Evaluation of the biocontrol potential of Streptomyces goshikiensis YCXU against Fusarium oxysporum f. sp. niveum

Biological Control 81 (2015) 101–110

Contents lists available at ScienceDirect

Biological Control journal homepage: www.elsevier.com/locate/ybcon

Evaluation of the biocontrol potential of Streptomyces goshikiensis YCXU against Fusarium oxysporum f. sp. niveum Muhammad Faheem 1, Waseem Raza 1, Wei Zhong, Zhang Nan, Qirong Shen, Yangchun Xu ⇑ Jiangsu Collaborative Innovation Center for Solid Organic Waste Utilization, College of Resources and Environmental Sciences, Nanjing Agricultural University, Tong Wei Road, No. 6, 210095 Nanjing, Jiangsu Province, PR China

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 The strain S. goshikiensis YCXU

showed antifungal activity against fungal pathogens.  The strain YCXU exhibited catalase, b-1,3-glucanase, chitinase and urease enzyme activities.  The application of YCXU significantly decreased the incidence of Fusarium wilt.  The application of YCXU decreased the pathogen population by 89% in soil.  The strain YCXU protected the roots of watermelon from pathogen invasion.

a r t i c l e

i n f o

Article history: Received 5 June 2014 Accepted 18 November 2014 Available online 26 November 2014 Keywords: Antifungal Enzyme Morphological Streptomyces goshikiensis Biofertilizer Cluster analysis

a b s t r a c t A rhizobacterium with broad spectrum antifungal activity was isolated from the rhizosphere of a healthy cucumber plant in a Fusarium wilt diseased field. Phylogenetic tree analysis based on similarity percentage showed that the bacterium was 99% affiliated with the species Streptomyces goshikiensis. The strain, coded as S. goshikiensis YCXU, inhibited in vitro a broad range of phytopathogenic fungi, so it was selected for more detailed characterization. The strain could utilize different carbon sources and exhibited catalase, b-1,3glucanase, chitinase and urease enzyme activities. The strain showed maximum growth at the pH of 7, temperature of 28 °C and NaCl concentration of 1%. The stain was able to produce antifungal diffusible and volatile organic compounds that significantly inhibited the growth of pathogenic fungi. In the greenhouse experiments, watermelon plants fresh and dry weights were significantly increased, and the incidence of Fusarium wilt was decreased by 67% when the strain enriched by a bioorganic fertilizer was applied to both nursery soil and pot soil (NS). The treatment NS also showed 88.9% less pathogen population in soil as compared to control. The use of biocontrol agents decreased the stress indicator enzymes and malondialdehyde content by 55–70% and 62%, respectively as compared to control. The denaturing gradient gel electrophoresis (DGGE) analysis showed significant variations in the fungal and bacterial community structures of all treatments resulted from UPGMA cluster analysis. This study showed that S. goshikiensis YCXU could be a potential biocontrol agent for controlling watermelon Fusarium wilt disease. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction ⇑ Corresponding author. Fax: +86 2584432420. 1

E-mail address: [email protected] (Y. Xu). First and second author contributed equally to the manuscript.

http://dx.doi.org/10.1016/j.biocontrol.2014.11.012 1049-9644/Ó 2014 Elsevier Inc. All rights reserved.

Watermelon is an important fruit crop in China; however, it is susceptible to Fusarium wilt disease and continuous farming of

102

M. Faheem et al. / Biological Control 81 (2015) 101–110

watermelon in the same field intensifies this disease (SorianoMartín et al., 2006). The Fusarium wilt pathogen of watermelon, Fusarium oxysporum f. sp. niveum, is difficult to control because it produces chlamydospores that survive in soil for many years (Garrett, 1970). The Fusarium wilt pathogen can infect watermelon at all growth stages causing damping off of seedlings and plants wilt followed by death or stunting (Jones et al., 1991). Currently there is no satisfactory control measure available for the Fusarium wilt. Resistant cultivars, crop rotation and other traditional methods are not useful to control this disease (Berg, 2009). The use of fungicides showed some reduction of Fusarium wilt but the pathogen has developed resistance to all fungicides all the times. In addition, the use of fungicides is environmentally unsafe (Bolton and Thomma, 2012). Under these conditions, biological control is an effective and sustainable alternative method to control plant diseases. Previously, different microbial species such as Bacillus spp., Pseudomonas spp., Trichoderma spp., Streptomyces spp. and nonpathogenic Fusarium spp., have been effectively used for the control of soil-borne plant pathogens (Heydaria and Pessarakli, 2010; Raza et al., 2013). Among those, Streptomycetes strains have their own importance. Streptomycetes are Gram positive Actinobacteria with high GC content and mainly found in soil and decaying organic matter (Kämpfer, 2006). There are more than 500 species of Streptomycetes (Labeda, 2010). Many Streptomycetes strains have been used to promote plant growth and control soil-borne plant pathogens (Getha and Vikineswary, 2002; Gopalakrishnan et al., 2011; Merriman et al., 1974). Among these, S. rochei and S. rimosus, isolated from the rhizosphere of chickpea, showed strong antagonism against F. oxysporum f. sp. cicero (Bashar and Rai, 1991). Merriman et al. (1974) reported that S. griseus promoted the growth of barley, oat, wheat and carrot. The biocontrol mechanism of Streptomyces strains consist of the production of a wide spectrum of antibiotics and antifungal volatile organic compounds, a variety of fungal cell wall-degrading enzymes, such as cellulases, chitinases, amylases, glucanases, etc. and induction of systemic resistance in plants against pathogens (Getha and Vikineswary, 2002; Zhao et al., 2013). In addition, Streptomyces strains produce bioactive molecules of diverse nature and activity that make them a major part of the industrial strain collection (Baltz et al., 2010). Streptomyces strains produce antibiotics that are two-third of all natural origin useful antibiotics (neomycin and chloramphenicol) (Kieser et al., 2000). This biotechnological potential of Streptomycetes makes them a promising candidate for use in different applications. The strains used for the biocontrol of plant diseases showed different results and only a few strains showed complete control of plant pathogens (Perez Vicente et al., 2009). Therefore, it is really important to find new biocontrol strains from the environment in which they are called to act as biocontrol agents with superior biocontrol mechanisms and qualities to effectively control plant diseases. Considering the importance of Streptomycetes spp., a study was planned to isolate a new strain of Streptomycetes from the rhizosphere of cucumber. The newly isolated strain was characterized and its potential to promote plant growth and control Fusarium wilt of watermelon under greenhouse conditions was evaluated by determining the disease incidence, plant growth promotion, induction in systemic resistance and changes in microbial community structure of watermelon rhizosphere.

