Multiple garlic (Allium sativum L.) microRNAs regulate the immunity against the basal rot fungus Fusarium oxysporum f. sp. Cepae

Accepted Manuscript Title: Multiple garlic (Allium sativum L.) microRNAs regulate the immunity against the basal rot fungus Fusarium oxysporum f. sp. Cepae Authors: Subodh Kumar Chand, Satyabrata Nanda, Rukmini Mishra, Raj Kumar Joshi PII: DOI: Reference:

S0168-9452(16)30801-9 http://dx.doi.org/doi:10.1016/j.plantsci.2017.01.007 PSL 9549

To appear in:

Plant Science

Received date: Revised date: Accepted date:

28-11-2016 21-12-2016 16-1-2017

Please cite this article as: Subodh Kumar Chand, Satyabrata Nanda, Rukmini Mishra, Raj Kumar Joshi, Multiple garlic (Allium sativum L.) microRNAs regulate the immunity against the basal rot fungus Fusarium oxysporum f.sp.Cepae, Plant Science http://dx.doi.org/10.1016/j.plantsci.2017.01.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Multiple garlic (Allium sativum L.) microRNAs regulate the immunity against the basal rot fungus Fusarium oxysporum f. sp. Cepae

Subodh Kumar Chand, Satyabrata Nanda, Rukmini Mishra, Raj Kumar Joshi*

Functional Genomics Laboratory, Centre of Biotechnology, Siksha O Anusandhan University, Bhubaneswar, Odisha, INDIA

*Corresponding author: Dr. Raj Kumar Joshi, Assistant Professor Functional Genomics Laboratory, Centre of Biotechnology, Siksha O Anusandhan University, Bhubaneswar-751003, Odisha, INDIA. [email protected]; [email protected]

HIGHLIGHTS



45 miRNAs responsive to F. oxysporum f.sp. cepae (FOC) were identified in A. sativum.



qPCR analysis classified miRNAs as positive, negative or basal regulator of defense against FOC.



RLM-5′-RACE analyses identified and validated distinct miRNA targets.



qPCR and north blotting revealed reciprocal alteration of miRNA and targets in the resistant and susceptible genotypes.



Transgenic overexpression of positive miRNAs resulted in decreased fungal growth and induction of defense genes.



Overexpression of miR164a, miR168a and miR393 could augment garlic resistance to FOC infection.

Abstract The basal plates rot fungus, Fusarium oxysporum f.sp. cepae (FOC), is the most devastating pathogen posing a serious threat to garlic (Allium sativum L.) production worldwide. MicroRNAs (miRNAs) are key modulators of gene expression related to development and defense responses in eukaryotes. However, the miRNA species associated with garlic immunity against FOC are yet to be explored. In the present study, a small RNA library developed from FOC infected resistant garlic line was sequenced to identify immune responsive miRNAs. Forty-five miRNAs representing 39 conserved and six novel sequences responsive to FOC were detected. qRT-PCR analyses further classified them into three classes based on their expression patterns in susceptible line CBT-As11 and

2

in the resistant line CBT-As153. North-blot analyses of six selective miRNAs confirmed the qRTPCR results. Expression studies on a selective set of target genes revealed a negative correlation with the complementary miRNAs. Furthermore, transgenic garlic plant overexpresing miR164a, miR168a and miR393 showed enhanced resistance to FOC, as revealed by decreased fungal growth and upregulated expression of defense-responsive genes. These results indicate that multiple miRNAs are involved in garlic immunity against FOC and that the overexpression of miR164a, miR168a and miR393 can augment garlic resistance to Fusarium basal rot infection.

Keywords: Allium sativum, Basal rot, Fusarium oxysporum f. sp. cepae, microRNAs, Plant immunity

1. Introduction Fusarium basal rot (FBR) caused by the soil borne fungus, Fusarium oxysporum f.sp. cepae (FOC) is one of the most severe diseases of garlic and is singly responsible for 60% yield losses in both bulb and seed crop throughout the world [1,2]. The pathogen infects the roots and basal plates of garlic causing symptoms at all phases of plant development ranging from damping off and delayed seedling emergence to bulb rot at pre- and post-harvest stages [2]. Attempted host resistance breeding of garlic against FOC has been highly ineffective due to variation in resistance response at the seedling and bulb development stages. Besides, FOC also produces Chlamydospores which can survive for many years in the soil, making disease management very challenging [2]. There is no perfect strategy for control of this disease because the molecular mechanism accentuating FOC infection is still highly ambiguous.

3

Plants exhibit a complex network of cellular and molecular processes in response to multiple stresses, including environmental factors and pathogen attacks [3]. The molecular and biochemical mechanisms governing the interaction between garlic and FOC have been investigated only to a limited extent. Transcriptome analysis of onion and garlic have demonstrated a number of differentially expressed genes related to antifungal R–protein [4], pathogenesis related protein (PR) [5], protein signalling and transcription factors. On the other hand, ten putative effectors have been identified in FOC, including seven secreted in Xylem (SIX) genes that facilitates pathogenesis [6]. Yet, the actual genetic networks associated with FOC-Allium interaction are poorly understood mainly due to lack of more comprehensive genome sequence knowledge. The high-throughput RNAsequencing (RNA-Seq) has emerged as a powerful and cost-efficient tool for decoding gene expression and regulation from both the host and the pathogen [7]. However, the full picture of genetic regulation during pathogenic infection includes not only protein coding genes, but regulatory non coding RNAs as well. Increasing evidences indicate that, endogenous small regulatory RNAs such as microRNAs (miRNAs) acts as a key component of the post-transcriptional gene regulation and display an important function in the regulation of plant growth and stress responses [8,9]. miRNAs are a group of negative non-coding regulators of 20-24 nucleotide (nt) length that are integrate into an RNA-induced silencing complex (RISC), which coordinates with Argonaute (AGO) protein and down regulate their mRNA targets through cleavage or translational repression [9]. During the last decade, plant miRNAs have been implicated in various biological processes such as organ development, signal transduction and responses to external stimuli including biotic and abiotic stresses [8]. Recent studies have shown that, miRNAs and the mediated RNA interference (RNAi) pathway components are crucial to plant immunity against multiple phytopathogens [10, 11]. A set of miRNAs including miR393, miR160 and miR398 have been identified to be responsive to pathogen

4

associated molecular pattern (PAMP) molecule flg22 and positively contributes to pathogen triggered immunity (PTI) [12]. Zma-miR393b plays an important role in defense against Rhizoctonia solani infection through a negative feedback regulation of a transport inhibitor response 1 (TIR1 F-box) gene in Zea mays [13]. Ectopic overexpression of miR160a and miR398b displayed enhanced resistance to M. oryza, as revealed by decreased fungal growth and up-regulated expression of defense-related genes [14]. Similarly, a genome-wide sRNA sequencing and transient overexpression analysis revealed that miR319, miR394 and sly-miRn1 are involved in the regulation of tomato immunity against Botrytis cinerea [15]. In contrast, miR400 mediated dysfunction of the mRNA encoding pentatricopeptide repeat (PPR) protein renders Arabidopsis thaliana more susceptible to B. cinerea [16]. More recently, the overexpression of potato miR482e demonstrated enhanced plant sensitivity to Verticillium dahliae due to cleavage of nucleotide binding site leucine rich repeat (NBS-LRR) resistant target transcripts [17]. All these reports suggest critical involvement of miRNAs towards reprogramming of immune responses in different pathosystems. In one of our recent study, we demonstrated the involvement of miR394 in regulating induced defenses and JA signaling networks in garlic post infection with FOC [18]. Based on this study, we hypothesize that specialized miRNAs may be master regulators of garlic immunity against FOC. In the present work, we performed a systemic screen by comparing the abundance of miRNAs in the resistant garlic line CBT-As153 and the susceptible line CBT-As11 to identify miRNAs involved in the defense response of garlic against the basal rot fungus. By sequencing and qRT-PCR analyses, we identified candidate miRNAs with differential response to FOC infection. Further, we also developed and analyzed transgenic garlic plants ectopically overexpresing miR164a, miR168a and miR393 to assess their ability in engineering garlic resistance to FOC.

