Mouse very low-density lipoprotein receptor (VLDLR): gene structure, tissue-specific expression and dietary and developmental regulation

Atherosclerosis 145 (1999) 239 – 251 www.elsevier.com/locate/atherosclerosis

Mouse very low-density lipoprotein receptor (VLDLR): gene structure, tissue-specific expression and dietary and developmental regulation Oliver Tiebel a, Kazuhiro Oka a,*, Kathy Robinson a, Merry Sullivan a, Julie Martinez a, Makoto Nakamuta a, Kazumi Ishimura-Oka b,c, Lawrence Chan a a

Departments of Cell Biology and Medicine, Baylor College of Medicine, One Baylor Plaza, Houston TX 77030, USA b Department of Pediatrics, Baylor College of Medicine, Houston TX 77030, USA c USDA/ARS Children’s Nutrition Research Center, HoustonTX 77030, USA Received 4 September 1998; received in revised form 11 January 1999; accepted 27 January 1999

Abstract The very low density lipoprotein receptor (VLDLR) is a multifunctional apolipoprotein (apo) E receptor that shares a common structural feature as well as some ligand specificity to apo E with members of the low density lipoprotein receptor gene family. We have isolated and characterized the mouse VLDLR gene. The mouse VLDLR gene contains 19 exons spanning approximately 50 kb. The exon-intron organization of the gene is completely conserved between mouse and human. Since the 5%-flanking region of the mouse VLDLR gene contains two copies of a sterol regulatory element-1 like sequence (SRE-1), we next studied regulation of the VLDLR mRNA expression in heart, skeletal muscle and adipose tissue in C57BL/6, LDLR-/-, apo E-/- and LDLR-/-apo E-/mice fed normal chow or atherogenic diet. The VLDLR mRNA expression was down-regulated 3-fold by feeding atherogenic diet in heart and skeletal muscle only in LDLR-/- mice. In contrast, VLDLR mRNA expression was up-regulated by atherogenic diet in adipose tissue in all animal models except double knockout mice. These results suggest that SRE-1 may be functional and VLDLR plays a role in cholesterol homeostasis in heart and skeletal muscle when LDLR is absent and that apo E is required for this modulation. Developmental regulation of the VLDLR mRNA expression was also tissue-specific. VLDLR mRNA expression in heart displayed significant up and down regulation during development. Maximal level was detected on post-natal day 3. However, the VLDLR mRNA levels in skeletal muscle remained relatively constant except a slight dip on post-natal day 7. In kidney and brain, VLDLR mRNA also peaked on post-natal day 3 but remained relatively constant thereafter. In liver, VLDLR mRNA expression was very low; it was barely detectable at day 19 of gestation and was decreased further thereafter. In adipose tissue, the VLDLR mRNA level showed an increase on post-natal day 13, went down again during weaning and then continued to increase afterwards. This developmental pattern as well as dietary regulation in adipose tissue supports the notion that VLDLR plays a role in lipid accumulation in this tissue. Although the primary role of VLDLR in heart, muscle and adipose tissue is likely in lipid metabolism, developmental pattern of this receptor in other tissues suggests that VLDLR has functions that are unrelated to lipid metabolism. © 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Very low-density lipoprotein receptor; Mouse gene structure; Dietary regulation; Developmental regulation

1. Introduction



The sequence data from this article has been deposited with the GenBank/EMBL Data Bank under Accession No. AF026064. * Corresponding author. Tel.: + 1-713-798-7381; fax: + 1-713-7988764. E-mail address: [email protected] (K. Oka)

Receptor-mediated endocytosis of plasma lipoproteins plays a pivotal role in cholesterol homeostasis [1]. Apolipoprotein (apo) E and apo B-100 are important ligands for this process. The very low density lipoprotein receptor (VLDLR) is an apo E receptor that was isolated from rabbit heart cDNA library by cross-hybridization to the cDNA corresponding to the

0021-9150/99/$ - see front matter © 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 9 9 ) 0 0 0 6 8 - 4

240

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

ligand binding domain of low density lipoprotein receptor (LDLR) [2]. The VLDLR belongs to the expanding mammalian LDLR gene family that also includes LDLR, LDLR-related protein (LRP), glycoprotein 330 (gp330)/megalin [3,4], apo E receptor-2 (apo ER2) [5]/ LR8B [6], and LR11 [7]. All members are characterized by common structural features which include: (1) cysteine-rich repeats consisting of 40 amino acid residues in the ligand binding domain or in complement-type domain; (2) epidermal growth factor (EGF) precursor-type repeats; (3) module of  50 amino acid residues with a consensus tetrapeptide, YWTD; (4) a single transmembrane domain; and (5) a cytoplasmic domain containing an NPXY sequence required for clustering of the receptor into coated pits. The VLDLR is structurally more closely related to LDLR and apo ER2/LR8 than the other members. A major difference in the domain structure of VLDLR, LDLR and apo ER2 is the number of cysteine-rich repeats in the ligand binding domain, in which the LDLR and apo ER2 have seven repeats, and VLDLR has eight repeats in this domain. This distinguishing feature is not absolute, however, because variant forms of the VLDLR and apo ER2 lacking one cysteine-rich repeats have been identified [8,9]. The ligand specificity for rabbit b-VLDL also distinguishes the VLDLR, LDLR, apo ER2 and LR11 from LRP and gp330/megalin. There is sufficient apo E on b-VLDL that allows its binding to VLDLR, LDLR, apo ER2 and LR11, but additional enrichment with exogenous apo E appears to be necessary for it to bind efficiently to LRP and gp330/megalin [2,5,7,10]. It has been hypothesized that the primary role of the VLDLR is the delivery of triglycerides in triglyceriderich apo E-containing lipoproteins to extrahepatic tissues that are active in fatty acid metabolism [2]. The tissue- and cell type-specific expression of the VLDLR mRNA support this hypothesis [2,11 – 15]. The VLDLR protein is present in the endothelium of capillaries and small arterioles. Disruption of this gene in mice leads to a mild reduction in the size of adipose depots [16]. In spontaneously hypertensive stroke-prone rats, VLDLR mRNA was lower in the heart than in control rats at 4 weeks and was further reduced at 13 weeks when cardiac hypertrophy is established. This developmental pattern of the VLDLR gene expression was associated with a switch in energy substrate from lipid to glucose [17]. However, the role of the VLDLR in energy metabolism remains unclear. VLDLR mRNA levels in rats are not regulated by fasting and re-feeding [8]. Human VLDL itself has been reported to be a poor ligand for this receptor [18]. Intermediate density lipoproteins, but not VLDL, appear to be the ligand in VLDLR ectopically expressed in liver in vivo [19]. Although sterol regulatory element 1 (SRE-1) like sequence is present in the 5%-flanking region of the VLDLR gene, the expression of the VLDLR gene was