Danyang, Jiangsu, China. Soil samples were serially diluted with sterile water, spread (50 ll) onto nutrient agar (NA) medium and incubated at 28 °C for 4–6 days. The microbial colonies were streaked onto new NA plates for purification. The antagonism assay was conducted against different fungal pathogens (F. oxysporum sp. cubense, Sclerotinia sclerotiorum, Rhizoctonia solani, Phytophthora capsici, Aspergillus sp., and F. oxysporum sp. niveum) in triplicate using the dual culture technique. Briefly, a 3 mm agar plug from the edge of a 5 days old fungal pathogen strain on potato dextrose medium (PDA) was placed in the middle of another PDA plate. The biocontrol strains were inoculated in the middle of agar plug and edge of the plate and incubated at 28 °C for 3 days. The strain showing the strongest antifungal effect (inhibition zone) was coded as YCXU and selected for further studies. The strain YCXU was maintained on yeast malt extract (YME) agar medium (yeast extract 4 g/l, malt extract 20 g/l, glucose 4 g/l, agar 10 g/l, pH 7) and stored at 4 °C. The fungal pathogen strains, obtained from the Plant Protection College, Nanjing Agriculture University, Nanjing, China, were maintained on PDA and stored at 4 °C. 2.2. Identification of strain YCXU by 16S rRNA gene sequence analysis For 16S rRNA sequence analysis, DNA of strain YCXU was isolated by following the method of Pospiech and Neumann (1995). The universal primers used were (24f) AGAGTTTGATCCTGGCTCAG (Weisburg et al., 1991) and (1492r) TACGGYTACCTTGTTACGACTT (Stackebrandt and Goodfellow, 1991). The PCR reaction mixture contained 1 ll DNA, 2 ll each of reverse and forward primers (30 pmol ll1), 4 ll of dNTP mix, 5 ll of 10 PCR buffer containing 0.75 ll of 0.1 M MgCl2, 32 ll of ddH2O and 1 ll of Taq DNA polymerase (5 U ll1). Thermal cycling profile was included a first step at 95 °C (4 min) and 35 cycles of 95 °C (1 min), 63.5 °C (1 min) and 72 °C (2 min) and a final step at 72 °C (8 min). The amplified fragment was purified, ligated into the pMD18-T vector (Invitrogen Co., Carlsbad, Calif.) according to the manufacturer’s instructions and transformed into Escherichia coli DH-5a by electroporation. Plasmids containing the inserted fragments were isolated and sent for sequencing to Invitrogen™, Shanghai. The 16S rRNA gene sequence was compared to known bacterial sequences in NCBI GenBank using BLASTN and sequences of Streptomyces strains with high similarities were used for the construction of the phylogenetic tree by Maximum likelihood method using Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0 (Tamura et al., 2007). 2.3. Characterization of strain YCXU 2.3.1. Gram staining and optimum pH, temperature and NaCl concentration assay The Gram staining for strain YCXU was performed using aniline crystal violet as primary stain according to the method of Burke (1922) and observed under simple light microscope. Growth of strain YCXU was determined in YME medium at different temperatures ranging from 20 °C to 45 °C with the interval of 5 °C and with the exceptions of 28 °C and 37 °C. The pH sensitivity was detected in YME medium from pH 2–12 with the interval of pH 1. The NaCl concentration sensitivity test was conducted in YME media amended with different concentrations of NaCl (0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 10%, 12%, 14%, 16%, 18%, 20%, and 22%). All experiments had three replicates.

2. Material and methods 2.1. Isolation of Streptomycetes strain antagonistic to different fungi The soil samples were collected from the rhizosphere of a healthy cucumber plant from a Fusarium wilt diseased field in

2.3.2. Chitinase, b-1,3-glucanase, protease, catalase and urease activity assay For the chitinase and b-1,3-glucanase activity, NA media were amended with 1% colloidal chitin and 1% glucan, respectively, and transparent zones were observed around bacterial colonies

103

M. Faheem et al. / Biological Control 81 (2015) 101–110

after 5 days at 28 °C. Protease activity was tested by preparing skim milk agar medium and transparent zone was observed around bacterial colony after 5 days at 28 °C (Wehr and Frank, 2004). For catalase production, 3–6% H2O2 was added in Petri plates, and then a loop full of fresh colonies of bacteria was added. Bubble production was considered positive for catalase activity. Christensen’s urea agar medium was prepared and color change from yellow to red after bacterial inoculation was considered positive for urease activity (Christensen, 1946). All experiments had three replicates.

2.3.3. Utilization of different C sources, motility test and antibiotic sensitivity assay The ability of strain YCXU to use different carbon sources (1%) was examined in YME medium. Different carbon sources used are listed in Table 1 and growth of strains YCXU was described as positive. The motility test was performed using YME medium (0.4% agar) in a 5 ml test tube in triplicate. A loop of bacteria was stabbed straight in the center of test tube containing medium and growth at 28 °C was noticed after 7 days. The bacterial growth at the site of loop insertion only was considered as non-motile and aerobic (Green et al., 1951). Bacterial sensitivity to different antibiotics was tested in YME medium in triplicate. All antibiotics were added after the sterilization of medium at the rate of 30 lg/ml. Antibiotics used were ampicillin sodium, ampicillin disodium hexahydrate, phenazine methosulfate, tetracycline, polymyxin b sulfate, bacitracin, chloramphenicol, gentamicin, rifamycin, erythromycin, kanamycin, and streptomycin.

2.4. Antifungal volatile and diffusible compounds assay For the antifungal volatile compounds production assay, divided Petri plates (85 mm diameter) were used in triplicate. The PDA medium was added to both compartments of a plate. One compartment was inoculated with a plug of freshly grown F. oxysporum sp. niveum and other compartment was inoculated with strain YCXU. The plates were sealed with parafilm and fungal growth was measured on a daily basis and compared with control plates, with E. coli inoculation and without bacterial inoculation. For the production of antifungal diffusible compounds, the strain YCXU was grown in PDA broth and incubated at 28 °C in an incubator shaker at 170 rpm. After 7 days, the cell biomass was removed by centrifugation and antifungal compounds were extracted with ethyl acetate, dried by rotary evaporation and dissolved in methanol as described by Raza et al. (2013). These extracted compounds (100 ll) were checked for antifungal activity (inhibition zone) against F. oxysporum sp. niveum using the agar diffusion assay. Further purification was conducted with high performance liquid chromatography, but we were unable to isolate antifungal compounds successfully.