2. MATERIALS AND METHODS 5

2.1 Plant material, pathogenic infection and RNA isolation Cloves of two garlic (A. sativum) accessions, namely CBT-As153 (FOC resistant-T) and CBTAs11 (FOC susceptible-S) were treated with 7% hypochlorite solution for 30 min followed by three washes with sterile water and sowed in pots with autoclaved soil. The cloves were grown in plant growth chamber following the conditions mentioned in [18]. Ten-day old seedlings, free from microorganisms were used for FOC (strain FOC-CBT3) inoculation as described previously [19]. Whole seedlings of control and treated samples were harvested at 0, 12, 24, 48 and 72 h after treatment. A set of five plants was collected for each time point of the experiment and pooled together for RNA extraction. A second experiment of FOC infection was performed under similar condition. The samples were pooled together from all time points in the pathogen inoculated (PI-T and PI-C) and the mock inoculated (MI-T and MI-C) condition for small RNA (≤200 nucleotides) extraction. A. sativum cv. Plant samples were immediately frozen in liquid nitrogen and grounded into a fine powder. Total RNA was isolated from the frozen samples using Trizol reagent (Invitrogen, Darmsradt, Germany) and treated with DNAse I (Promega, Madison, WI) as per manufacturer’s instructions. The quality and purity of RNA was assayed by a NanoDrop ND-1000 spectrophotometer (Therma Scientific, Waltham, USA) and the integrity was confirmed using RNA6000 nano kit on the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA samples with 260/280 nm ratio between 2.0 and 2.1 and RNA integrity number (RIN) more than 8 were used for further analysis. Small RNA was extracted using a MirVana miRNA isolation kit (Ambion, Foster City, CA) according to the manufacturer’s instructions. Fifty milligrams of plant samples was used and the small RNA was dissolved in 50 µl of nuclease free water. 2.2 Construction of small RNA library

6

The small RNA library was constructed from FOC infected garlic samples of CBT-As153 genotype according to the procedures previously described [18]. Precisely, small RNAs were polyadenylated using 5U of E. coli poly (A) polymerase at 37 °C for 30 min. Polyadenylated RNA was

ligated

to

a

5’

adapter

(5’

CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA 3’) using T4 RNA ligase. 1.5 µg adapter ligated poly (A) small RNA was used for first strand cDNA synthesis in a 20 µl reacture mixture consisting of 1 µg RT primer (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30), 2 µl 10x buffer, 2 µl dNTP mix (10 mM) and 200U of Superscript III reverse transcriptase (Life Technologies, Burlington, ON). The reaction was set at 30 °C for 5 min and 42 °C for 30 min followed by 5 min at 75 °C for heat inactivation. The cDNA amplification was performed using 200 μM dNTP mix, 5 pmol each of forward primer (5’ ATTCTAGAGGCCGAGGCGGCCGACATGT 3’) and reverse primer (5 GGACACTGACATGGACTGAAGGAGTA 3’), 1X PCR buffer and 1 U of Taq polymerase (Promega, Madison, WI). The PCR products were separated on 12% polyacrylamide gel and stained with ethium bromide. The gel slices containing cDNA with a size between 110-120 bp were excised, gel purified (Wizard SV gel and PCR cleanup system, Promega, Madison, WI) and cloned into pTZ57R/T vector using InsTA clone T/A cloning kit (Fermentas Life Sciences, Hannover, Germany). The cloned fragments were subsequently sequenced using Big Dye Terminator Cycle DNA Sequencing kit (Perkin Elmer, Norwalk, USA) on a 3730 DNA analyzer (Life Technologies, Burlington, ON, Canada). 2.3 Sequence analysis and identification of candidate miRNAs The sequenced fragments were processed to remove the adapters. The adapter trimmed sequences were searched for non-coding RNAs against the non-redundant GenBank database (www.ncbi.nlm.nih.gov/genbank), Rfam database ver 12.0 (www.rfam.xfam.org) [20] and de novo

7

sequenced transcriptome libraries of garlic [21,22,23]. The sequences were further used for homology search against the known mature plant miRNA sequences in miRBase (Release 21; http://www.mirbase.org/search.shtml). The pairwise alignment of sequenced transcripts against known miRNAs was achieved using BLASTn algorithms with a threshold of E value at 10. The criteria for identifying candidate miRNAs were: (1) length of the predicted miRNA should be at least 18 nt without gaps, and (2) maximum allowed mismatches between known miRNAs and the predicted sequences should be less than three. miRNA sequence that matched with miRNAs from other plants were considered conserved while the sequences that had no match with existing miRNAs were considered novel. The complete sequences of the cloned RNAs were folded using the Zuker folding algorithm in the MFOLD program [24] to produce the secondary hairpin structure. The miRNA precursors were confirmed by subjecting the hairpin structures to the following criteria: (1) the hairpin structure of the RNA sequence should contain the ̴ 18 nt mature miRNA in one arm of the stem-loop, (2) <4 nt mismatch between miRNA and miRNA*, (3) percentage of paired bases should be more than 50%, (4) minimal bulge size should be one or two bases and frequency should be one or less asymmetric bulges within the miRNA/miRNA*. The identified miRNA precursors were further subjected to NCBI and EST BLAST with 75% query coverage and no gap. 2.4 Northern blot analysis Northern blot analyses for small RNAs from total extracts were performed as described previously [18]. Ten-day old seedlings inoculated with 40 µl of conidial suspension were used for RNA extraction at 0, 12, 24, 48 and 72 hpi. Total RNA was separated on a 15% denaturing polyacrylamide gel and blotted overnight on an Ambion Bright Star Plus positively charged nylon membrane (Life Technologies, Carlsbad, USA) by capillary transfer method. RNA on the membrane was subsequently fixed by ultra violet crosslinking. Antisense probes designed from mature

8

miRNAs, mentioned in table S1 were biotinylated using the MAXI Script labeling kit (Life Technologies, Carlsbad, USA) as per the manufacturer’s instructions. RNA blots were hybridized with the biotinylated probes using the Northern Max kit which includes the ULTRA Hyb hybridization buffer (Life Technologies, Carlsbad, USA). Hybridization was followed by multiple washing steps to remove the non-specific hybridization and background interference. Finally, the biotinylated probe-target hybridization was detected using the Bright Star Bio detect non-isotopic detection kit (Life Technologies, Carlsbad, USA). Small nuclear RNA U6 was used as a loading control. 2.5 Identification and enrichment of miRNA target genes Putative targets for candidate miRNAs were identified using the psRNA-Target webserver (http://plantgrn.noble.org/psRNATarget/) [25]. A pairwise sequence similarity analysis was performed by subjecting mature miRNAs as query against a newly curated de novo assembled garlic transcriptome sequences (unpublished) as well as previously assembled garlic transcripts [21,22,23]. The parameters for identification of miRNA targets are as follows: mismatches between miRNA and target: ≤2; length for complementary scoring: 20; maximum energy allowed to unpair the target site: 23; flanking length around the target site for accessibility: 17 bp upstream/13 bp downstream; range of central mismatch leading to translational inhibition: 9-10 nt; number of target genes for each miRNAs: 30. The potential miRNA targets were subjected to functional enrichment analysis using the BLAST2GO program (http://www.blast2go.com/b2ghome) [26] with the default parameters used to obtain the gene ontology terms. 2.6 Target prediction and validation by RLM-5’RACE The RNA ligase mediated 5’ rapid amplification of cDNA ends (RLM-5’RACE) assay was performed using the Gene Racer kit (Life Technologies, Carlsbad, USA) to validate the cleavage site

9

of miRNAs on the predicted targets. Briefly, 2 µg of the total RNA was ligated to a 5’ RACE RNA oligo adapter using T4 RNA ligase and subsequently reverse transcribed using Superscript III reverse transcriptase and random hexamer primer. The cleaved site of the target gene was PCR amplified using a 5’ RACE primer and a gene specific reverse primer (Table S2). A touch down PCR was performed in a Veriti gradient thermal cycler (Applied Biosystems) with the following temperature conditions: 94 oC for 2 min, followed by five cycles at 94 oC for 30 s and 72 oC for 60 s, five cycles at 94 oC for 30 s and 72 oC for 90 s, and 25 cycles at 94 oC for 30 s, 65 oC for 30 s and 72 oC for 90 s and final extension at 72 oC for 10 min. A second PCR was performed using a nested 5’ RACE primer, gene specific nested reverse primer and 2 µl of the initial PCR product as template. The nested PCR conditions were as follows: 2 min at 94 oC followed by 25 cycles of 30 s at 94 oC, 30 s at 65 oC, 2 min at 72 oC and final extension of 10 min at 72 oC. The amplified product was resolved on 1.2% agarose gel, cloned into the pGEM-T easy vector (Promega, Manheim, Germany) and sequenced to confirm the cleavage site.