not affected by sterols in the human monocytic cell line, THP-1 [20] or in rabbit resident alveolar macrophages [21]. VLDLR was expressed in endothelial cells as well as in macrophage-derived foam cells, which suggests a potential role for this receptor in foam cell formation and atherogenesis [14,15]. In addition, VLDLR has been reported to bind to Lp(a) [22], and may play a role in modulating the effects of this atherogenic lipoprotein on the vascular wall. In this report, we have isolated and characterized the mouse VLDLR gene and its 5%-flanking region and studied the effects of atherogenic diet feeding on VLDLR mRNA expression in wild type mice and other genetic mouse models. We also studied the developmental regulation of VLDLR mRNA expression in various tissues around birth and during early post-natal development.

2. Materials and methods

2.1. Isolation of mouse genomic clones for VLDLR A 3.0-kb cDNA for mouse VLDLR [13] was used to screen a genomic library constructed in lFIX II (Stratagene). For further screening, a 1.0-kb genomic fragment located in the 5%-region of the clone 8-1 was used to rescreen the library. Four overlapping clones were characterized by restriction enzyme digestion and subsequently subcloned into the pBluescript KS vector. The sequence analysis was performed on doublestranded circular plasmid DNA using a Sequenase sequencing kit (Amersham) or Cyclist Exo- Pfu DNA sequencing kit (Stratagene).

2.2. Northern blot analysis Total cellular RNA was prepared from mouse heart and brain using Ultraspec RNA isolation kits (Biotecx Lab.). The RNA (20 mg) was electrophoresed on a 1% agarose/6% formaldehyde gel and transferred to a Hybond N + membrane (Amersham). The membrane was then hybridized to either a 32P-labeled 1.6-kb cDNA corresponding to nucleotides (nt) 1–1581 of the mouse VLDLR cDNA or the 1.0-kb BamHI/EcoRI genomic fragment contained in the 3%-flanking region of the mouse VLDLR gene and with mouse glyceraldehyde-3phosphate dehydrogenase (GAPDH) cDNA probe (Ambion).

2.3. Mapping the 5 % end of the gene RNase protection assay (RPA) was performed by using the RPA II kit (Ambion). An antisense RNA probe corresponding to nt − 159 to +111 was produced by T7 RNA polymerase using P6uII digested

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

0.8-kb SstI/Hind III fragment in the presence of [32P]UTP. RNA probe was hybridized to 20 mg of total RNA from heart or yeast tRNA at 42oC overnight. The mixture was digested with RNase A and RNase T1 and fractionated by electrophoresis on a 6% sequencing gel.

2.4. RNA analysis We quantified VLDLR mRNA by RPA. The mouse VLDLR mV13 [19] was digested with SmaI to remove nt 1 –1227 and self-ligated to obtain mV13SmaI clone. A 32P-labeled 354 nt antisense RNA probe corresponding to nt 1228 to 1581 covering exon 8 – 11 was generated by T7 RNA polymerase from BamHI linearized mV13SmaI plasmid DNA. We subcloned mouse GAPDH cDNA corresponding to nt 426 – 660 that extend exon 5–8 by polymerase chain reaction (PCR) using pTR1-mouse-GAPDH (Ambion) as a template. The PCR primers used were 5%-ATTACCCTCACTAAAGGG -3% for a sense primer and 5%GAAGGGATCCATGTTTGTGATGGGTGTGAAC3% for an antisense primer. The 3% down stream primer contained an artificial BamHI site (underlined) for cloning purpose. The PCR products were subcloned into the BamHI/EcoRI sites of pBluescript KS. A 32 P-labeled 318 nt antisense probe was generated by T3 RNA polymerase reaction using the BamHI digested plasmid DNA. 20 mg of total RNA were hybridized to 1× 105 cpm VLDLR probe and 1×104 cpm GAPDH probe at 65oC overnight using RPAII kit (Ambion) according to the manufacturer’s instructions. The protected RNA probes (354 nt for VLDLR and 235 nt for GAPDH) were electrophoresed on a 6% sequencing gel. The gel was dried and radioactive bands were quantified by exposure to a phophor screen (Molecular Dynamics) using Quant program.

2.5. Diet study C57BL/6 mice were purchased from Jackson Laboratories. In order to obtain mice lacking both LDLR and apo E, apo E knockout mice [23] were cross-bred with LDLR knockout mice [24]. The progeny heterozygous for both mutant alleles were mated each other and the next generation was screened for double knockout by Southern blot analysis for the LDLR knockout allele and by polymerase chain reaction (PCR) for apo E knockout allele. Mice were maintained on a normal chow diet (Teklad 4% mouse/rat diet 7001 from Harlen Teklad Premier Laboratory Diets) that contained 4% (w/w) animal fat and B0.04% (w/w) cholesterol. For the atherogenic diet groups, mice were switched to a 1.25% cholesterol/atherogenic diet that contained 1.25% cholesterol, 7.5% (w/w) cocoa butter, 7.5% casein and 0.5% (w/w) sodium cholate [25] and maintained for 3 weeks on the diet. Mice were kept on 12 h

241

dark/12 h light cycles and were allowed free access to food and water.