Table 1 Utilization of different carbon sources by Streptomyces goshikiensis YCXU.

2.5. Bioorganic fertilizer preparation The strain YCXU was inoculated in 200 ml of YME broth and incubated at 30 °C in an incubator shaker at 180 rpm for 24 h. The culture medium of strain YCXU was centrifuged, resuspended in sterilized water to a concentration of 1  109 cfu/ml and mixed with 2 kg of pig manure compost (Jiangsu Tianniang Ltd., China). The enriched bioorganic fertilizer (Pig manner compost) was placed in shade at room temperature and turned every day till it contained 109 cfu/ml of strain YCXU. The moisture of the mixture was maintained at 40–45% with sterilized water. Before that, the strain YCXU was tested for optimum growth in eight different organic fertilizers. The organic fertilizer that showed maximum growth was chosen for final enrichment. The organic fertilizer without the enrichment of strain YCXU was designated as organic fertilizer (OF). 2.6. Pot experiment design A pot experiment in a greenhouse at Yixing, Jiangsu, China was conducted to check the effect of strain YCXU on the Fusarium wilt incidence of watermelon. Following treatments were used: (1) CK: nursery soil and pot soil without any treatment; (2) CF: nursery soil (2%) and pot soil (0.5%) application of organic fertilizer only; (3) NS: nursery soil (2%) and pot soil (0.5%) application of bioorganic fertilizer; (4) WONS: only pot (0.5%) soil application of bioorganic fertilizer. In treatments, where organic fertilizer was not used; chemical fertilizers were used containing same N, P and K concentration as organic fertilizer. Seeds of watermelon were grown on sterilized water wetted Whatman filter paper in Petri plates for 3 days at 28 °C, germinated seeds were then transplanted to nursery trays (5 cm  5 cm) containing healthy soil. After 10 days, the plants along with nursery soil with four true leaves were transplanted to pots (20 cm  25 cm; one plant/pot and 20 plants for each treatment) containing Fusarium infested field soil (5 kg) from Dayang, Jiangsu, China. All pots were arranged by completely randomized design in a greenhouse having 35 °C maximum day temperatures and 21 °C minimum night temperature with the relative humidity of 60–85%. 2.7. Plant fresh and dry weights and disease severity index (DSI) Plant fresh, dry weight and disease severity index were measured after 2 (first harvest) and 6 (second harvest) weeks. For the determination of fresh plant weight, the whole plant was taken out of pot; roots were washed with distilled water, dried with paper and weighed. Later, plants were dried at 70 °C until constant weight and dry weights were measured. The plants were scored for disease class on a scale of 0–4; where 0 represented plants that had no visible wilt symptoms, 1 for plants that showed vein clearing alone, 2 for plants that were partially wilted with 1–3 chlorotic leaves, 3 for plants that were partially wilted with >3 chlorotic leaves and 4 for plants that were completely wilted. The disease severity index (DSI) was calculated by the following equation:

Disease severity index ðDSIÞ ¼

C sources

Growth

C sources

Growth

Arabinose Cellobiose Fructose Galactose Gluconate Glucose Inositol Lactose Maltose

+ + ++ +  ++ + + 

Mannitol Melobiose Raffinose Rhamnose Ribose Sorbitol Sucrose Xylitol Xylose

  + + +  + + +

hX i X ðA  BÞ  100 B4

where A = Disease class (0, 1, 2, 3 or 4) and B = Number of plants showing that disease class per treatment. All experiments had five replicates. 2.8. Enzyme activity assay Superoxide dismutase (SOD), peroxidase (POD) and polyphenoloxidase (PPO) enzyme activities and malondialdehyde (MDA)

104

M. Faheem et al. / Biological Control 81 (2015) 101–110

content were determined in fresh watermelon leaves, collected after 2 (first harvest) and 6 (second harvest) weeks, after washing with running tap water by following the methods of Garcı´aLimones et al. (2002), Nakano and Asada (1981), Tao et al. (2007) and Hartman et al. (2004), respectively. All experiments had three replicates.

2.9. Estimation of bacterial and pathogen strain in rhizosphere and bulk soil The rhizosphere and bulk soil were carefully sampled after 2 and 6 weeks. One gram of the rhizosphere soil was suspended in 9 ml of sterilized distilled water and blended at high speed for 10 min. A sterilized distilled water dilution series was set up (1–9 ml), and 0.1 ml serial dilutions were spread on to NA plates with ampicillin sodium (30 lg/ml) for strain YCXU and on Komada’s medium (Komada, 1975) for pathogen strain F. oxysporum. The plates were incubated at 28 °C and the colony forming units (CFU) were counted after 24 h for strain YCXU and after 48 h for pathogen strain. All experiments had three replicates.

2.10. Soil microbial community analysis by denaturing gradient gel electrophoresis (DGGE) The rhizosphere soil preserved for 24 h after sampling (0.5 g) was used to extract the total DNA with Axygen total soil microbial DNA extraction kit according to the manufacturer’s instructions. Extracted DNA was amplified twice using 338F-GC and 518R primers for bacterial 16S rRNA (Muyzer et al., 1993) and NS1 and FungGC primers for fungal 18S rRNA (May et al., 2001). Each reaction mixture (25 ll) was contained of DNA (25 ng), each primer (20 pmol), each deoxynucleotide triphosphates (dNTP; 400 lM)), 1 polymerase buffer, and Taq polymerase (1.5 U) (TaKaRa Ltd., Dalian, China). Thermal cycling profile was included a first step at 95 °C (4 min) and 35 cycles of 94 °C (1 min), 55 °C (1 min) for 16S rRNA or 58 °C (1 min) for 18S rRNA and 72 °C (1 min) and a final step at 72 °C (10 min). Products were visualized on 0.8 % (w/v) agarose gels before DGGE analysis. The DGGE analysis was done using Decode System (Universal Mutation Detection System, BIO-RAD). The amplicons (300 ng) were loaded on 8% polyacrylamide gel (Acrylamide/-Bisacrylamide 37.5:1) containing a denaturant gradient of 40–60% (100% denaturant contains 7 M urea and 40% formamide). Gels were run at a constant temperature (60 °C) using the voltage of 200 V for 10 min and then voltage of 80 V for 16 h constantly. Gels were silver stained and scanned with gel document system (Hercules, USA). Well-defined bands in the DGGE were excised and purified using Purification Kit (Sangon Biotech Ltd.). The positions of the excised bands in DGGE gel were confirmed and re-amplified using primers without GC-clamp. The PCR products were purified using PCR Product Purification Kit (Sangon Biotech Ltd.) and sequenced. All experiments had three replicates.