2.7 Expression analysis of miRNA and target genes Stem-loop RT-PCR was performed to determine the differential expression pattern of all the mature miRNAs in response to FOC infection. The base-loop RT primers and miRNA specific forward primers were designed by adopting the method described by Varkonyi-Gasic et al [27]. cDNA synthesis was carried out with 2 μL of 10X RT buffer, 1 µL 15 mer Oligo-dT primer (500ng/ µL), 1 µL of miRNA specific stem-loop primer (1 µM) (Table S3), 2 μL of 10 mM dNTP, 2 μg template RNA and 200 units of Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA). For cDNA synthesis, following reaction conditions were used: 16 oC for 30 min (1 cycle), 30 oC for 10 s,

10

42 oC for 10 s and 50 oC for 2 s (60 cycles) and 85 oC for 5 min (1 cycle). Similarly, 2 μg of total RNA of each sample was also used for the cDNA synthesis of predicted targets using the Superscript III reverse transcriptase kit following manufacturer’s instructions. qPCR analysis of the mature miRNAs and the target genes was carried out on a StepOne Plus real time PCR system (Applied Biosystems, Waltham, MA) using a FASTSYBR Green PCR mix (Life Technologies, Burlington, ON, Canada) and sequence specific forward and reverse primer (Table S3 & S4). The reaction setup was as follows: 3 min of initial denaturation at 94 oC followed by 35 cycles of 30 s at 94 oC, 30 s at 60 oC and 30 s at 72 oC. The U6 small nuclear RNA and Actin 1 gene from garlic were used as internal control to determine the relative quantity of miRNAs and target transcripts respectively by the comparative 2-ΔΔCt method [28]. The invariant expression of U6 and Actin 1 in response to FOC was checked beforehand. The qPCR reactions were performed in triplicates with three independent experiments. The statistical significances of the qPCR results were analyzed with two-way analysis of variance (ANOVA) and multiple comparisons were done using uncorrected Fischer’s LSD test. Differences in the results were scored as statistically significant at p< 0.05. 2.8 Construction of miRNA overexpression transgenic lines To generate the overexpression constructs DNA fragment of 273, 289 bp and 302 bp surrounding the miRNA sequence that includes the fold back structure of miR164a, miR168a and miR393 respectively was amplified from the genomic DNA of A. sativum ac. CBT-As153. Primers used for making constructs are listed in table S5. The amplified products were inserted into the pENTR/DTOPO vector to develop gateway entry clone “pENTR/D-TOPO-miR164a”, “pENTR/D-TOPOmiR168a” and “pENTR/D-TOPO-miR393”

using pENTR/D-TOPO cloning kit (Invitrogen)

following manufacturer’s instructions. The cloning of the fragment was confirmed by sequencing.

11

The full length cloned fragment of miR164a, miR168a and miR393 were then inserted downstream of Cauliflower mosaic virus (CaMV) 35S promoter in the pEarleyGate 103 plasmid using the LR clonase reaction. Garlic cv. Yamuna Safed 4 (YS4) being a superior yielding variety of A. sativum and highly sensitive to FOC [29] was used for transgenic analysis. Calli was induced from the root segment of in vitro plantlets of YS4 on Murashige and Skoog (MS) medium supplemented with 1.0 mg/L 2, 4-D and 0.2 mg/L IAA for 2 months. Constructs were transformed into YS4 calli using a super virulent Agrobacterium tumefaciens LBA4404 strain as per the method described previously [30]. Empty pEarleyGate 103 plasmid was used as vector control. Selection of transgenic garlic plants was done using 50 mg/l Basta solution and confirmed by PCR amplification with vector primers of bar gene and specific primer for asa-miR164a, asa-miR168a and asa-miR393 precursor sequences. Selected transgenic lines were further subjected to southern hybridization using a bar gene specific probe. The selection process was repeated for two generations to get homozygous transgenic plants for further experiments.

2.9 Pathogen infection assay FOC mycelial plugs from PDA plates were transferred to potato-dextrose broth and grown at 26 o

C for five days on a rotary shaker. The mycelium and broth were comminuted with a blender and

centrifuged at 3500 rpm for 10 min. The spore containing pellet was resuspended in potato-dextrose broth, filtered through cheese cloth and adjusted to 3 x 105 conidia/ml. The garlic cloves were sown in pots with autoclaved soil and acclimatized in growth chamber as per condition described previously [18]. The garlic pots were added with 40 ml of conidial suspension (containing 5 x 106 conidia/ml) and incubated at 26/27 oC with 12 h photoperiod. Controlled cloves were mock

12

inoculated with 40 mL of sterile distilled water. The lesion length and disease severity were observed at 9 dpi. The lesion types were scored from 0 (resistant) to 3 (susceptible) using a standard reference scale [29]. The sporulation rate on the lesions and the fungal mass in the infected garlic cloves were measured by following the method as described for Magnaporthe oryzae [14, 31] with desired modification for FOC. Briefly, a portion of the lesion was cut from the basal plate and placed in 100 µL distilled water and 1% Tween 20. The spores were dislodged from the sample by vortexing it for 2 min and the number of spores per mL was determined with a haemocytometer under a microscope. For the measure of fungal biomass, a piece of infected garlic tissue was cut and DNA extracted using the CTAB method. Purified DNA was subjected to DNA based qPCR using two sets of specific primers-

FOC

specific

Fot1

(5’-CTCTGCGGACGACCTAGAAAA-3’

and

5’-

TCGTAGGGTGCTGGGTGGTA-3’) and garlic Actin 1 (5’-TCCGCCTTGTTGTGTGCAT-3’ and 5’-GGGCTTGCTTTGAGCACTCT-3’). The threshold values (Ct) of FOC-Fot1 and As-Act1 was measured and the Ct of Act1 was subtracted from the Ct of Fot1. The relative fungal growth was then calculated as a ratio of FOC-Fot1 and AS-Act1 represented by the equation ECt(As-Act1) - Ct(FOC-Fot1) , with 2 as the value for amplification efficiency for the primer pairs.

2.10 Expression analysis of defense responsive genes in transgenic garlic lines qPCR was performed to monitor the expression analysis of important defense responsive genes in transgenic A. sativum. Leaf samples were collected from WT and transgenic plants at different time points post-inoculation with FOC, frozen in liquid nitrogen and stored at -80 °C. Total RNA isolation, cDNA synthesis and qPCR analysis were performed as discussed earlier. Gene specific primer sequences used in this study are presented in supplementary table S6.

13

3. Results 3.1 Validation of defense response in resistant line To identify immune responsive miRNA in garlic against basal rot fungus, two accessions- CBTAs153 and CBT-As11 with variable sensitivity to FOC were exposed to the pathogen for various time periods. CBT-As153 is a major source of disease resistance genes and exhibit a high level of resistance against multiple FOC isolates [4,19]. In contrast, CBT-As11 is a highly susceptible line and no major R-gene is ever isolated in it [19]. Although, the small seedlings of both accessions showed no visible symptoms of FOC infection in terms of lesion development, there was a slight difference in growth pattern (Figure 1A). While, the CBT-As153 seedlings showed a uniform and gradual growth with time, the CBT-As11 plants were wrinkled, yellowed and demonstrated growth retardation. Further, the CBT-As153 cloves were symptomless whereas the CBT-As11 clove showed sunken, yellow brown rotten lesions at the basal regions which gradually rose upwards (Figure 1B). We analyzed the qRT-PCR expression of five resistant marker genes- A. sativum resistant (R) gene (AsR1), A. sativum pathogenesis related protein 5 (AsPR5), AsPR1, AsPR3 and peroxidase 1 (AsPRX1) in resistant and susceptible plants to validate the defense response in resistant line. The results showed that, AsR1 was induced 2.8-, 6.3-, 8.8- and 7.8- fold in 12, 24, 48 and 72 h, respectively in CBT-As153 while it was negligible in CBT-As11. Likewise, the transcripts of other defense related genes- AsPR5, AsPR1, AsPR3 and AsPRX1 were significantly induced in CBT-As153 in comparison with those in CBT-As11 (Figures1D to 1G). Taken together, these data suggest that CBT-As153 exhibit a strong defense response and therefore can be used as a suitable material for subsequent screening of miRNAs involved in defense against FOC. 3.2 Identification of miRNA from garlic sRNA library

14

To obtain miRNAs involved in garlic immunity against FOC, a sRNA library was constructed from pooled tissues of CBT-As153 genotype post infection with FOC. DNA sequencing and data searching resulted in the characterization of 226 garlic clones.