2.6. Lipid analysis After 5 h fasting, blood was obtained by puncture of the retro-orbital plexus from anesthetized animals and collected into EDTA-treated Pasteur pipettes. The cholesterol and triglyceride content were determined by using kits from Sigma.

2.7. De6elopmental study ICR mice (timed-pregnancy females and females at various ages) were purchased from SASCO. Animals were housed in an animal facility with a 12 h/12 h light/dark cycle and given free access to chow and water for several days before manipulation. Pregnant females were kept in separate cages. Birth occurred on day 21 of gestation which was defined as post-natal day 1 for this study. Litter size varied between 10 and 15. Nursing animals were weaned on day 21 after birth. Mice were sacrificed between 10:00 and 12:00 a.m. to minimize diurnal variation in expression. All animals were studied in the fed state, verified by the presence of milk in the stomach of nursing mice and chow in the stomach of weaned animals [26]. We dissected brain starting with the 17th gestational day. A clean isolation of adequate amounts of tissue from heart, kidney and liver was possible following the 19th gestational day. We were able to separate muscle tissue starting with the 1st and adipose with the 3rd postnatal day.

2.8. Statistical analysis Statistical analyses were performed using the nonpaired Student t-test with SigmaStat program and graphs were created with SigmaPlot program (Jandel Scientific).

3. Results

3.1. Mouse VLDLR gene structure The VLDLR gene was isolated from a 129Sv mouse genomic library. The 3.0-kb mouse VLDLR cDNA [13] was used for the initial screening, which yielded three overlapping clones containing exons 2–19, but missing exon 1. Therefore, a second round of screening was performed with a 1.0-kb DNA fragment located in the 5%-region of the clone 8–1 (Fig. 1). We obtained three additional clones and characterized one of them, which contained exon 1 and the 5%-flanking region. The gene spans approximately 50 kb. The overlapping clones used for characterization and the gene structure are

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

242

shown in Fig. 1. Exon-intron organization (Table 1) was completely conserved between mouse and human [20]. The imperfect cysteine-rich repeats 1, 2, 3, 7 and 8 in the ligand binding domain are each encoded by a different exon, whereas repeats 4 – 6 are encoded by a single exon. The fifth repeat of the VLDLR contains 10 extra amino acid residues. It is noteworthy that repeats 3 – 5 in the binding domain of LDLR are also encoded by a single exon [27]. EGF precursor-type repeats A, B and C are encoded by different exons. The non-re-

peated sequence in the EGF precursor homology region is encoded by exons 10–14. The O-linked sugar domain, the least conserved domain between VLDLR and LDLR [13], is encoded by a single short exon which has been shown to undergo tissue- and cell type-specific alternative splicing [8,20,28]. The transmembrane domain is encoded by two separate exons number 17 and 18, and the last exon contains the codon for the last 11 amino acids in the C-terminus as well as the 3%-untranslated region. Thus, the gene organization of the

Fig. 1. Structure and organization of the mouse VLDLR gene. The gene map was established for the restriction endonucleases BamHI and EcoRI. Four overlapping clones that were used for characterization of the VLDLR gene are shown below the map. Boxes represent exons and open areas indicate untranslated regions. Exons are numbered 1–19. A shaded box indicates the 3%-probe used for Northern blot analysis. Table 1 Exon and intron organization of the mouse VLDL receptor genea Exon

Exon size (bp)

Position on cDNA* (bp)

5%-splice donor

Intron (kb)

3%-splice acceptor

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

645 120 123 123 372 123 123 120 126 172 219 119 140 142 147 84 81 170 \4.0k

1–101 102–221 222–344 345–467 468–839 840–962 963–1085 1086–1205 1206–1331 1332–1503 1504–1722 1723–1841 1842–1981 1982–2123 2124–2270 2271–2354 2355–2435 2436–2605 2606–3134

CAAGCGGTGAGTGGGG ACTGTGGTAAGCTCTT AGTGCCGTGAGTGTGC ACTGTGGTAAGAAGAC ACTGCCGTAAGTAACT AAAACGGTGAGGTTCT AATGCCGTAAGTGGAG GTGGAGGTGAGTTGAA CAGTAGGTAAATAGAC CTTCAGGTAACTTCCA GTCGGGGTTTGTATTC CACTCGGTATGTATGT TTTGAGGTAAGACTCG CGTCAGGTAACATGGA GTCAAAGTAAGGCTTT CTGGAGGTATTGGGTC CTCTCTGTAAGTAAAT CCAGCAGTAAGTATAC

14.0 4.8 1.5 1.6 0.4 0.1 0.2 0.1 0.3 0.8 1.6 0.6 0.3 1.2 0.9 0.3 0.8 1.2

TTCCTCCTAGGGAAGA ACGTTTATAGTAAAGA TCATCAACAGATATGA CCTCTAACAGGCAACA TCTTTCGTAGCTTCTC CGGAAAATAGTCAATC TTTATTCCAGATATCA TTTCCCCTAGATATTG TGTCTTGCAGGCAAAG ATCTGTTCAGTGCCTC CTCTTCCCAGCTTTGT TCCTGCCTAGACCTTG TCTGTTTTAGGATCGC CCCCAACTAGGTAAAA TATAATCCAGGTACTT GTCCTTGTAGGGATCA TTTTTTTCAGTGCTCT TTCTCTGCAGATATCA

a

The sequences of the mouse VLDLR gene splice junctions are shown. The intron sequences are underlined. * Positions on cDNA are numbered according to the published sequence [13].