2.11. Statistical analysis The data of plant fresh and dry weights, disease severity index, enzyme activities, MDA content and strain YCXU and pathogen counts in the rhizosphere were analyzed by one-way ANOVA. Duncan’s multiple-range test was applied when one-way ANOVA revealed significant differences (P < 0.05). All statistical analysis was performed with SPSS version 11.5 statistical software (SPSS, Chicago, USA).

3. Results 3.1. Identification and antifungal activity of strain YCXU A total of 10 strains were isolated with antifungal activity against tested plant pathogens and among those, strain YCXU showed maximum antifungal activity (Inhibition zone) against F. oxysporum sp. niveum, Aspergillus sp., S. sclerotiorum, R. solani, P. capsici and F. oxysporum sp. cubense (Fig. 1). The 16S rRNA sequence of newly isolated bacterial strain YCXU showed 99.7% similarity with Streptomyces goshikiensis. A phylogenetic tree of closely related Streptomyces strains 16S rRNA sequences is shown in Fig. 2. The nucleotide sequence of YCXU was submitted to the NCBI database under the accession numbers KC887997.

3.2. Characteristics of strain YCXU The strain YCXU was Gram-positive, non-motile and aerobic bacterium which produced pink spores after 3–7 days on YME medium. It could utilize different carbon compounds as a sole C source and maximum growth was observed with D-glucose and D-fructose (Table 1). Strain YCXU had maximum growth at the pH of 7, temperature of 28 °C and NaCl concentration of 1% while decreased growth at other pH values, temperatures and NaCl concentrations (Fig. 3). The strain YCXU showed chitinase, b-1,3glucanase, catalase and urease activities; however, protease activity was not found. The antibiotic sensitivity of strain YCXU was tested on plates containing 30 lg/ml of different antibiotics. The strain YCXU showed resistance against ampicillin sodium, ampicillin disodium hexahydrate and phenazine methosulfate while it was not resistant to polymyxin b sulfate, bacitracin, chloramphenicol, gentamicin, rifamycin, erythromycin, kanamycin, streptomycin and tetracycline.

3.3. Antifungal volatile and diffusible compounds The liquid culture extract of strain YCXU showed antifungal activity against F. oxysporum sp. niveum (Fig. 1). However, we were unable to identify the antifungal compounds because those were unstable during purification using high performance liquid chromatography. The volatile compounds production assay was conducted in divided plates. The strain YCXU produced antifungal volatile compounds that were able to inhibit the growth of FON up to 40% (data not shown).

3.4. Effect of strain YCXU on plant fresh and dry weights The results showed that the NS treatment showed significantly higher fresh and dry weights of watermelon plants at first and last harvest followed by WONS treatment where only pot soil was inoculated with strain YCXU enriched bioorganic fertilizer as compared to Ck and CF treatments (Fig. 4A). The treatment WONS showed non-significant differences of dry weights with CK and CF treatments at first harvest. On the opposite, at the last harvest, the fresh and dry weight differences among all treatments were significant. The results also showed that the CF treatment had significantly higher plant fresh weights at the first harvest compared to CK treatment; however, dry weights at first harvest and both fresh and dry weights at the last harvest in CK and CF treatments had non-significant differences (Fig. 4B).

M. Faheem et al. / Biological Control 81 (2015) 101–110

105

Fig. 1. Antagonistic activity of Streptomyces goshikiensis YCXU against Fusarium oxysporum sp. niveum, Sclerotinia sclerotiorum, Aspergillus sp., Rhizoctonia solani, Phytophthora capsici and Fusarium oxysporum sp. cubense.

Fig. 2. Phylogenetic tree of Streptomyces spp. 16S rRNA gene sequences, showing the relationship between Streptomyces goshikiensis YCXU and closely related species.

Fig. 3. Effect of pH (A), NaCl concentrations (B) and temperature (C) on the growth of Streptomyces goshikiensis YCXU.

3.5. Effect of strain YCXU on disease severity The symptoms of Fusarium wilt were appeared after 9 days of transplanting plants into the pots. The disease severity indexes

estimated at the last harvest (6 weeks after transplantation) were 3.83 and 3.67 out of 4 which showed that 95% and 92% plants were wilted in the CK and CF treatments, respectively (Table 2). The NS treatment showed 71.4% (first harvest) and 66.8% (last harvest) less

106

M. Faheem et al. / Biological Control 81 (2015) 101–110

Fig. 4. Effect of different treatments on the fresh and dry weights of watermelon plants after first harvest (A) and last harvest (B). Data were expressed as mean ± standard error. The data in a column with a different letter differ significantly at Duncan’s significance level 0.05. Following treatments were used: (1) CK: nursery soil and pot soil without any treatment; (2) CF: nursery soil (2%) and pot soil (0.5%) application of organic fertilizer only; (3) NS: nursery soil (2%) and pot soil (0.5%) application of bioorganic fertilizer; (4) WONS: only pot (0.5%) soil application of bioorganic fertilizer.

disease severity index than CK treatment, however, those were nonsignificant with WONS treatment at the first harvest. Disease severity index in CF treatment was also slightly lower than CK treatment, but differences were not significant at the last harvest. 3.6. Antagonist and pathogen counts in the rhizosphere and bulk soil After 6 weeks, bacterial counts were determined in the rhizoplane and bulk soil. The results showed that the treatment NS had maximum antagonistic bacterium YCXU counts in rhizoplane and bulk soil followed by WONS treatment. The strain YCXU was not detected in CK and CF treatments (Table 2). An opposite trend was observed in fungal pathogen numbers as compared to bacterial counts. In the rhizoplane soil, treatments CK and CF showed the highest fungal pathogen counts. The decrease in fungal pathogen in NS treatment was 88.9% compared to control. Almost 90% more reduction in pathogen population in nursery treated plants compared with nursery non-treated plants was observed. Similar trend was observed in the bulk soil; however, fungal pathogen numbers were more in bulk soil compared to rhizoplane soil. It might be because of antagonistic bacterium that was only well established in the rhizoplane soil (Table 2). 3.7. Induction of systematic resistance in watermelon plants To evaluate the induced systematic resistance in watermelon plants, different stress related enzyme levels were determined in leaves at both harvest times. The stress related enzyme levels and MDA content were found maximum in control treatment (CK) and minimum activities were found in NS treatment (Fig. 5A). At the first harvest time, the decrease in PPO levels was 10%, 44% and 70% and at the last harvest, this decrease was 6.3%, 40% and 67% in CF, WONS and NS treatments as compared to CK, respectively. At the last harvest, the PPO activities difference