The sequences in the library

represented several kinds of cellular RNA fragments (Table 1). More than 68% of the cloned sequences correspond to complete or breakdown products of abundant non-coding RNAs including transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs) and repeat associated small interfering RNAs (rasi-RNAs). Also, one cloned fragment represented a genomic sequence and another fragment corresponded to mitochondrial transcript. In addition to this, 37 cloned fragments did not match with any genomic sequences and were of unidentified nature. The rest of the 45 cloned fragments from the sRNA library were identified as miRNAs (Table S7). A comparison of these sequences with the known plant miRNAs in the miRBase (release 21) revealed 39 conserved miRNAs from 24 miRNA families. The remainder of the 6 clones did not match any known miRNA inspite of having typical hairpin characteristics of miRNA precursors. Therefore, we reasoned that they are novel miRNAs and named as asanovel_miRx. Secondary structure prediction of the miRNA clones by Mfold resulted in hairpin miRNA precursors similar to other plant miRNAs (dataset S1). The lengths of the predicted pre-miRNA hairpin structures varied from 89 to 114 nucleotides (nt) with an average length of 103 nt. Nine out of the 45 hairpin forming structures were chosen for experimental validation through North-blot analysis. Results demonstrated that the conserved and novel miRNAs were distinctively mapped onto the selected precursor structures with a size of 21-22 nt (Figure 2). Further, each precursor structure was able to express only one functional miRNA either in the 5’ or in the 3’ region of the hairpin showing a clear distinction between the miRNA and miRNA*. The expression pattern of the nine

15

selected miRNA was further confirmed by stem-loop PCR. Results showed that, the PCR products were about 60-62 bp in length and all the 9 miRNAs were found to be expressed in both infected and control tissues (Figure S1). 3.3 Prediction and validation of miRNA targets To understand and assign functions to garlic miRNAs, we performed target prediction using the webserver, PsRNATarget. Assuming that plant miRNA exhibit high homology with their target mRNA within the open reading frames [32], FASTA search was performed to predict targets for miRNAs in a manually curated de novo assembled transcriptome library of garlic and UniGene transcripts from NCBI (http://www.ncbi.nlm.nih.gov/unigene). Accordingly, we identified 128 potential target genes for 39 conserved and six novel miRNA families (Table S8). In concurrence with the literature, most of the targets predicted for miRNAs were transcription factors (TFs) including the members of the regulatory elements such as Squamosa promoter binding like (SPL) protein, NAC domain protein (a member of NO APICAL MARISTEM/ Arabidopsis thaliana transcription factor (ATAF1/2) / CUP-SHAPED COTYLEDON (CUC) family), Auxin response factors (ARFs), Myloblastosis (MYB) TFs, Nuclear transcription factor Y 1 (NFY1) and zinc-finger proteins. These TFs regulate the expression of various genes and hormones during plant growth, development and stress responses [33, 29]. Besides, many of the potential targets shared high homology with target orthologs from other plants and demonstrated similar functions. For instance, asa-miR168 targeting Argonaute 1 (AGO1) protein, asa-miR393 targeting TIR1 (transport inhibitor response 1), asa-miR482/asa-novel-miRn3 targeting nucleotide-binding site leucine rich repeats (NBS-LRR) proteins, asa-miR400/asa-novel-miRn6 targeting pentatrichopeptide repeat (PPR) proteins had been previously implicated in the regulation of plant growth and host-microbe interaction [13,17,33,29].

16

To have a comprehensive idea about the miRNA-gene regulatory networks, we subjected the identified targets to GO analysis using Blast2GO program. The GO analysis categorized 37, 34 and 13 target genes into biological process, molecular function, and cellular component, respectively (Figure S2 & Table S9). Majority of targets were involved in a broad range of biological processes, including metabolic process (37), response to extracellular stimulus (25), immune system process (21), signaling (18) and defense response (16). Seven targets (ASCN_12949; ASCN_1887; ASCN_19322; ASCN_3549; ASCN_606; ASCN_239; ASCN_1538) were found to be specifically involved in defense response to fungal phytopathogens. Similarly, the putative target transcripts of miRNAs in the molecular function category were largely related to catalytic activity (34), binding (31) and transcription factor activity (19). To validate the computationally predicted miRNA-target interaction in garlic, RLM-5’RACE analysis was performed for 18 target genes representing 13 conserved and five novel miRNAs. All the predicted targets such as SPL1, MyB30, ARF10, NAC1, HD-ZIP, AGO1, SCL, AP2, TCP14, TIR1, LRR-kinase and PPR1 for the conserved miRNAs demonstrated distinct miRNA directed cleavage at specific sites through RLM-5’RACE (Figure 3). The majority of miRNAs were highly conserved and cleaved their respective targets at the 10th nucleotide position, the same cleavage site frequently observed in plant species [34]. miR156 targeted SPL family genes at the 9th position and miR171 targeted the SCL TFs at the 13th position from 5’ end of mRNA, which is similar to the one validated for B. napus miRNAs [29]. Likewise, garlic specific miR7722 targeted GRAS family proteins at the 11th position from 5’ end of miRNA. Four out of five novel miRNAs could be validated by RLM-5’RACE reaction. Novel_miRn1 targeted the A. thaliana F-box homolog (ASCN_239) at the 10th position while novel-miRn2 cleaved ASCN_15843, a WRKY homolog of O. sativa at the 9th position. Novel_miRn3 and novel_miRn6 exhibited cleavage sites for disease

17

resistance (R) protein gene and PPR gene, respectively at the 8th nucleotide position which is highly unusual from previous prediction. 3.4 Identification of miRNAs involved in garlic-FOC interaction Established on the hypothesis that, defense responsive miRNA can display dynamic expression patterns upon pathogen infection, qRT-PCR was performed to compare the relative abundance of miRNAs in the control and treated samples of CBT-As153 and CBT-As11 at different time points post infection with FOC. The 45 miRNAs could be categorized into three classes based on a significant change in their trend for accumulation upon FOC infection (Figure 4, table S10). Ten miRNAs which either showed no obvious change or reduced expression in CBT-As11 but significantly increased in CBT-As153 (i.e. miR160e, miR164a and eight others) were classified as having a positive role in garlic resistance to FOC (Figure 4A). Similarly, sixteen miRNAs which showed upregulated expression in CBT-As11 but no obvious changes or decreased expression in CBT-As153 (i.e. miR156b, miR156e and 14 others) were classified as negative regulators (Figure 4B) (Table S10). Rest of the 19 garlic miRNA with increased expression in both CBT-As153 and CBT-As11 upon FOC infection (i.e. miR159a, miR393 and 17 others) were catalogued as basal responsive miRNAs (Figure 4C). The expression patterns of six miRNAs including three positive (miR164a, miR168a and novel_miRn1), one negative (miR396) and two basal regulators (miR169a and miR393) was analyzed by small RNA blotting to verify the qRT-PCR results. The northern blotting demonstrated a concomitant expression pattern with the qRT-PCR data. As revealed from Figure 5A, the accumulation of miR164a, miR168a and novel_miRn1 was significantly induced in CBT-As153. This corroborated with no visible symptoms in the seedlings of the resistant genotypes (Fig.S3). In contrast, miR396 transcripts were significantly increased in CBT-As11. On the other hand, miR169a,

18

and miR393 being basal responsive were obviously increased in both the resistant and susceptible genotypes. 3.5 Expression pattern of the FOC responsive miRNA targets miRNAs regulate the gene expression through cleavage or translational repression of the target genes [9]. Therefore, we examined the expression profiles of a selected set of target genes using qRT-PCR. The level of target gene expression was determined in 12, 24, 48 and 72 hpi samples of CBT-As11 and CBT-As153. The results showed a negative correlation between the abundance of the targets and their corresponding miRNAs (Figure 5). The genes encoding NAC TF (ASCN_3549), AGO1 like protein (ASCN_5455) and F-box family protein (ASCN_239), which were targeted by miR164a, miR168a and miRn1 respectively, were significantly down regulated in the FOC inoculated CBT-As153 line and upregulated in the susceptible CBT-As11 line (Figures 5B-D). In contrast, the target gene of the negatively regulating miRNA GRF3 (ASCN_418) was upregulated in the resistant genotypes and significantly down regulated in the susceptible plant (Figures 5E). However, the targets of the miRNAs involved in basal response against FOC were significantly down regulated in both the genotypes (Figures 5F-G). These results suggest that, the selected miRNAtarget pairs exhibited clear reciprocal changes in their expression levels, whereby an increase or decrease in miRNA abundance post infection with FOC was accompanied by a reciprocal alteration in the expression levels of the target gene. 3.6 Enhanced defense responses to FOC in transgenic lines over expressing miR164a, miR168a and miR393 To study the regulatory function and verify the representatives of the miRNAs involved in defense response to FOC, we followed a transgenic approach towards over-expression of precursor miRNAs in the susceptible garlic line YS4. The two positive regulators, miR164a, and miR168a were