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

243

Fig. 2. Nucleotide sequence of the 5%-flanking region of the mouse VLDLR gene. The figure displays 714 bp of 5%-flanking region of the gene (negative numbering) and 647 bp of exon 1. Sequence data have been deposited with the EMBL/GenBank Data Libraries under Accession No. AF026064. The coding amino acid containing region is shown by capital letter. The closed circles above the sequence indicate transcription initiation sites identified by RPA. Consensus sequences for putative transcription factor-binding sites are marked beneath (for sense strand) or above (for antisense strand) each site. Nucleotides that differ from the consensus sequence are indicated in parentheses. Potential transcription factor binding sites for AP-2, Sp-1, SRE-1, E2A, NF-IL6 and PU.1 are shown.

VLDLR is similar to that of LDLR, which is consistent with the hypothesis that the two genes have evolved from a common ancestral gene [13,20].

3.2. Northern blot analysis of VLDLR mRNA Multiple mRNA species have been reported for VLDLR [2,8,11–13,29]. Three major species of mRNAs (9.7, 4.5 and 3.9-kb) for mouse VLDLR are present in heart, whereas the 9.7 kb mRNA was the major mRNA species in brain [13]. The probe corresponding to the 3%-untranslated region hybridized only to the high molecular size mRNA (data not shown), suggesting that high and low molecular size mRNA species may be generated by utilization of different polyadenylation signals.

3.3. Characterization of the 5 %-flanking region of the mouse VLDLR gene The start site of transcription was mapped by RPA. Multiple protected fragments were detected by this

method. The first base of the predominant protected fragment was assigned + 1. The nucleotide sequence of the 5%-flanking region of the mouse VLDLR gene is shown in Fig. 2. This part of the sequence is less conserved between human and mouse than the coding region. As in the human gene [20], we could not identify a typical TATA box or CCAAT box in the mouse VLDLR gene, though an inverted CCAAT box was found at nt + 104. Although several conserved potential regulatory elements are present in the 5%-flanking region of mouse and human VLDLR gene, their locations are not well conserved and their functional significance is unknown. Two copies of a potential sterol regulatory element-1 (SRE-1) [30], which is present in the promoters of HMG-CoA synthase, HMG-CoA reductase and the LDLR receptor genes, and mediates regulation of the LDL receptor gene by sterols, are present, separated from each other by 20 nucleotides. Other potential regulatory elements include: a binding site for Sp-1 [31]; a binding site for NF-IL6, a member of C/EBP, which appears to be ubiquitous but most abundant in liver, heart and muscle [32]; two copies of

244

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

Fig. 3. Quantitation of VLDLR mRNA in various mouse tissues. Total RNA from various tissues was hybridized to 32P-labeled antisense VLDLR and GAPDH probes in solution. After RNase digestion, RNA was precipitated, redissolved in a loading buffer and separated on a 6% sequencing gel. The radioactive bands were quantified by PhospharImager. The values are expressed as band volume of VLDLR mRNA/band volume of GAPDH. Each value represents mean of five animals 9 S.D. Statistical analysis was performed on each tissue and results are shown in the Fig. 3.

a binding site for AP-2 [33]; a binding site for E2A, another factor that is present ubiquitously and is related to myocytes or B-cell specific E2-box binding factors [34]; and a binding site for macrophage and B cell-specific PU.1 [35].

3.4. Distribution of VLDLR mRNA in adult mouse tissues Since the relative concentrations of VLDLR mRNA in various tissues have not been reported, we determined VLDLR mRNA level in adult mice by quantitative RPA. We used an RNA probe corresponding to nt 426 – 660 in this study and normalized the results to the level of GAPDH mRNA. The VLDLR mRNA was most abundant in heart. Moderate VLDLR mRNA expression was detected in muscle, kidney, adipose tissue and brain. It was barely detectable in liver (Fig. 3).

atherogenic diet (Table 2).Feeding atherogenic diet did not change VLDLR mRNA expression in heart and muscle in C57BL/6, apo E-/- or apo E-/-LDLR-/- mice. However, VLDLR mRNA expression was down-regulated 3-fold in both tissues in LDLR-/- mice (Fig. 4). In contrast, VLDLR mRNA expression was up-regulated in adipose tissue in all genetic models except in double knockout mice. In these animals, VLDLR mRNA expression was down-regulated by 40%.

3.6. Expression of VLDLR mRNA in mouse tissues during early post-natal de6elopment We next studied VLDLR mRNA expression at various developmental stages by quantitative RPA. Total RNA was prepared from various mouse tissues, starting on day 17 of gestation and ending on post-natal day

Table 2 Effects of atherogenic diet on plasma lipida,c

3.5. Regulation of VLDLR mRNA expression by high fat diet C57BL/6J, LDLR-/-, apo E-/- and LDLR-/-apo E-/mice were fed normal chow or atherogenic diet for 3 weeks and plasma lipids were measured. Plasma cholesterol levels in mice fed atherogenic diets were significantly higher than those fed normal chows. Plasma cholesterol levels in apo E-/-LDLR-/- mice increased to 4120 mg/dl, which were higher than those in single gene knockout mice as has been reported previously [25]. In contrast, triglyceride levels were not affected by feeding

Mouse

C57BL/6J LDLR-/Apo E-/LDLR-/-Apo E-/-

Cholesterol (mg/dl)

Triglyceride (mg/dl)

Nb

HCb

N

HC

74 94 259 942 497 9211 7769181

159 9 20* 2428 9515* 22849757** 4120 9 963*

53 921 186 932 174 949 109 924

36 9 5 189 9 31 126 921 889 10

Each value is expressed as mean of five animals 9S.D. N, normal chow; HC, high cholesterol/high fat atherogenic diet. c *PB0.0001; **PB0.001.

a

b

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

245

Fig. 4. Regulation of VLDLR mRNA expression by high cholesterol diet. Mice were fed with normal chow or atherogenic diet for 3 weeks and VLDLR mRNA expression was determined by RPA. Each value represents mean 9S.D. of five animals. (A) C57BL/6, (B) LDLR-/-, (C) Apo E-/- and (D) LDLR-/-Apo E-/- mice. The open bars show the results from mice fed normal chow and the closed bars show the results from mice fed high cholesterol/high fat atherogenic diet. (E) RNase protection assay for VLDLR mRNA expression in heart of C57BL/6 or LDLR-/- mice fed either normal chow or atherogenic diet. Arrows indicate protected antisense RNA probes. The bands corresponding to protected VLDLR or GAPDH RNA probes were quantified by PhospharImager.

