage (for a review, see Brandhorst and Klein, 2002). Large micromeres are autonomously specified and differentiate into skeletogenic primary mesenchyme cells (PMC) that express sm50 (spicule matrix protein) (Benson et al., 1987; Sucov et al., 1987). Overexpression of ets1 enhanced sm50, while expression of a dominant negative ets1 repressed sm50 expression and spicule formation (Kurokawa et al., 1999). In the present study, both Hp-ets1 and Hp-sm50 mRNA expressions in 4-OHBaAtreated embryos decreased significantly. The degree of the restraint is larger in Hp-ets1 than in Hp-sm50, indicating that 4-OHBaA mainly suppressed the transcription factor and inhibited spicule formation. In the case of BaA, Hp-est1 mRNA expression in BaA-treated embryos decreased significantly while Hp-sm50 mRNA expression tended to decrease with BaA treatment. The other transcription factor is alx1. Alx1 protein is required for an early step in the specification of large micromere lineage and for the transfating of non-micromere-derived cells to a PMC fate (Ettensohn et al., 2003). By alx1 knockdowns, PMC-specific mRNAs, including biomineralization genes, were downregulated (Rafiq et al., 2012). In Hp-alx1 as well as in Hp-ets1, mRNA expression in 4-OHBaA-treated embryos decreased significantly. We strongly suggest that 4-OHBaA mainly suppresses the transcription factor and inhibits spicule formation. We previously indicated that OHPAHs act on calcified tissue and suppress osteoblastic and osteoclastic activity in the scales of wrasse (seawater teleosts) (Suzuki et al., 2009). The present study also demonstrates that the degree of toxicity for sea urchins is higher with OHPAHs than with PAHs. There have been many studies regarding the toxicity of PAHs in marine animals (Meador et al., 1995; Peterson et al., 2003; Barron et al., 2004; Billiard et al., 2006; Danion et al., 2011). However, the toxicity of OHPAHs in marine animals has not been investigated until now. We should pay attention to OHPAHs because marine organisms have been exposed to and accumulated PAHs in their bodies (for a review, see Meador et al., 1995). In the Mediterranean mussel species Mytilus galloprovincialis, it has been reported that the uptake rate constant of BaA is higher than the depuration rate constant (Yakan et al., 2011). The OHPAHs that occurred with accumulated PAHs may have toxic influences on aquatic animals, even though the PAH level in the aquatic environment is low. Acknowledgments We are grateful to Dr. Takuya Minokawa (Research Center for Marine Biology, Graduate School of Life Sciences, Tohoku University) for information regarding PCR primers in the mRNA expression analysis.
This study was supported in part by grants to N.S. (Grant-in-Aid for Scientific Research [C] No. 24620004 by JSPS), to T.S. (Grant-in-Aid for Young Scientists [B] No. 40378568 by JSPS), to Y.T. (Grant-in-Aid for Scientific Research [B] No. 24310046 by JSPS), to K.K. (Grant-in-Aid for Scientific Research [C] No. 24500848 by JSPS), to A.H. (Grant-in-Aid for Scientific Research [C] No. 24570068 by JSPS), and to K.H. (Grantin-Aid for Exploratory Research No. 24651044 by JSPS). This study was performed under the cooperative research program of the Institute of Nature and Environmental Technology, Kanazawa University (Accept No. 1). References Andreasen, E.A., Mathew, L.K., Löhr, C.V., Hasson, R., Tanguay, R.L., 2007. Aryl hydrocarbon receptor activation impairs extracellular matrix remodeling during zebrafish fin regeneration. Toxicol. Sci. 95, 215–226. Barron, M.G., Carls, M.G., Heintz, R., Rice, S.D., 2004. Evaluation of fish early life-stage toxicity models of chronic embryonic exposures to complex polycyclic aromatic hydrocarbon mixtures. Toxicol. Sci. 78, 60–67. Benson, S., Sucov, H., Stephens, L., Davidson, E., Wilt, F., 1987. A lineage-specific gene encoding a major matrix protein of the sea urchin embryo spicule. I. Authentication of the cloned gene and its developmental expression. Dev. Biol. 120, 499–506. Billiard, S.M., Timme-Laragy, A.R., Wassenberg, D.M., Cockman, C., Di Giulio, R.T., 2006. The role of the aryl hydrocarbon receptor pathway in mediating synergistic developmental toxicity of polycyclic aromatic hydrocarbons to zebrafish. Toxicol. Sci. 92, 526–536. Brandhorst, B.P., Klein, W.H., 2002. Molecular patterning along the sea urchin animalvegetal axis. Int. Rev. Cytol. 213, 183–232. Breger, R.K., Franklin, R.B., Lech, J.J., 1981. Metabolism of 2-methylnaphthalene to isomeric dihydrodiols by hepatic microsomes of rat and rainbow trout. Drug Metab. Dispos. 9, 88–93. Bue, B.G., Sharr, S., Seeb, J.E., 1998. Evidence of damage to pink salmon populations inhabiting prince William Sound, Alaska, two generations after the Exxon Valdez oil spill. Trans. Am. Fish. Soc. 127, 35–43. Chetiyanukornkul, T., Toriba, A., Kameda, T., Tang, N., Hayakawa, K., 2006. Simultaneous determination of urinary hydroxylated metabolites of naphthalene, fluorene, phenanthrene, fluoranthene and pyrene as multiple biomarkers of exposure to polycyclic aromatic hydrocarbons. Anal. Bioanal. Chem. 386, 712–718. Danion, M., Deschamps, M.H., Thomas-Guyon, H., Bado-Nilles, A., Le Floch, S., Quentel, C., Sire, J.Y., 2011. Effect of an experimental oil spill on vertebral bone tissue quality in European sea bass (Dicentrarchus labrax L.). Ecotoxicol. Environ. Saf. 74, 1888–1895. de Soysa, T.Y., Ulrich, A., Friedrich, T., Pite, D., Compton, S.L., Ok, D., Bernardos, R.L., Downes, G.B., Hsieh, S., Stein, R., Lagdameo, M.C., Halvorsen, K., Kesich, L.R., Barresi, M.J., 2012. Macondo crude oil from the Deepwater Horizon oil spill disrupts specific developmental processes during zebrafish embryogenesis. BMC Biol. 10, 40. http:// dx.doi.org/10.1186/1741-7007-10-40. Ettensohn, C.A., Illies, M.R., Oliveri, P., De Jong, D.L., 2003. Alx1, a member of the Cart1/ Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo. Development 130, 2917–2928. Goldstone, J.V., Goldstone, H.M.H., Morrison, A.M., Tarrant, A., Kern, S.E., Woodin, B.R., Stegeman, J.J., 2007. Cytochrome P450 1 genes in early deuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog): origin and diversification of the CYP1 gene family. Mol. Biol. Evol. 24, 2619–2631.