19

put into Gateway plasmid constructs and transformed using Agrobacterium tumefaciens. After two rounds of selection with Basta solution, T2 transgenic plants were selected from both the miRNA transformation groups based on positive amplification of 400bp bar gene fragment and specific amplification of 307 and 233 bp fragment for miR164a and miR168a precursor sequences respectively (Figures S4 & S5). Ten selected transgenic plants from both the transformation groups were further confirmed by southern hybridization. Subsequently, 3 independent transgenic lines (35S:miR164a#3; 35S:miR164a#5 and 35S:miR164a#6) with high expression for miR164a were identified by qRT-PCR and RNA blot analysis (Figures 6A & B). The expression of miR164a target genes, ASCN_3549, ASCN_606 and ASCN_3199 and ASCN_79852 all of which encode NAC domain proteins were significantly reduced to less than 20% as compared to the control (Figure 6C). The transgenic lines were then inoculated with FOC and disease phenotype recorded at 7dpi. The number of necrotic lesions was obviously less or completely absent in the transgenic lines overexpressing miR164a as compared to the control (Figure 6D). Further, the spore numbers and relative fungal mass in the infected tissue were significantly reduced (Fig 7E & F). A similar kind of result was also obtained with three selected transgenic lines (35S:miR168a#2; 35S:miR168a#6; 35S:miR168a#8) overexpressing miR168a (Figure S6). We also evaluated the functional characteristics of miR393, a basal responsive miRNA, which was induced by 4.8-fold in CBT-As11 and 7.3 fold in CBT-As153 upon FOC infection. Agrobacterium mediated transformation of garlic cv. YS4 with 35S:miR393 construct resulted in 14 transgenic lines after two rounds of Basta selection. Eleven out of the 24 transformants were verified as positive transgenic lines with expected amplification of 400 and 306bp fragments for bar and miR393 precursor sequence respectively (Figure S7). Southern blot analysis of the eleven transgenic lines using a probe specific to the bar gene sequence showed one or two copies of the fragments

20

inserted into the transgenic garlic genome. RNA blotting and qRT-PCR resulted in the identification of three transgenic lines with high accumulation of miR393 (Figures S8A & B). qPCR analysis revealed reduced expression of the target genes in the three miR393 transgenic lines (Figure S8C). Inoculation assay with FOC revealed very less or no necrotic lesions in the miR393 overexpressive lines (Figure S7D). Consistently, the spore number and relative fungal biomass in the infected tissue were also significantly reduced in 35S:miR393 lines as compared to the control plant (Figures S8E & F). Based on the theory that the resistant phenotypes usually go together with upregulation of defense related genes, we analyzed the transcript levels of various defense related genes in transgenic lines overexpressing miR164a, miR168a and miR393. As expected, the transcript levels of AsR1, AsPR1, AsPR3, AsPR5 and AsPRX1 had a gradual and significant rise as early as 12 hpi in the transgenic lines while the expression in the control line was poor and remained more or less unchanged across all time points (Figure 7). Transgenic line overexpressing miR168a displayed the highest expression for AsR1 and the two PR genes, AsPR3 and AsPR5. Likewise, the transgenic line 35S:miR164a#6 reported highest induction for AsPR1, while the expression for AsPRX3 was highest in miR393 overexpression line. Altogether, the results from the transgenic lines signify that the two positively regulating miR164a and miR168a and the basal responsive miR393 extensively contribute to the suppression of FOC infection and may act differently in garlic immunity against the basal rot fungus.

4. Discussion Fusarium basal rot caused by FOC is the most destructive disease and is accountable for rigorous yield losses in both pre and post harvested crops of onion and garlic. Although, garlic cultivar CBTAs153 possesses resistance to the FOC and many genes were shown to be induced upon basal rot

21

infection [4, 5], the genetic, epigenetic and molecular mechanisms of FBR resistance was not yet clear. miRNAs have been found as ubiquitous post-transcriptional regulators in many eukaryotic plants and are involved in the response to various biotic and abiotic stresses [11, 35]. Previous reports have shown the involvement of miRNAs in plant immunity against various fungal pathogens [14, 15, 29, 36]. Therefore, the identification of host miRNAs that are differentially induced by pathogen infection will lay a comprehensive foundation for unraveling the complex miRNA-mediated regulatory networks and examine their function in the immunity of garlic to the FOC infection. To prove the hypothesis that miRNAs play a role in regulating host immunity against FOC, we constructed and sequenced a small RNA library from FOC inoculated tissue of the garlic cultivar CBT-As153. In total, we identified 45 garlic miRNAs, which included 24 conserved and 6 novel miRNA families. Earlier, a similar approach was used to isolate 28 miRNAs of 214 clones from resistant turmeric rhizomes post inoculated with Pythium aphanidermatum [37]. Despite the fact that deep sequencing has the capability to produce a huge amount of small RNA data, the cloning strategy used in the present study was found highly reliable for characterization of garlic miRNAs especially with fewer inputs, less cost and little available genomic information. Additionally, it is more advantageous over other traditional cloning protocols in terms of the requirement of only a small amount of plant tissue for RNA extraction and applicability of the method towards cloning of other small RNAs. Thirty-nine conserved miRNAs were identified in the present study (Table S7), the majority of which found a perfect match with known miRNAs from Oryza sativa, Zea mays and Linum usitatissimum. These miRNA families are possibly stress responsive and specifically expressed during necrotrophic fungal infection [14, 15, 37, 38]. Further, only six novel miRNAs could be identified in the present analysis. This is consistent with previous reports predicting that novel

22

miRNAs are often less in number and expressed at a lower levels as compared to the conserved miRNAs [37, 39]. Furthermore, a lesser number of miRNAs might be attributed to a smaller number of clones obtained from the sRNA library. Therefore, the structure of libraries with larger datasets together with high-throughput sequencing is required to identify and characterize more novel miRNAs in garlic. The qRT-PCR analysis often reflects the miRNA expression abundance as obtained from deep sequencing data [40]. Therefore, miRNA accumulation was systemically assayed by qRT-PCR in garlic seedlings of susceptible and resistant lines upon FOC infection to define the contribution of host miRNAs to FBR resistance. In total, we found the representatives from all the 24 conserved and 6 novel miRNA families that are apparently involved in innate immunity against the basal rot fungus FOC (Figure 4). Members of miR167 and miR169 families were differentially responsive to FOC infection. Whilst miR167a/b/c serve as positive regulator for garlic immunity, miR167f act as negative regulators. Similarly, miR169h might negatively function in garlic immunity against the basal rot fungus even as miR169a/b act in basal response to FOC infection. A previous study in rice also reported similar differences in the expression patterns of miRNA response to infection by the necrotrophic fungal pathogen Magnaporthe oryzae [14]. Another study has shown that miR169b was highly differentially regulated in wheat cultivars with contrasting response to Fusarium culmorum [41]. Therefore, the identified miRNAs involved in garlic immunity could be further analyzed to determine their role in post-transcriptional gene silencing towards garlic resistance to basal rot fungus. In the present study, miR164a, miR168a and miR393 were significantly up-regulated while their target genes were reciprocally altered in the resistant and susceptible lines upon FOC infection. The

23

transgenic lines individually overexpressing miR164a, miR168a and miR393 exhibited significant resistance to FOC, as demonstrated by weaker disease phenotypes, poor growth of the fungus in the infected tissues and up-regulated expression of the defense responsive genes. A previous report has shown that overexpression of positive or basal responsive miRNAs can enhance disease resistance to necrotrophic fungi [14, 15]. The R-gene, AsR1 and the four PR genes, AsPR1, AsPR3, AsPR5 and AsPRX were significantly induced in the miRNA overexpression lines upon FOC infection. AsR1 is an NBS-LRR class R-proteins that are normally associated with effector triggered immunity (ETI) against pathogens [42]. Further, the PR proteins accumulate not only locally in the place of infection, but are also formed systemically following any kind of infection [43]. Taken together, it may be assumed that miR164a, miR168a and miR393 might act in positive regulation of post invasive defense responses in garlic against the infection of the basal rot fungus. miRNA mediated modulation of the target gene expression may regulate plant signaling towards activation of its defense mechanism [14]. The positive regulation of garlic immunity by miR164a, miR168a and miR393 in the present study also suggests the potential involvement of their target genes in resistance. The NAC1 and NAC2 TFs targeted by asa-miR164a have been demonstrated to play important roles in the regulation of the plant innate immune system, basal defense and systemic acquired resistance [44]. Oryza sativa NAC proteins (OsNAC4 and OsNAC) are major regulators of pathogen triggered immunity (PTI) against the blast fungus M. oryzae [45]. While a number of NAC proteins positively regulate the plant defense, a selective group of NACs including ATAF1 and ATAF2 from A. thaliana attenuate the resistance against both necrotrophic fungal and bacterial pathogens through repression of PR-genes [46, 47]. Transgenic Arabidopsis with ATAF1 chimeric repressor construct demonstrated up-regulated expression of PR-genes and enhanced resistance to necrotrophs like Botrytis cinerea and Alternaria brassicicola [47]. These reports together with our