60. In most experiments we used GAPDH, a housekeeping gene, as an internal standard [36] to establish the relative amount of VLDLR mRNA in each sample. We found only minimal variations in GAPDH mRNA levels during neonatal development in most tissues except in muscle and liver. For these two tissues, we have directly used integrated band volume of VLDLR mRNA without normalization by GAPDH mRNA. VLDLR mRNA level in heart increased about 3-fold at birth followed by an additional 3-fold increase on day 3 after birth. It decreased 6-fold on day 7 and continued to increase thereafter (Fig. 5A). There was no significant change in muscle VLDLR mRNA level either during or following the weaning period, except for a

mild decline on day 7 after birth (Fig. 5B). VLDLR mRNA level in kidney increased about 4-fold at birth and another  40% on day 3 before returning to day 1 level thereafter (Fig. 5C). Adipose tissue was obtained from epididymal fat, which was not detectable until day 3 (Fig. 5D). We observed a significant peak of VLDLR mRNA in this tissue on post-natal day 13, followed by a decline on day 20 before weaning. After weaning, the VLDLR mRNA levels went up and maintained an upward trend to day 60. The VLDLR mRNA level in brain is about half that in kidney, but the developmental patterns in the two tissues are quite similar (Fig. 5C,E). VLDLR mRNA in brain was detected on day 17 of gestation. It

246

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

increased slightly in the last 4 days of gestation, and markedly ( 2-fold) immediately after birth. There was a peak on day 3 and levels fluctuated until day 24 when they remained steady until day 60. The expression of the VLDLR mRNA in the liver is very low in adult

mice (Fig. 5F). The mRNA level in the fetal liver was about 3-fold higher than in adults on days 19 and 20 of gestation. During the first 2 weeks of birth, there was a gradual decline in expression, and the adult level was reached shortly after weaning.

Fig. 4. (Continued)

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

247

Fig. 5. VLDLR mRNA expression in mouse tissues at various developmental stages. Concentrations of VLDLR mRNA were determined by RPA as described in Section 2 and normalized to GAPDH mRNA (panel A, C, D and E). (A) Heart, (B) Muscle, (C) Kidney, (D) Adipose tissue, (E) Brain and (F) Liver. The values are expressed as band volume of VLDLR mRNA/band volume of GAPDH. Each value represents mean of five samples 9 S.D. Statistical analysis was performed on each developmental stage and results are shown in the Fig. 5. Because of significant variation of GAPDH mRNA expression in muscle and liver during neonatal development, VLDLR mRNA levels are expressed as integrated band volume in these tissues (panel B and F). Statistical analysis was performed on each developmental stage and the results are shown above each column. (G) RNase protection assay for VLDLR mRNA expression in heart at various developmental stages.

4. Discussion In this report, we have characterized the mouse VLDLR gene and studied the regulation of VLDLR mRNA expression during prenatal and early postnatal development. The exon-intron organization of the VLDLR gene was completely conserved and the coding region was highly conserved between species, but the 5%-flanking region was poorly conserved. The human VLDLR gene contains polymorphic CGG triplet repeats in the 5%-untranslated region and the allele frequencies of the 5-repeat have been reported to be

significantly higher in Japanese patients with Alzheimer’s disease [37], a finding that has not been confirmed in Caucasian patients [38,39]. The CGG triplet repeats were absent in the mouse VLDLR gene. We have identified potential regulatory elements such as binding sites for transcription factors AP-2, E2A, NF-IL6, Sp-1, SRE-1 and PU.1 in the 5%-flanking region of the mouse VLDLR gene. The functional significance of these sites remains to be elucidated. Macrophage-derived foam cells express VLDLR mRNA, which was not regulated by cholesterol despite the presence of SRE-1-like sequence in the human gene

248

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

[15,21]. LDLR-deficient CHO-ldlA7 cells transfected with VLDLR exhibited intracellular lipid accumulation by incubation with b-VLDL [21], suggesting that VLDLR may play a role in foam cell formation. VLDLR has been detected in endothelial cells and macrophage-derived foam cells [14,15]. Unregulation of VLDLR expression by sterols has been postulated to play a role in normal and pathophysiological vascular processes [15]. Here we showed that the VLDLR mRNA expression is regulated by atherogenic diets in heart and skeletal muscle in LDLR-/- mice. Thus, VLDLR may play a role in cholesterol homeostasis in

these tissues under certain pathological conditions. The most striking dietary regulation of VLDLR mRNA expression by 1.25% cholesterol/atherogenic diets occurred in adipose tissue, which stimulated expression by 60–190%. These results are consistent with the slightly reduced body weight of mice lacking VLDLR [16] and suggest that VLDLR may contribute to lipid accumulation in adipose tissue and potentially play a role in obesity. VLDLR mRNA is essentially undetectable in adult mouse liver. However, we detected a three-fold higher amount of VLDLR in the neonatal liver (Fig. 5F).