between CK and CF treatments was nonsignificant. The decrease in POD activities at first harvest was 13.3%, 33.3% and 60% and at last harvest was 17%, 56.6% and 70% in CF, WONS and NS treatments as compared to CK, respectively. At the first harvest the difference of POD activities in WONS and NS treatments was nonsignificant. The SOD activities were decreased by 7.8%, 56.3% and 67% at the first harvest, while this decrease was 16.2%, 32.4% and 55.4% at the last harvest in CF, WONS and NS treatments as compared to CK, respectively. However, at the first harvest the SOD activity differences of CK and CF treatments and WONS and NS were nonsignificant with each other. In our results, the decrease in MDA content was nonsignificant between CK and CF treatments at both harvest times while those were decreased by 40% and 56% at the first harvest (Fig. 5A) and by 48% and 62% at the last harvest in WONS and NS treatments as compared to CK, respectively (Fig. 5B).

3.8. Soil bacterial community structure and UPGMA clustering analysis The PCR–DGGE analysis of the rhizosphere bacterial community in the different treatments showed that the certain bands were common in all treatments, whereas, some treatments had unique bands (Fig. 6a). Except for the common bands, the unique bands (B1, B2, B3, B4 (three bands similar), B5, B6, B7 (4 bands similar), B8, B9, B10 (7 bands similar), were cloned and sequenced. BLAST results showed that these bacteria were similar to the species of bacteria, Bacillales, Cucurbitales, Flavobacteriales, Firmicutes, Desulfovibrionales, Sphingomonadales and an uncultured bacterium (Table 3). The UPGMA clustering analysis of the 16S rDNA DGGE patterns was obtained (Fig. 6b). Profiles generated from the rhizosphere soil showed that the clusters formed from the CK and CF exhibited 77.3% similarity, while NS and WONS had 63.5% similarity, whereas bacterial community of the nursery treated plants

Table 2 Disease incidence of watermelon after first harvest and last harvest and antagonistic strain YCXU and fungal pathogen strain counts after 6 weeks in different treatments. Treatments

CK CF NS WONS

Disease severity index

Strain YCXU counts

First harvest

Last harvest

Rhizoplane soil (108 CFU/g)

Bulk soil (107 CFU/g)

Rhizoplane soil (103 CFU/g)

Pathogen strain counts Bulk soil (104 CFU/g)

3.5a 2.83b 1c 1.16c

3.83a 3.67a 1.27c 2.00b

0b 0b 48a 0.9b

0b 0b 17a 0.9b

390a 274b 4.3d 92.4c

31a 24b 6.6d 9.8c

CK: nursery and pots without any treatment. CF: nursery and pots with the application of organic fertilizer only. NS: nursery and pot soil application of bioorganic fertilizer enriched with Streptomyces goshikiensis YCXU. WONS: nursery plants grown without any treatment but pot soil application of bioorganic fertilizer enriched with Streptomyces goshikiensis YCXU. DI: disease index. Same letters in column represent non-significant differences.

107

M. Faheem et al. / Biological Control 81 (2015) 101–110

Fig. 5. Effect of different treatments on superoxide dismutase (SOD), peroxidase (POD) and polyphenoloxidase (PPO) enzyme activities and malondialdehyde (MDA) content after first harvest (A) and last harvest (B). Data were expressed as mean ± standard error. The data in a column with a different letter differ significantly at Duncan’s significance level 0.05. Following treatments were used: (1) CK: nursery soil and pot soil without any treatment; (2) CF: nursery soil (2%) and pot soil (0.5%) application of organic fertilizer only; (3) NS: nursery soil (2%) and pot soil (0.5%) application of bioorganic fertilizer; (4) WONS: only pot (0.5%) soil application of bioorganic fertilizer.

Fig. 6. Denaturing gradient gel electrophoresis (DGGE) banding pattern of bacterial population (a), cluster analysis (UPGMA method) of bacterial 16S rRNA PCR–DGGE profiles (b), DGGE banding pattern of fungal population (c) and cluster analysis (UPGMA method) of fungal 18S rRNA PCR–DGGE profiles of 4 different treatments from watermelon rhizosphere (d).

Table 3 Closest relatives of bacterial partial 16S rDNA sequences derived from denaturing gradient gel electrophoresis bands. DGGE bands

Sequence length (bp)

Gene bank acc. No.

Close relatives

Similarity (%)

Alignment

B1 B2 B3 B4 B5 B6 B7 B8 B9 B10

172 171 178 176 213 148 159 151 189 187

AJ640183 KC443104 GQ866125 KC329595 GQ866155 GQ866143 DQ494214 EU407188 FM162953 GQ866179

Uncultured Bacillus sp. Bacillus subtilis strain BAB-2544 Uncultured bacterium clone 39-1-X13F(-47) Uncultured Sphingomonadaceae DM1-57 Uncultured bacterium clone 26-4-M13F(-47) Uncultured bacterium clone 9-4-M13F(-47) Citrullus lanatus phytoene synthase (psy) Bacterium S27-4 Flavobacteriaceae bacterium ACEMC 1F-6 Uncultured bacterium clone 53-1-M13F(-47)

99% 100% 96% 99% 100% 97% 99% 100% 98% 100%

171/172 171/171 169/169 171/173 198/198 178/179 179/180 157/159 199/781 181/181

with bioorganic fertilizer was having significant difference even same soil was used for all treatments. 3.9. Soil fungal community structure and UPGMA clustering analysis The PCR–DGGE analysis of rhizosphere soil fungal community in the different treatments showed that some changes in the rhizosphere fungal community occurred after treatment application (Fig. 6c). With the exception of the common bands, 13 bands showing variations between treatments were cloned and sequenced

(Table 4). The bands F1 (5 bands similar), F2, F3, F4, F5, F6 (3 bands similar), F7, F8, F9 and F10 (2 bands similar) showed phylogenetic affiliation with Pezizomycotina, Glomerellaceae, Eukaryota, Neocallimastigomycota and Pleosporomycetidae. The UPGMA clustering analysis of the 18S rDNA DGGE patterns obtained in the rhizosphere of different treatments (Fig. 6d) showed that the effect of different treatments was obvious on microbial community. Profiles generated from the nursery treated plants with biofertilizer and non-nursery treated plants were barely similar to each other, CK and CF treatments showed 67.1% while NS and

108

M. Faheem et al. / Biological Control 81 (2015) 101–110

Table 4 Closest fungi relatives of partial 18S rDNA sequences derived from denaturing gradient gel electrophoresis bands. DGGE band

Sequence length (bp)

Gene bank acc. No.