60
N. Suzuki et al. / Comparative Biochemistry and Physiology, Part C 171 (2015) 55–60
Hayakawa, K., Nomura, M., Nakagawa, T., Oguri, S., Kawanishi, T., Toriba, A., Kizu, R., Sakaguchi, T., Tamiya, E., 2006. Damage to and recovery of coastlines polluted with C-heavy oil spilled from the Nakhodka. Water Res. 40, 981–989. Heintz, R.A., Rice, S.D., Wertheimer, A.C., Bradshaw, R.F., Thrower, F.P., Joyce, J.E., Short, J.W., 2000. Delayed effects on growth and marine survival of pink salmon Oncorhynchus gorbuscha after exposure to crude oil during embryonic development. Mar. Ecol. Prog. Ser. 208, 205–216. Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya, S., Shimada, H., Akasaka, K., 1999. HpEts, an ets-related transcription factor implicated in primary mesenchyme cell differentiation in the sea urchin embryo. Mech. Dev. 80, 41–52. Lee, L.L., Lee, J.S.C., Waldman, S.D., Casper, R.F., Grynpas, M.D., 2002. Polycyclic aromatic hydrocarbons present in cigarette smoke cause bone loss in an ovariectomized rat model. Bone 30, 917–923. Li, D., Dag, D., 2004. Ocean pollution from land-based sources: east China Sea, China. Ambio 33, 107–113. Lima, A.L.C., Eglinton, T.I., Reddy, C.M., 2003. High-resolution record of pyrogenic polycyclic aromatic hydrocarbon deposition during the 20th century. Environ. Sci. Technol. 37, 53–61. Meador, J.P., Stein, J.E., Reichert, W.L., Varanasi, U., 1995. Bioaccumulation of polycyclic aromatic hydrocarbons by marine organisms. Rev. Environ. Contam. Toxicol. 143, 79–165. Olsvik, P.A., Brattås, M., Lie, K.K., Goksøyr, A., 2011. Transcriptional responses in juvenile Atlantic cod (Gadus morhua) after exposure to mercury-contaminated sediments obtained near the wreck of the German WW2 submarine U-864, and from Bergen Harbor, Western Norway. Chemosphere 83, 552–563.
Peterson, C.H., Rice, S.D., Short, J.W., Esler, D., Bodkin, J.L., Ballachey, B.E., Irons, D.B., 2003. Long-term ecosystem response to the Exxon Valdez oil spill. Science 302, 2082–2086. Pillai, M.C., Vines, C.A., Wikramanayake, A.H., Cherr, G.N., 2003. Polycyclic aromatic hydrocarbons disrupt axial development in sea urchin embryos through a β-catenin dependent pathway. Toxicology 186, 93–108. Rafiq, K., Cheers, M.S., Ettensohn, C.A., 2012. The genomic regulatory control of skeletal morphogenesis in the sea urchin. Development 139, 579–590. Sucov, H.M., Benson, S., Robinson, J.J., Britten, R.J., Wilt, F., Davidson, E.H., 1987. A lineagespecific gene encoding a major matrix protein of the sea urchin embryo spicule. II. Structure of the gene and derived sequence of the protein. Dev. Biol. 120, 507–519. Suzuki, N., Hayakawa, K., Kameda, T., Toriba, A., Tang, N., Tabata, M.J., Takada, K., Wada, S., Omori, K., Srivastav, A.K., Mishima, H., Hattori, A., 2009. Monohydroxylated polycyclic aromatic hydrocarbons inhibit both osteoclastic and osteoblastic activities in teleost scales. Life Sci. 84, 482–488. Suzuki, N., Danks, J.A., Maruyama, Y., Ikegame, M., Sasayama, Y., Hattori, A., Nakamura, M., Tabata, M.J., Yamamoto, T., Furuya, R., Saijoh, K., Mishima, H., Srivastav, A.K., Furusawa, Y., Kondo, T., Tabuchi, Y., Takasaki, I., Chowdhury, V.S., Hayakawa, K., Martin, T.J., 2011. Parathyroid hormone 1 (1-34) acts on the scales and involves calcium metabolism in goldfish. Bone 48, 1186–1193. Yakan, S.D., Henkelmann, B., Schramm, K.W., Okay, O.S., 2011. Bioaccumulation depuration kinetics and effects of benzo(a)anthracene on Mytilus galloprovincialis. Mar. Pollut. Bull. 63, 471–476.