24

results suggest that, the up-regulated expression of miR164a might result in a decrease in the level of NAC proteins, thereby inducing hypersensitive response (HR), and cell death at the infection site to prevent fungal colonization. AGO1 protein targeted by the conserved miR168a is a key component in many miRNA biosynthetic pathways regulating various physiological processes, including PAMP-triggered plant innate immunity [12, 32]. Varallyay et al [48] demonstrated that, the expression modulation of miR168 upon Cymbidium virus infection causes attenuation of the antiviral function of AGO1 protein. Recently, Shen et al [29] demonstrated that A. thaliana mutant line mir168 exhibits high sensitivity to V. longisporum, while ago1 mutants show reduced disease symptoms and enhance resistance. In the present study, a clear reciprocal alteration in the abundance of miR168 (upregulation) and expression of its targets (down-regulation) in the resistant garlic lines suggest an indispensable role of miR168-AGO1 networks in garlic-FOC interaction. Further, a recent report has shown that B. cinerea sRNA effectors (Bc-sRNAs) hijack the host RNA interference machinery by binding and cleaving the Arabidopsis AGO1 and silence the host immunity genes [49]. Therefore, it is legitimate to suggest that cutting down the expression of AGO1 by inducing asa-miR168a expression may be a defense strategy adopted by resistant garlic lines to prevent fungal colonization. However, functional characterization through the development and analysis of loss of function mutants will throw more insights into their roles in garlic immunity to the basal rot fungus. TIR1 has been identified as the most conserved target of miR393 in various plant species including garlic in this study. It belongs to the F-box family protein, which act as a co-repressor of auxin signaling during stress responses. Auxin mediates the binding of TIR1 with Auxin/Indole 3acetic acid (Aux/IAA) repressor causing ubiquitination and 26S proteosome mediated degradation of Aux/IAA [46]. This in turn releases the ARFs from AUX/IAA mediated heterodimerization to

25

regulate the transcription of auxin-response genes [50]. Therefore, it is possible that an increase in abundance of miR393 in the resistant line may result in the reduction of TIR1 transcripts thereby allowing the accumulation of Aux/IAA-ARF heterodimers. As a consequence, the suppression of auxin responsive genes may prevent fungal colonization. In addition, ARFs are also posttranscriptionally downregulated by both miR160 and miR167 which suppresses auxin signalling and contribute to plant immunity [51, 52]. In this work, we also demonstrated that miR160 and miR167 targets putative ARFs and contributes to resistance against FOC. Based on these findings, it may be assumed that miR393 together with miR160/miR167 play a critical part in plant innate immunity by suppression of ARF-mediated auxin responsive genes. Thus, by sequencing and qPCR analyses of sRNAs from susceptible and resistant lines, we identified a set of known and novel miRNAs that act either positively or negatively in the regulation of garlic immunity against the basal rot fungus. Our study also demonstrated that ectopic expression of a single miRNA is able to establish garlic resistance to the Fusarium basal rot disease. Nevertheless, characterization of further miRNAs identified in this study is needed to fully realize the impact of the miRNA pathways in the regulation of garlic-FOC interaction.

Competing interests The authors declare that they have no competing interests.

Author contributions RKJ conceived, designed and supervised the research work. SC and SN performed the experiments. SC and RM analyzed the data. SC, SN and RM wrote the manuscript. RKJ provided

26

inputs on data presentation and critically reviewed the manuscript. All authors read and approved the final manuscript.

Acknowledgement Research work in the laboratory is supported by grants from Science and Engineering Research Board (SERB), Dept. of Science and Technology (DST), Govt. of India (grant no. SR/FT/LS41/2012) and R & D grant from Siksha O Anusandhan University, India (grant no. REGR/2289/SOAU). SC and SN are thankful for research fellowships from Dept. of Biotechnology (DBT), Govt. of India. RM is thankful for a young Scientist fellowship from SERB (grant no. SB/YS/LS-171/2013). We thank Prof. Manoj Ranjan Nayak, President, Siksha O Anusandhan University, Bhubaneswar, India for his guidance and support. We also thank DST-FIST, Govt. of India, for the research infrastructure facilities provided to Centre of Biotechnology, Siksha O Anusandhan University.

References [1] C.S. Cramer, Breeding and genetics of Fusarium basal rot resistance in onion, Euphytica. 115 (2000) 159–166. doi:10.1023/A:1004071907642. [3] I. Rejeb, V. Pastor, B. Mauch-Mani, Plant Responses to Simultaneous Biotic and Abiotic Stress: Molecular Mechanisms, Plants. 3 (2014) 458–475. doi:10.3390/plants3040458.

27

[4] E. Rout, S. Nanda, S. Nayak, R.K. Joshi, Molecular characterization of NBS encoding resistance genes and induction analysis of a putative candidate gene linked to Fusarium basal rot resistance in

Allium

sativum,

Physiol.

Mol.

Plant

Pathol.

85

(2014)

15–24.

doi:10.1016/j.pmpp.2013.11.003. [5] E. Rout, S. Nanda, R.K. Joshi, Molecular characterization and heterologous expression of a pathogen induced PR5 gene from garlic (Allium sativum L.) conferring enhanced resistance to necrotrophic fungi, Eur. J. Plant Pathol. 144 (2016) 345–360. doi:10.1007/s10658-015-0772-y. [6] A. Taylor, V. Vágány, A.C. Jackson, R.J. Harrison, A. Rainoni, J.P. Clarkson, Identification of pathogenicity-related genes in Fusarium oxysporum f. sp. cepae, Mol. Plant Pathol. 17 (2016) 1032–1047. doi:10.1111/mpp.12346. [7] Y. Kawahara, Y. Oono, H. Kanamori, T. Matsumoto, T. Itoh, E. Minami, Simultaneous RNAseq analysis of a mixed transcriptome of rice and blast fungus interaction., PLoS One. 7 (2012) e49423. doi:10.1371/journal.pone.0049423. [8] A.K.L. Leung, P.A. Sharp, MicroRNA Functions in Stress Responses, Mol. Cell. 40 (2010) 205– 215. doi:10.1016/j.molcel.2010.09.027. [9] A.R. Naqvi, M. Sarwat, S. Hasan, N. Roychodhury, Biogenesis, functions and fate of plant microRNAs, J. Cell. Physiol. 227 (2012) 3163–3168. doi:10.1002/jcp.24052. [10] S. Katiyar-Agarwal, H. Jin, Role of small RNAs in host-microbe interactions, Annu. Rev. Phytopathol. 48 (2010) 225–46. doi:10.1146/annurev-phyto-073009-114457. [11] L. Yang, H. Huang, Roles of small RNAs in plant disease resistance, J Integr Plant Biol. (2014). doi:10.1111/jipb.12200. [12] Y. Li, Q. Zhang, J. Zhang, L. Wu, Y. Qi, J.M. Zhou, Identification of MicroRNAs Involved in Pathogen-Associated Molecular Pattern-Triggered Plant Innate Immunity, Plant Physiol. 152 (2010) 2222–2231. doi:10.1104/pp.109.151803.

28

[13] M. Luo, J. Gao, H. Peng, G. Pan, Z. Zhang, MiR393-targeted TIR1-like (F-box) gene in response to inoculation to R. Solani in Zea mays, Acta Physiol. Plant. 36 (2014) 1283–1291. doi:10.1007/s11738-014-1509-9. [14] Y. Li, Y.-G. Lu, Y. Shi, L. Wu, Y.-J. Xu, F. Huang, X.-Y. Guo, Y. Zhang, J. Fan, J.-Q. Zhao, H.Y. Zhang, P.-Z. Xu, J.-M. Zhou, X.-J. Wu, P.-R. Wang, W.-M. Wang, Multiple rice microRNAs are involved in immunity against the blast fungus Magnaporthe oryzae, Plant Physiol. 164 (2014) 1077–92. doi:10.1104/pp.113.230052. [15] W. Jin, F. Wu, Characterization of miRNAs associated with Botrytis cinerea infection of tomato leaves, BMC Plant Biol. 15 (2015) 1. doi:10.1186/s12870-014-0410-4. [16] Y.J. Park, H.J. Lee, K.J. Kwak, K. Lee, S.W. Hong, H. Kang, MicroRNA400-guided cleavage of pentatricopeptide repeat protein mRNAs renders Arabidopsis thaliana more susceptible to pathogenic

bacteria

and

fungi,

Plant

Cell

Physiol.