Close relatives

Similarity (%)

Alignment

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10

418 367 427 427 405 369 453 462 454 466

U57674 U57673 JN098132 EU364864 HQ839785 AY354395 KC708441 KC708371 JF974104 KC438394

Acremonium alternatum rDNA ITS 1 and 2 Nectria vilior rDNA ITS 1 and 2 Uncultured fungi L042884-122-064-C01 ITS1 Gibberella moniliformis Fm-X.1.7-030527-31 Colletotrichum orbiculare isolate XC010625 Fusarium oxysporum f. niveum strain NM11 Uncultured Mucoromycotina clone B Uncultured Glomeromycota clone A Piromyces sp. E GRL-6 Uncultured Pleosporales clone I267S16

100% 99% 98% 99% 99% 99% 99% 99% 96% 100%

418/418 348/350 435/437 427/428 415/418 369/370 459/460 468/469 460/470 470/470

WONS treatments showed 38.5% similarity. The NS treatment was significantly different from CK and CF. 4. Discussion The newly isolated strain YCXU was identified as S. goshikiensis and showed antifungal activity against a number of plant pathogenic fungal strains in vitro, which showed its potential to be used as an antagonist to control diseases caused by fungal pathogens. We evaluated different characteristics of newly isolated strain YCXU like optimum growth conditions, resistance to antibiotics and utilization of C sources. Almost similar results were reported for some other Streptomyces strains. Gopalakrishnan et al. (2013) reported the pH of 7, temperature of 20–40 °C and NaCl concentration of 2% for the optimum growth of Streptomyces strains. The strain YCXU showed chitinase, b-1,3-glucanase, catalase and urease activities which reflected that the strain YCXU can not only degrade cell wall of fungal pathogens but also can promote plant growth indirectly. The b-1,3-glucan, chitin and proteins are the structural components of the cell wall of fungal plant pathogens and are considered essential for the pathogenesis and transmission of disease (Ruiz-Herrera et al., 2006). Therefore, the microbes having b-1,3-glucan, chitin and protein lysis ability, which leads to the leakage and breakdown of the cells of pathogenic fungi, by producing b-1,3-glucanase, chitinase and protease are potential candidates for the biocontrol of plant pathogens (Macagnan et al., 2008). Zhao et al. (2013) reported the antifungal potential of hydrolytic enzymes produced by Streptomyces strains to degrade fungal pathogen cell wall. The production of antifungal compounds in an important biocontrol mechanism and some strains that do not produce antifungal compounds are unable to reduce disease. Streptomyces violaceusniger strain G10 produced antifungal metabolites that effectively inhibited the growth of F. oxysporum f. sp. cubense (Getha and Vikineswary, 2002). The liquid culture extract of strain YCXU showed significant inhibition of mycelia of F. oxysporum sp. niveum. However, we were unable to identify the antifungal compounds produced by strain YCXU because the antifungal compounds were unstable during purification using high performance liquid chromatography. The production of volatile organic compounds is a long distance control mechanism against phytopathogens (Yuan et al., 2012). The volatile organic compounds produced by strain YCXU significantly inhibited the growth of F. oxysporum sp. niveum. Similar results were reported earlier when volatile compounds produced by S. philanthi RM-1-138 inhibited the growth of R. solani PTRRC-9, Pyricularia grisea PTRRC-18, Bipolaris oryzae PTRRC-36 and Fusarium fujikuroi PTRRC-16 (Boukaew et al., 2013). The production of antifungal diffusible and volatile compounds against FON showed the great potential of strain YCXU to be used for the biocontrol of plant pathogens. To investigate the potential of strain YCXU to control the Fusarium wilt of watermelon, a pot experiment was conducted

using Fusarium infested soil. Strain YCXU was enriched in an organic fertilizer and applied to the nursery soil or pot soil or both. The dual application of bioorganic fertilizer to nursery soil and pot soil showed maximum control of Fusarium wilt of watermelon followed by treatment where only pot soil was amended with bioorganic fertilizer. Similar results were reported for Streptomyces violaceusniger G10 when it effectively controlled the F. oxysporum f. sp. cubense (Getha and Vikineswary, 2002). Another S. goshikiensis strain TSR38 did not show antifungal activity against F. oxysporum but showed against R. solani (Debnath et al., 2013). The strain YCXU enriched bioorganic fertilizer application to nursery soil and pot soil significantly increased the plant dry and fresh weights followed by treatment where only pot soil was amended with bioorganic fertilizer. The results also showed that the CF treatment had higher fresh weights than CK treatment. These results revealed that the strain YCXU has significant potential to promote plant growth and control Fusarium wilt of watermelon. The plant growth promoting results have been reported by other Streptomyces strains. Streptomyces strains CAI-24, CAI-121, CAI-127, KAI-32 and KAI-90 promoted the growth of rice, sorghum and chickpea by producing IAA and siderophores (Gopalakrishnan et al., 2011, 2013). However, there is no report about the plant growth promoting effects of S. goshikiensis strains. The maximum populations of antagonistic strain YCXU and minimum populations of pathogen F. oxysporum sp. niveum occurred in treatment where strain YCXU enriched bioorganic fertilizer was applied to nursery soil and pot soil followed by treatment where only pot soil was amended with bioorganic fertilizer. These results showed that the strain YCXU was well adapted to the rhizosphere of watermelon and showed its plant growth promoting and biocontrol traits effectively. Similar results were reported for some other Streptomyces strains (Gopalakrishnan et al., 2011). To evaluate the induced systematic resistance in watermelon plants, MDA content and different stress related enzyme activities (SOD, PPO, and POD) were determined in leaves at two harvest times. All stress related enzyme activities and MDA content were found maximum in control treatment and minimum activities were found in treatment where the strain YCXU enriched bioorganic fertilizer was applied to nursery soil and pot soil followed by treatment where only pot soil was amended with bioorganic fertilizer. Generally, pathogen invasion, injury or environmental stress increase the activity of plant defense enzymes (Chen et al., 2000; Garcı´a-Limones et al., 2002) and MDA content shows the extent of stress-induced damage to plant cell membrane (Morsy et al., 2007). The enzymes such as SOD and POD abolish reactive oxygen species, while PPO reinforces cell walls by inducing the production of lignin and phenolic compounds (Avdiushko et al., 1993; Asada, 1992). In the present study, MDA content and the activities of SOD, PPO, and POD were decreased by the application of strain YCXU. Our results were in agreement with the results of Zhao et al. (2011). In another report, watermelon MDA content and defense-related enzyme activities were lower when intercropped with rice compared to watermelon monocropping (Ren