Fig. 5. (Continued)

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

Since we showed that hepatic VLDLR expression induced by adenovirus-mediated gene transfer is functional and mediates the hepatic uptake of IDL [19], we speculate that the transient hepatic expression of VLDLR might play a role in the lipoprotein homeostasis of neonatal mice. It has been reported that VLDLR binds to lipoprotein lipase (LPL), the key enzyme involved in the remodeling of triglyceride-rich lipoproteins. LPL also enhances the binding of these lipoproteins to VLDLR [18,40]. The tissue-specific expression of the VLDLR gene is similar but not identical to that of LPL [26,41]. LPL mRNA in adult mice was most abundant in adipose tissue, heart, skeletal muscle and kidney. LPL mRNA in brain has been localized in the hippocampus in same studies [42,43]. In other reports it was too low in concentration to be detected in RNA prepared from whole brain [12,41,44]. In contrast, VLDLR gene transcripts were detectable in cerebral cortex, hippocampus and cerebellum [5,45]. The significant difference in tissue expression of LPL and VLDLR suggests that VLDLR has functions that are independent of LPL action including those that may be unrelated to lipid metabolism. Since developmental studies on LPL mRNA expression have not been reported for mice, we compared the pattern of tissue specific expression of VLDLR to that of LPL in rats [26]. We observed substantial differences in their expression patterns. For example, in mouse heart VLDLR mRNA expression rapidly increased post-natally, with a peak on day 3 of birth that was higher than the adult level. It decreased somewhat afterwards, but the adult level was reached within several weeks of birth. However, in rat heart, LPL mRNA was barely detectable at birth. It increased steadily over 20-fold as the animal grew into adulthood. Similarly, differences in VLDLR and LPL mRNA expression during the post-natal period were also observed in the other tissues (Fig. 5 and Semenkovich et al., 1989) [26]. LPL plays an important role in normal lipoprotein metabolism, being the key enzyme responsible for the catabolism of the triglyceride-rich lipoproteins. LPL deficiency in mice leads to early post-natal death resulting from severe chylomicronemia and a fat emboli-like syndrome [46,47]. The function of VLDLR, in contrast, is not well understood. VLDLR deficiency in mice is not associated with any significant lipoprotein phenotype. These animals are fertile and grossly healthy. The only abnormality seems to be a modest decrease in body mass index and adipose tissue mass [16]. Our observations indicate that while LPL and VLDLR may have synergistic function as suggested previously [18], the fact that their expression shows substantial divergence suggests that VLDLR has functions independent to LPL.

249

Majority of members of LDLR gene family reported to date bind apo E-enriched lipoproteins, which is implicated for physiological roles of these receptors in lipid metabolism. However, it has also become evident that these members bind many non-lipoprotein ligands and play diverse roles in other than lipid metabolism. The VLDLR binds many non-lipoprotein ligands including serine proteinase/serpin complex [40,48,49] and exhibits substantial overlap in ligand specificity with LRP [4,49]. In agreement with potential role of LRP in metabolism of lipoproteins and proteinase/inhibitor complexes, LRP is highly expressed in liver during embryonal as well as postnatal development, whereas VLDLR expression is minimal in this tissue. LRP is expressed in brain throughout all embryonic stages and during post-natal development, where scavenging proteinase/inhibitor complexes may be an important role for LRP [44,50]. Similarly, VLDLR is expressed throughout life in brain (Fig. 5E, [51]). In contrast, LR11 expression was highly dependent on neuronal cell types and peaked at 2 weeks, which suggests its role in neuronal development [51]. The present study suggests that VLDLR like LRP may play a role in metabolism of proteinase/inhibitor complexes in some tissues. Acknowledgements The authors wish to thank Dr John B. Anderson for his helpful suggestions for this manuscript and Celeste Arden for her technical assistance. O.T. was a recipient of German Academic Exchange Service Award. This work was supported in part by Alzheimer’s Association/The William T. Morris Foundation Pilot Research Grant (PRG-95-179) to K.O. and a grant (HL51586) from the National Institutes of Health to L.C. References [1] Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34 – 47. [2] Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, Yamamoto T. Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity. Proc Natl Acad Sci USA 1992;89:9252 – 6. [3] Jingami H, Yamamoto T. The VLDL receptor: wayward brother of the LDL receptor. Curr Opin Lipidol 1995;6:104 – 8. [4] Strickland DK, Kounnas MZ, Argraves WS. LDL receptor-related protein: a multiligand receptor for lipoprotein and proteinase catabolism. FASEB J 1995;9:890 – 8. [5] Kim DH, lijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H, Kondo H, Saeki S, Yamainoto T. Human apolipoprotein E receptor 2. A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J Biol Chem 1996;271:8373– 80. [6] Novak S, Hiesberger T, Schneider WJ, Nimpf J. A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J Biol Chem 1996;271:11732– 6.