55

(2014)

1660–1668.

doi:10.1093/pcp/pcu096. [17] L. Yang, X. Mu, C. Liu, J. Cai, K. Shi, W. Zhu, Q. Yang, Overexpression of potato miR482e enhanced plant sensitivity to Verticillium dahliae infection, J. Integr. Plant Biol. (2015). doi:10.1111/jipb.12348. [18] S.K. Chand, S. Nanda, R.K. Joshi, Regulation of miR394 in response to Fusarium oxysporum f. sp. cepae (FOC) infection in garlic (Allium sativum L), Front. Plant Sci. 7 (2016). doi:10.3389/fpls.2016.00258. [19] E. Rout, P. Tripathy, S. Nanda, S. Nayak, R.K. Joshi, Evaluation of Cultivated and Wild Allium Accessions for Resistance to Fusarium oxysporum f. sp. cepae, Proc. Natl. Acad. Sci. India Sect. B - Biol. Sci. 86 (2015) 643–649. doi:10.1007/s40011-015-0506-0. [20] E.P. Nawrocki, S.W. Burge, A. Bateman, J. Daub, R.Y. Eberhardt, S.R. Eddy, E.W. Floden, P.P. Gardner, T.A. Jones, J. Tate, R.D. Finn, Rfam 12.0: Updates to the RNA families database, Nucleic Acids Res. 43 (2015) D130–D137. doi:10.1093/nar/gku1063.

29

[21] R. Kamenetsky, A. Faigenboim, E. Shemesh Mayer, T. Ben Michael, C. Gershberg, S. Kimhi, I. Esquira, S. Rohkin Shalom, D. Eshel, H.D. Rabinowitch, A. Sherman, Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.), BMC Genomics. 16 (2015) 12. doi:10.1186/s12864-015-1212-2. [22] E. Shemesh-Mayer, T. Ben-Michael, N. Rotem, H.D. Rabinowitch, A. Doron-Faigenboim, A. Kosmala, D. Perlikowski, A. Sherman, R. Kamenetsky, Garlic (Allium sativum L.) fertility: transcriptome and proteome analyses provide insight into flower and pollen development, Front. Plant Sci. 6 (2015) 271. doi:10.3389/fpls.2015.00271. [23] X. Sun, S. Zhou, F. Meng, S. Liu, De novo assembly and characterization of the garlic (Allium sativum) bud transcriptome by Illumina sequencing, Plant Cell Rep. 31 (2012) 1823–1828. doi:10.1007/s00299-012-1295-z. [24] M. Zuker, Mfold web server for nucleic acid folding and hybridisation prediction, Nucleic Acids Res. 31 (2003) 3406–15. [25] X. Dai, P.X. Zhao, PsRNATarget: A plant small RNA target analysis server, Nucleic Acids Res. 39 (2011). doi:10.1093/nar/gkr319. [26] A. Conesa, S. Götz, Blast2GO: A comprehensive suite for functional analysis in plant genomics, Int. J. Plant Genomics. (2008). doi:10.1155/2008/619832. [27] E. Varkonyi-Gasic, R. Wu, M. Wood, E.F. Walton, R.P. Hellens, Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs., Plant Methods. 3 (2007) 12. doi:10.1186/1746-4811-3-12. [28] K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2∆∆CT Method, Methods. 25 (2001) 402–408. [29] D. Shen, I. Suhrkamp, Y. Wang, S. Liu, J. Menkhaus, J.A. Verreet, L. Fan, D. Cai, Identification and characterization of microRNAs in oilseed rape (Brassica napus) responsive to infection with the pathogenic fungus Verticillium longisporum using Brassica AA (Brassica rapa) and CC

30

(Brassica

oleracea)

as

reference

genomes,

New

Phytol.

204

(2014)

577–594.

doi:10.1111/nph.12934. [30] Y.-K. Ahn, M.-K. Yoon, J.-S. Jeon, Development of an efficient Agrobacterium-mediated transformation system and production of herbicide-resistant transgenic plants in garlic (Allium sativum L.)., Mol. Cells. 36 (2013) 158–62. doi:10.1007/s10059-013-0142-6. [31] R. Berruyer, S. Poussier, P. Kankanala, G. Mosquera, B. Valent, Quantitative and qualitative influence of inoculation methods on in planta growth of rice blast fungus, Phytopathology. 96 (2006) 346–355. doi:10.1094/PHYTO-96-0346. [32] M.W. Rhoades, B.J. Reinhart, L.P. Lim, C.B. Burge, B. Bartel, D.P. Bartel, Prediction of plant microRNA targets, Cell. 110 (2002) 513–520. doi:10.1016/S0092-8674(02)00863-2. [33] D.G. Hwang, J.H. Park, J.Y. Lim, D. Kim, Y. Choi, S. Kim, G. Reeves, S.I. Yeom, J.S. Lee, M. Park, S. Kim, I.Y. Choi, D. Choi, C. Shin, The Hot Pepper (Capsicum annuum) MicroRNA Transcriptome Reveals Novel and Conserved Targets: A Foundation for Understanding MicroRNA

Functional

Roles

in

Hot

Pepper,

PLoS

One.

8

(2013).

doi:10.1371/journal.pone.0064238. [34] B.C. Meyers, M.J. Axtell, B. Bartel, D.P. Bartel, D. Baulcombe, J.L. Bowman, X. Cao, J.C. Carrington, X. Chen, P.J. Green, S. Griffiths-Jones, S.E. Jacobsen, A.C. Mallory, R.A. Martienssen, R.S. Poethig, Y. Qi, H. Vaucheret, O. Voinnet, Y. Watanabe, D. Weigel, J.-K. Zhu, Criteria for Annotation of Plant MicroRNAs, PLANT CELL ONLINE. 20 (2008) 3186–3190. doi:10.1105/tpc.108.064311. [35] B. Khraiwesh, J.J.-K.J.J.-K.J.J.-K. Zhu, Role of miRNAs and siRNAs in biotic and abiotic stress responses

of

plants.,

Biochim.

Biophys.

Acta.

1819

(2012)

137–48.

doi:10.1016/j.bbagrm.2011.05.001. [36] S. Campo, C. Peris-Peris, C. Siré, A.B. Moreno, L. Donaire, M. Zytnicki, C. Notredame, C. Llave, B. San Segundo, Identification of a novel microRNA (miRNA) from rice that targets an alternatively spliced transcript of the Nramp6 (Natural resistance-associated macrophage protein

31

6)

gene

involved

in

pathogen

resistance,

New

Phytol.

199

(2013)

212–227.

doi:10.1111/nph.12292. [37] S.K. Chand, S. Nanda, E. Rout, J. Mohanty, R. Mishra, R.K. Joshi, Identification and characterization of microRNAs in turmeric (Curcuma longa L.) responsive to infection with the pathogenic fungus Pythium aphanidermatum, Physiol. Mol. Plant Pathol. 93 (2016) 119–128. doi:10.1016/j.pmpp.2016.01.010. [38] F. Wu, J. Shu, W. Jin, Identification and validation of miRNAs associated with the resistance of maize

(Zea

mays

L.)

to

Exserohilum

turcicum,

PLoS

One.

9

(2014).

doi:10.1371/journal.pone.0087251. [39] L. Chen, Y. Ren, Y. Zhang, J. Xu, Z. Zhang, Y. Wang, Genome-wide profiling of novel and conserved Populus microRNAs involved in pathogen stress response by deep sequencing, Planta. 235 (2012) 873–883. doi:10.1007/s00425-011-1548-z. [40] Y. Chen, J. L. Gelfond, L.M. McManus, P.K. Shireman, Reproducibility of quantitative RT-PCR array in miRNA expression profiling and comparison with microarray analysis, BMC Genomics. 10 (2009) 407. doi:10.1186/1471-2164-10-407. [41] B. Inal, M. Turktas, H. Eren, E. Ilhan, S. Okay, M. Atak, M. Erayman, T. Unver, Genome-wide fungal stress responsive miRNA expression in wheat. Planta. 240 (2014) 1287-1298. [42] J.D.G. Jones, J.L. Dangl, The plant immune system, Nature. 444 (2006) 323–329. doi:10.1038/nature05286. [43] L. Almagro, L. V. Gomez Ros, S. Belchi-Navarro, R. Bru, A. Ros Barcelo, M.A. Pedreno, Class III

peroxidases

in

plant

defence

reactions,

J.