M. Faheem et al. / Biological Control 81 (2015) 101–110

et al., 2008). Similarly, Wu et al. (2009) reported that the application of bioorganic fertilizer lowered the leaf MDA contents compared with control. These results demonstrated that the strain YCXU significantly suppressed the invasion of pathogens into plant roots that caused low activities of stress related enzymes in disease free plants. Chen et al. (2000) reported that the attack of pathogen to plants increased the defense or stress related enzyme activities with the development of disease. This further confirms that the strain YCXU can effectively control Fusarium wilt disease not by improving resistance in plants against the pathogen but by protecting the roots from pathogen invasion. The treatment where only pot soil was inoculated with antagonist enriched bioorganic fertilizer was less effective than treatment where both nursery and pot soil was inoculated with antagonist enriched bioorganic fertilizer. The PCR–DGGE analysis showed that the different treatments significantly affected the rhizosphere bacterial and fungal community, especially the treatment where both nursery soil and pot soil were amended with the bioorganic fertilizer. The antagonistic microbes experience a large variety of processes after their inoculation in soil, including growth, death, and physiological adaptation, physical speed and gene transfer (Prévost et al., 2006). In the perspective of biological invasion, the inoculation of an antagonistic microorganism may change the original ecological equilibrium of soil microbial community. Our results also showed that the inoculation of strain YCXU had a significant effect on the soil bacteria and fungal community, which reflected that the strain YCXU was well adapted to the rhizosphere and significantly influenced the neighboring microbial community. Similar changes in soil microbial community after the inoculation of antagonistic strain have been reported by other researchers (Gao et al., 2012). These results also support the findings of low MDA content and the activities of SOD, PPO, and POD enzymes in plants that the strain YCXU prevented the plant roots from pathogen and created a plant friendly environment around plant roots. 5. Conclusions S. goshikiensis strain YCXU enriched bioorganic fertilizer significantly suppressed the Fusarium wilt of watermelon and promoted the growth of watermelon plants. This effect was more prominent when the enriched fertilizer was applied both to the nursery plants and pots. Moreover, this treatment altered the rhizosphere microbial community structure and protected the plants from stress stage as suggested by the decrease in the stress related enzyme activities. However, more studies should be conducted to find out some more suitable carrier for this strain so that it can control wilt disease more efficiently. In addition, this strain should also be tested against other plant pathogen diseases especially caused by fungal pathogens. Acknowledgments This research was financially supported by the National Natural Science Foundation of China (41301262) and the Jiangsu Province Science Foundation for Youths (BK20130677). References Asada, K., 1992. Ascorbate peroxidase a hydrogen peroxide scavenging enzyme in plants. Physiol. Plant. 85, 235–241. Avdiushko, S., Ye, X., Kuc, J., 1993. Detection of several enzymatic activities in leaf prints of cucumber plants. Physiol. Mol. Plant Pathol. 42, 441–454. Baltz, R.H., Davies, J.E., Demain, A.L., 2010. Manual of Industrial Microbiology and Biotechnology. ASM press. Bashar, M., Rai, B., 1991. Antagonistic Potential of Root Region Microflora of Chickpea Against Fusarium oxysporum f. sp. ciceri. International Botanical Conference, Dhaka (Bangladesh), 10–12 Jun 1991, BBS.