250

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251

[7] Yamazaki H, Bujo H, Kusunoki J, Seimiya K, Kanaki T, Morisaki N, Schneider WJ, Saito Y. Elements of neural adhesion molecules and a yeast vacuolar protein sorting receptor are present in a novel mammalian low density lipoprotein receptor family member. J Biol Chem 1996;271:24761–8. [8] Jokinen EV, Landschulz KT, Wyne KL, Ho YK, Frykman PK, Hobbs HH. Regulation of the very low density lipoprotein receptor by thyroid hormone in rat skeletal muscle. J Biol Chem 1994;269:26411– 8. [9] Kim DH, Magoori K, Inoue TR, Mao CC, Kim HJ, Suzuki H, Fujita T, Endo Y, Saeki S, Yamamoto T. Exon/intron organization, chromosome localization, alternative splicing, and transcription units of the human apolipoprotein E receptor 2 gene. J Biol Chem 1997;272:8498–504. [10] Willnow TE, Goldstein JL, Orth K, Brown MS, Herz J. Low density lipoprotein receptor-related protein and gp330 bind similar ligands, including plasminogen activator-inhibitor complexes and lactoferrin, an inhibitor of chylomicron remnant clearance. J Biol Chem 1992;267:26172–80. [11] Gafvels ME, Caird M, Britt D, Jackson CL, Patterson D, Strauss JF III. Cloning of a CDNA encoding a putative human very low density lipoprotein/apolipoprotein E receptor and assignment of the gene to chromosome 9pter-p23. Som Cell Mol Genet 1993;19:557 – 69. [12] Gafvels ME, Paavola LG, Boyd CO, Nolan PM, Wittmaack F, Chawla A, Lazar MA, Bucan M, Angelin BO, Strauss JF III. Cloning of a complementary deoxyribonucleic acid encoding the murine homolog of the very low density lipoprotein/apolipoprotein-E receptor: expression pattern and assigmnent of the gene to mouse chromosome 19. Endocrinology 1994;135:387 – 94. [13] Oka K, Ishimura-Oka K, Chu MJ, Sullivan M, Krushkal J, Li YM, Chan L. Mouse very-low-density-lipoprotein receptor (VLDLR) cDNA cloning, tissue-specific expression and evolutionary relationship with the low-density-lipoprotein receptor. Eur J Biochem 1994;224:975–82. [14] Wyne KL, Pathak K, Seabra MC, Hobbs HH. Expression of the VLDL receptor in endothelial cells. Arterioscler Thromb Vasc Biol 1996;16:407 – 15. [15] Multhaupt HA, Gafvels ME, Kariko K, Jin H, Arenas-Elliot C, Goldman BI, Strauss JF III, Angelin B, Warhol MJ, McCrae KR. Expression of very low density lipoprotein receptor in the vascular wall. Analysis of human tissues by in situ hybridization and immunohistochemistry. Am J Pathol 1996;148:1985– 97. [16] Frykman PK, Brown MS, Yamamoto T, Goldstein JL, Herz J. Normal plasma lipoproteins and fertility in gene-targeted mice homozygous for a disruption in the gene encoding very low density lipoprotein receptor. Proc Natl Acad Sci USA 1995;92:8453 – 7. [17] Masuzaki H, Jingami H, Matsuoka N, Nakagawa O, Ogawa Y, Mizuno M, Yoshimasa Y, Yamamoto T, Nakao K. Regulation of very-low-density lipoprotein receptor in hypertrophic rat heart. Circ Res 1996;78:8–14. [18] Takahashi S, Suzuki J, Kohno M, Oida K, Tamai T, Miyabo S, Yamamoto T, Nakai T. Enhancement of the binding of triglyceride-rich lipoproteins to the very low density lipoprotein receptor by apolipoprotein E and lipoprotein lipase. J Biol Chem 1995;270:15747– 54. [19] Kobayashi K, Oka K, Forte T, Ishida B, Teng B, Ishimura-Oka K, Nakamuta M, Chan L. Reversal of hypercholesterolemia in low density lipoprotein receptor knockout mice by adenovirusmediated gene transfer of the very low density lipoprotein receptor. J Biol Chem 1996;271:6852–60. [20] Sakai J, Hoshino A, Takahashi S, Miura Y, Ishii H, Suzuki H, Kawarabayasi Y, Yamamoto T. Structure, chromosome location, and expression of the human very low density lipoprotein receptor gene. J Biol Chem 1994;269:2173–82.

[21] Suzuki J, Takahashi S, Oida K, Shimada A, Kohno M, Tamai T, Miyabo S, Yamamoto T, Nakai T. Lipid accumulation and foam cell formation in Chinese hamster ovary cells overexpressing very low density lipoprotein receptor. Biochem Biophys Res Commun 1995;206:835 – 42. [22] Argraves KM, Kozarsky KF, Fallon JT, Harpel PC, Strickland DK. The atherogenic lipoprotein Lp(a) is internalized and degraded in a process mediated by the VLDL receptor. J Clin Invest 1997;100:2170– 81. [23] Zhang SH, Reddick RL, Burkey B, Maeda N. Diet-induced atherosclerosis in mice heterozygous and homozygous for apolipoprotein E gene disruption. J Clin Invest 1994;94:937–45. [24] Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, Herz J. Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J Clin Invest 1993;92:883 – 93. [25] Ishibashi S, Herz J, Maeda N, Goldstein JL, Brown MS. The two-receptor model of lipoprotein clearance: tests of the hypothesis in ‘knockout’ mice lacking the low density lipoprotein receptor, apolipoprotein E, or both proteins. Proc Natl Acad Sci USA 1994;91:4431 – 5. [26] Semenkovich CF, Chen SH, Wims M, Luo CC, Li WH, Chan L. Lipoprotein lipase and hepatic lipase mRNA tissue specific expression, developmental regulation, and evolution. J Lipid Res 1989;30:423 – 31. [27] Sudhof TC, Goldstein JL, Brown MS, Russell DW. The LDL receptor gene: a mosaic of exons shared with different proteins. Science 1985;228:815 – 22. [28] Martensen PM, Oka K, Christensen L, Rettenberger PM, Petersen HH, Christensen A, Chan L, Heecaard CW, Andreasen PA. Breast carcinoma epithelial cells express a very low-density lipoprotein receptor variant lacking the O-linked glycosylation domain encoded by exon 16, but with full binding activity for serine proteinase serpin complexes and Mr-40 000 receptor-associated protein. Eur J Biochem 1997;248:583 – 91. [29] Webb JC, Patel DD, Jones MD, Knight BL, Soutar AK. Characterization and tissue-specific expression of the ‘human very low density lipoprotein (VLDL) receptor’ mRNA. Hum Mol Genet 1994;3:531 – 7. [30] Smith JR, Osbome TF, Goldstein JL, Brown MS. Identification of nucleotides responsible for enhancer activity of sterol regulatory element in low density lipoprotein receptor gene. J Biol Chem 1990;265:2306– 10. [31] Dynan WS, Tjian R. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA-binding proteins. Nature 1985;316:774 – 8. [32] Majello B, Arcone R, Toniatti C, Ciliberto G. Constitutive and IL-6-induced nuclear factors that interact with the human C-reactive protein promoter. EMBO J 1990;9:457 – 65. [33] Williams T, Tjian R. Analysis of the DNA-binding and activation properties of the human transcription factor AP-2. Genes Develop 1991;5:670 – 82. [34] Murre C, McCaw PS, Baltimore D. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 1989;56:777 – 83. [35] Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 1990;61:113 – 24. [36] Bosma PJ, Kooistra T. Different induction of two plasminogen activator inhibitor 1 mRNA species by phorbol ester in human hepatoma cells. J Biol Chem 1991;266:17845– 9. [37] Okuizumi K, Onodera O, Namba Y, Ikeda K, Yamainoto T, Seki K, Ueki A, Nanko S, Tanaka H, Takahashi H, et al. Genetic association of the very low density lipoprotein (VLDL) receptor gene with sporadic Alzheimer’s disease. Nature Genet 1995;11:207 – 9.