Exp.

Bot.

60

(2009)

377–390.

doi:10.1093/jxb/ern277. [44] M. Nuruzzaman, A.M. Sharoni, S. Kikuchi, Roles of NAC transcription factors in the regulation of

biotic

and

abiotic

stress

responses

in

plants,

Front.

Microbiol.

4

(2013).

doi:10.3389/fmicb.2013.00248.

32

[45] K. Nakashima, L.S. Tran, D. Van Nguyen, M. Fujita, K. Maruyama, D. Todaka, Y. Ito, N. Hayashi, K. Shinozaki, K. Yamaguchi-Shinozaki, Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-reponsive gene expression in rice, Plant J. 51 (2006) 617–630. [46] C. Delessert, K. Kazan, I.W. Wilson, D. Van Der Straeten, J. Manners, E.S. Dennis, R. Dolferus, The transcription factor ATAF2 represses the expression of pathogenesis-related genes in Arabidopsis, Plant J. 43 (2005) 745–757. doi:10.1111/j.1365-313X.2005.02488.x. [47] X. Wang, B.M.V.S. Basnayake, H. Zhang, G. Li, W. Li, N. Virk, T. Mengiste, F. Song, The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necrotrophic fungal and bacterial pathogens., Mol. Plant. Microbe. Interact. 22 (2009) 1227–1238. doi:10.1094/MPMI-22-10-1227. [48] E. Várallyay, A. Válóczi, A. Agyi, J. Burgyán, Z. Havelda, Plant virus-mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation., EMBO J. 29 (2010) 3507–19. doi:10.1038/emboj.2010.215. [49] A. Weiberg, M. Wang, F.-M. Lin, H. Zhao, Z. Zhang, I. Kaloshian, H.-D. Huang, H. Jin, Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways., Science. 342 (2013) 118–23. doi:10.1126/science.1239705. [50] G. Hagen, T. Guilfoyle, Auxin-responsive gene expression: Genes, promoters and regulatory factors, Plant Mol. Biol. 49 (2002) 373–385. doi:10.1023/A:1015207114117. [51] L. Navarro, P. Dunoyer, F. Jay, B. Arnold, N. Dharmasiri, M. Estelle, O. Voinnet, J.D.G. Jones, A plant miRNA contributes to antibacterial resistance by repressing auxin signaling., Science. 312 (2006) 436–9. doi:10.1126/science.1126088. [52] J. Fu, H. Liu, Y. Li, H. Yu, X. Li, J. Xiao, S. Wang, Manipulating Broad-Spectrum Disease Resistance by Suppressing Pathogen-Induced Auxin Accumulation in Rice, Plant Physiol. 155 (2011) 589–602. doi:10.1104/pp.110.163774.

33

Figure legends Figure 1: Comparison of defense responses between the susceptible garlic line CBT-As11 and resistant garlic line CBT-As153. 10 days old garlic seedling grown in vitro was inoculated with spore suspensions (5x106 spores/ml) of FOC. A) Time course difference in the morphology of seedlings from the indicated lines post treatment with FOC. B) Representative garlic cloves from the indicated lines to show the FOC disease phenotypes. C-G) Expression of the indicated defense related genes in CBT-As11 and CBT-As153 upon FOC infection. RNA was extracted from a set of five plants collected at each point after 0, 12, 24, 48 and 72 hours of treatment. mRNA level was normalized to that in untreated sensitive line CBT-As11 (0 h). At 0 h the relative expression is equal to 1. The housekeeping gene was Actin. Error bars show standard deviations for three independent experiments in real-time PCR. ** indicates the significant difference (at P value < 0.01) between infected and mock samples identified through two way ANOVA test.

34

Figure 2: Predicted hairpin fold back structures and experimental validation of small RNA candidates from garlic (Allium sativum L.). Small RNA sequences recovered are represented by blue bars. Northern blot analysis of small RNAs, and corresponding ethidium bromide staining, is shown on the right side. The small RNA fraction obtained from 50 µg of total RNA was probed with synthetic oligonucleotide sequences complementary to the indicated sequences.

35

Figure 3: Validation of predicted microRNA (miRNA) targets using RNA ligase-mediated 5’ rapid amplification of cDNA ends (RACE) PCR. The authentic targets validated here are from Allium sativum, and are homologs of genes listed in this figure. The bottom strand (Blue) identified the miRNA and the top strand (Red) identified a miRNA-complementary site in the target mRNA. Arrow indicates the cleavage position in the target mRNA. Fraction above the arrow refers to the number of independently cloned 50 RACE products whose 5’end terminated at the indicated position over the total number of sequenced clones. Watson-Crick pairing (:) and G:U wobble pairing (.) are indicated. The miRNA and its targets are labelled on the left.

36

Figure 4: Differential expression analysis of miRNAs in susceptible (CBT-As11) and resistant (CBTAs153) garlic cultivar post infection with FOC using qRT-PCR. (A) miRNAs regulating positively during garlic immunity against FOC, (B) miRNAs acting as negative regulators of garlic immunity to FOC, and (C) miRNAs acting as basal regulators with expression in both resistant and susceptible line post infection with FOC. Red indicates that a gene is highly expressed at that stage, whereas green indicates the opposite. The values in the top represents the signal intensity that ranges from low (green) to high (red) expression of miRNAs. For the numerical expression value of each time point, please refer to supplementary table S3.

37

Figure 5: Expression patterns of miRNAs and their target genes upon F. oxysporum f. sp. cepae infection. Garlic plants were germinated for 2 weeks and then subjected to FOC infection for 0, 12, 24, 48, and 72 h. A) North-blot analysis of miRNAs. 15 µg of small RNA was loaded and RNA blots were hybridized with DNA oligonucleotide probes complementary to the indicated miRNAs. U6 was used as a loading control. B-G) qRT-PCR analyses of mRNA levels for genes targeted by A. sativum miRNAs. U6 RNA was used as the internal control. Error bar indicates standard deviation obtained from three biological replicates. * and ** indicates the significant difference at P < 0.05 and P < 0.01 respectively between 0 hpi and the indicated time points in the same line through two way ANOVA test.

38

Figure 6: Overexpression of miR164a enhances garlic resistance to F. oxysporum f. sp. cepae. (A) RNA gel-blot and (B) qRT-PCR analysis to determine the accumulation of miR164a in the transgenic lines expressing 35S:miR168a and empty vector (EV). 15 µg of small RNA was loaded for RNA blotting while 1 µg of total RNA was used for qRT-PCR. RNA was isolated from the second generation transgenic plants. (D) Representative garlic seedlings and cloves from the transgenic lines showing disease phenotypes. Seedlings were inoculated by pouring 40 ml of FOC inoculum (containing 3 x 105 conidiospores/ml) and the phenotype was observed at 7 dpi. (E) Sporulation of FOC on the cloves of the inoculated seedlings of the transgenic lines. (F) Relative fungal growth on the cloves of the inoculated seedlings of the transgenic lines. All assays were performed using samples collected at 7 dpi. The experiments were carried out in triplicate. Error bar indicates standard deviation obtained from three biological replicates. * and ** indicates the significant difference at P < 0.05 and P < 0.01 respectively between Yamuna Safed (empty vector) and miR164a overexpression transgenic lines through two way ANOVA test.

39

Figure 7: Positive regulation of defense related genes in the garlic transgenic lines overexpressing miR164a, miR168a and miR393. 10 days old garlic seedling grown in vitro was inoculated with spore suspensions (5x106 spores/ml) of FOC and the samples were collected at the indicated time points. RNA was extracted for qRT-PCR analysis, and the mRNA level was normalized to that in untreated control Yamuna Safed (empty vector-EV). At 0 h, the relative expression for the control was set equal to 1. The housekeeping gene was Actin. Error bars show standard deviations for three independent experiments in real-time PCR. ** indicates the significant difference (at P value < 0.01) between infected and mock samples identified through two way ANOVA test.

40

Table 1: Composition of small RNA populations cloned from A. sativum RNA class

No. of clones

miRNA

45

mRNA

-

tRNA

103

rRNA

43

snRNA

3

snoRNA

2

Rasi-RNA

1

Genomic sequences

1

Mitochondrial

1

Unknown sequences

37

TOTAL

226

41