O. Tiebel et al. / Atherosclerosis 145 (1999) 239–251 [38] Okuizumi K, Onodera O, Seki K, Tanaka H, Namba Y, Ikeda K, Saunders AM, Pericak-Vance MA, Roses AD, Tsuji S. Lack of association of very low density lipoprotein receptor gene polymorphism with Caucasian Alzheimer’s disease. Ann Neurol 1996;40:251 – 4. [39] Chung H, Roberts CT, Greenberg S, Rebeck GW, Christie R, Wallace R, Jacob HJ, Hyman BT. Lack of association of trinucleotide repeat polymorphisms in very-low-density lipoprotein receptor gene with Alzheimer’s disease. Ann Neurol 1996;39:800 – 3. [40] Argraves KM, Battey FD, MacCalman CD, McCrae KR, Gafvels M, Kozarsky KF, Chappell DA, Strauss JF III, Strickland DK. The very low density lipoprotein receptor mediates the cellular catabolism of lipoprotein lipase and urokinase-plasminogen activator inhibitor type I complexes. J Biol Chem 1995;270:26550– 7. [41] Kirchgessner TG, Svenson KL, Lusis AJ, Schotz MC. The sequence of cDNA encoding lipoprotein lipase. A member of a lipase gene family. J Biol Chem 1987;262:8463–6. [42] Goldberg IJ, Soprano DR, Wyatt ML, Vanni TM, Kircheessner TG, Schotz MC. Localization of lipoprotein lipase mRNA in selected rat tissues. J Lipid Res 1989;30:1569–77. [43] Yaeoub LK, Vanni TM, Goldberg IJ. Lipoprotein lipase mRNA in neonatal and adult mouse tissues: comparison of normal and combined lipase deficiency (cld) mice assessed by in situ hybridization. J Lipid Res 1990;31:1845–52. [44] Lorent K, Overbergh L, Moechars D, De Strooper B, Van Leuven F, Van den Berghe H. Expression in mouse embryos and in adult mouse brain of three members of the amyloid precursor protein family, of the alpha-2-macroglobulin receptor/low density lipoprotein receptor-related protein and of its ligands apolipoprotein E, lipoprotein lipase, alpha-2-macroglobulin and the 40 000 molecular weight receptor-associated protein. Neuroscience 1995;65:1009–25. [45] Christie RH, Chung H, Rebeck GW, Strickland DK, Hyman BT. Expression of the very low-density lipoprotein receptor

[46]

[47]

[48]

[49]

[50]

[51]

251

(VLDL-r), an apolipoprotein-E receptor, in the central nervous system and in Alzheimer’s disease. J Neuropathol Exp Neurol 1996;55:491 – 8. Coleman T, Deip RL, Gimble JM, Lee D, Maeda N, Semenkovich CF. COOH-terminal disruption of lipoprotein lipase in mice is lethal in homozygotes, but heterozygotes have elevated triglycerides and impaired enzyme activity. J Biol Chem 1995;270:12518– 25. Weinstock PH, Bisgaier CL, Aalto-Setala K, Radner H, Ramakrishnan R, Levak-Frank S, Essenburg AD, Zechner R, Breslow JL. Severe hypertriglyceridemia, reduced high density lipoprotein, and neonatal death in lipoprotein lipase knockout mice. Mild hypertriglyceridemia with impaired very low density lipoprotein clearance in heterozygotes. J Clin Invest 1995;96:2555 – 68. Heegaard CW, Simonsen ACW, Oka K, Kjoller L, Christensen A, Madsen B, Ellgaard L, Chan L, Andrease PA. Very low density lipoprotein receptor binds and mediates endocytosis of urokinase-type plasminogen activator-type-1 plasminogen activator inhibitor complex. J Biol Chem 1995;270:20855– 61. Kasza A, Petersen HH, Heegaard CW, Oka K, Christensen A, Dubin A, Chan L, Andreasen PA. Specificity of serine proteinase/serpine complex binding to very-low-density lipoprotein receptor and a2-macroglobulin receptor/low-density-lipoprotein-receptor-related protein. Eur J Biochem 1997;248:270 – 81. Lorent K, Overbergh L, Delabie J, Van Leuven F, Van den Berghe H. Distribution of mRNA coding for alpha-2macroglobulin, the murinoglobulins, the alpha-2-macroglobulin receptor and the alpha-2-macroglobulin receptor associated protein during mouse embryogenesis and in adult tissues. Differentiation 1994;55:213 – 23. Kanaki T, Bujo H, Hirayama S, Tanaka K, Yamazaki H, Seimiya K, Morisaki N, Schneider WJ, Saito LY. Developmental regulation of LR11 expression in murine brain DNA. Cell Biol 1998;17:647 – 57.

. .