109

Berg, G., 2009. Plant–microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture. Appl. Microbiol. Biotechnol. 84, 11–18. Bolton, M.D., Thomma, B.P.H.J., 2012. Plant Fungal Pathogens: Methods and Protocols. Humana press. Boukaew, S., Plubrukam, A., Prasertsan, P., 2013. Effect of volatile substances from Streptomyces philanthi RM-1-138 on growth of Rhizoctonia solani on rice leaf. Biocontrol 58, 471–482. Burke, V., 1922. Notes on the gram stain with description of a new method. J. Bacteriol. 7, 159. Chen, C., Belanger, R.R., Benhamou, N., Paulitz, T.C., 2000. Defense enzymes induced in cucumber roots by treatment with plant growth promoting rhizobacteria (PGPR) and Pythium aphanidermatum. Physiol. Mol. Plant Pathol. 56, 13–23. Christensen, W.B., 1946. Urea decomposition as a means of differentiating Proteus and paracolon cultures from each other and from Salmonella and Shigella types. J. Bacteriol. 52, 461. Debnath, R., Saikia, R., Sarma, R.K., Yadav, A., Bora, T.C., Handique, P.J., 2013. Psychrotolerant antifungal Streptomyces isolated from Tawang, India and the shift in chitinase gene family. Extremophiles 17, 1045–1059. Gao, G., Yin, D., Chen, S., Xia, F., Yang, J., Li, Q., Wang, W., 2012. Effect of biocontrol agent Pseudomonas fluorescens 2P24 on soil fungal community in cucumber rhizosphere using T-RFLP and DGGE. PLoS One 7, e31806. ´ a-Limones, C., Hervás, A., Navas-Cortés, J.A., Jiménez-Dıaz, R.M., Tena, M., 2002. Garcı ´ Induction of an antioxidant enzyme system and other oxidative stress markers associated with compatible and incompatible interactions between chickpea (Cicer arietinum L.) and Fusarium oxysporum f. sp ciceris. Physiol. Mol. Plant Pathol. 61, 325–337. Garrett, S.D., 1970. Pathogenic Root-Infecting Fungi. University Press, Cambridge. Getha, K., Vikineswary, S., 2002. Antagonistic effects of Streptomyces violaceusniger strain G10 on Fusarium oxysporum f. sp. cubense race 4: indirect evidence for the role of antibiosis in the antagonistic process. J. Ind. Microbiol. Biotechnol. 28, 303–310. Gopalakrishnan, S., Pande, S., Sharma, M., Humayun, P., Kiran, B.K., Sandeep, D., Vidya, M.S., Deepthi, K., Rupela, O., 2011. Evaluation of actinomycete isolates obtained from herbal vermicompost for the biological control of Fusarium wilt of chickpea. Crop Prot. 30, 1070–1078. Gopalakrishnan, S., Srinivas, V., Vidya, M.S., Rathore, A., 2013. Plant GrowthPromoting Activities of Streptomyces spp. in Sorghum and Rice, vol. 2. SpringerPlus (p. 574). Green, R.A., Blum, E.F., DeCoro, C.T., Fairchild, R.B., Kaplan, M.T., Landau, J.T., Sharp, T.S., 1951. Rapid methods for the detection of motility. J. Bacteriol. 62, 347. Hartman, G., Huang, Y., Li, S., 2004. Phytotoxicity of Fusarium solani culture filtrates from soybeans and other hosts assayed by stem cuttings. Australas. Plant Pathol. 33, 9–15. Heydaria, A., Pessarakli, M., 2010. A review on biological control of fungal plant pathogens using microbial antagonists. J. Biol. Sci. 10, 273–290. Jones, J.B., Jones, J.P., Stall, R.E., Zitter, T.A., 1991. Compendium of Tomato Diseases. American Phytopathological Society (p. 73). Kämpfer, P., 2006. The family Streptomycetaceae, part I: taxonomy. The Prokaryotes, 538–604. Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., Hopwood, D.P., 2000. Practical Streptomyces Genetics. The John Innes Foundation, Bungay, Suffolk, UK. Komada, H., 1975. Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Rev. Plant Prot. Res. 8, 114–124. Labeda, D.P., 2010. Multilocus sequence analysis of phytopathogenic species of the genus Streptomyces. Int. J. Syst. Evol. Microbiol. 61, 2525–2531. Macagnan, D., Romeiro, R.d.S., Pomella, A.W., deSouza, J.T., 2008. Production of lytic enzymes and siderophores, and inhibition of germination of basidiospores of Moniliophthora (ex Crinipellis) perniciosa by phylloplane actinomycetes. Biol. Control 47, 309–314. May, L.A., Smiley, B., Schmidt, M.G., 2001. Comparative denaturing gradient gel electrophoresis analysis of fungal communities associated with whole plant corn silage. Can. J. Microbiol. 47, 829–841. Merriman, P., Price, R., Kollmorgen, J., Piggott, T., Ridge, E., 1974. Effect of seed inoculation with Bacillus subtilis and Streptomyces griseus on the growth of cereals and carrots. Aust. J. Agric. Res. 25, 219–226. Morsy, M.R., Jouve, L., Hausman, J.F., Hoffmann, L., Stewart, J.M., 2007. Alteration of oxidative and carbohydrate metabolism under abiotic stress in two rice (Oryza sativa L.) genotypes contrasting in chilling tolerance. J. Plant Physiol. 164, 157– 167. Muyzer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695–700. Nakano, Y., Asada, K., 1981. Hydrogen peroxide is scavenged by ascorbate specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 22, 867–880. Perez Vicente, L., Batlle Viera, A., Chacon Benazet, J., Montenegro Moracen, V., 2009. Efficacy of Trichoderma harzianum A34 in Fusarium oxysporum f. sp. cubense biocontrol, causal agent of Fusarium wilt or panama disease of bananas in Cuba. Fitosanidad 13, 259–264. Pospiech, A., Neumann, B., 1995. A versatile quick-prep of genomic DNA from gram positive bacteria. Trends Genet. 11, 217–218. Prévost, K., Couture, G., Shipley, B., Brzezinski, R., Beaulieu, C., 2006. Effect of chitosan and a biocontrol streptomycete on field and potato tuber bacterial communities. Biocontrol 51, 533–546.

110

M. Faheem et al. / Biological Control 81 (2015) 101–110

Raza, W., Faheem, M., Yousaf, S., Faheem, U.R., Yamin, M., 2013. Volatile and nonvolatile antifungal compounds produced by Trichoderma harzianum SQR-T037 suppressed the growth of Fusarium oxysporum f. sp. niveum. Sci. Lett. 1, 21–24. Ren, L., Su, S., Yang, X., Xu, Y., Huang, Q., Shen, Q., 2008. Intercropping with aerobic rice suppressed Fusarium wilt in watermelon. Soil Biol. Biochem. 40, 834–844. Ruiz-Herrera, J., Elorza, M.V., Valentin, E., Sentandreu, R., 2006. Molecular organization of the cell wall of Candida albicans and its relation to pathogenicity. FEMS Yeast Res. 6, 14–29. Soriano-Martín, M., Porras Piedra, A., Porras-Soriano, A., 2006. Use of microwaves in the prevention of Fusarium oxysporum f. sp. melonis infection during the commercial production of melon plantlets. Crop Prot. 25, 52–57. Stackebrandt, E., Goodfellow, M., 1991. Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tao, F., Zhang, M., Yu, H.-Q., 2007. Effect of vacuum cooling on physiological changes in the antioxidant system of mushroom under different storage conditions. J. Food Eng. 79, 1302–1309.

Wehr, H.M., Frank, J.H., 2004. Standard Methods for the Microbiological Examination of Dairy Products, 17th ed. APHA Inc., Washington, D.C. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703. Wu, H.S., Yang, X.N., Fan, J.Q., Miao, W.G., Ling, N., Xu, Y.C., Huang, Q.W., Shen, Q., 2009. Suppression of Fusarium wilt of watermelon by a bio-organic fertilizer containing combinations of antagonistic microorganisms. Biocontrol 54, 287– 300. Yuan, J., Raza, W., Shen, Q., Huang, Q., 2012. Antifungal activity of Bacillus amyloliquefaciens NJN-6 volatile compounds against Fusarium oxysporum f. sp. cubense. Appl. Environ. Microbiol. 78, 5942–5944. Zhao, Q., Dong, C., Yang, X., Mei, X., Ran, W., Shen, Q., Xu, Y., 2011. Biocontrol of Fusarium wilt disease for Cucumis melo melon using bio-organic fertilizer. Appl. Soil Ecol. 47, 67–75. Zhao, J., Xue, Q.H., Niu, G.G., Xue, L., Shen, G.H., Du, J.Z., 2013. Extracellular enzyme production and fungal mycelia degradation of antagonistic Streptomyces induced by fungal mycelia preparation of cucurbit plant pathogens. Ann. Microbiol. 63, 809–812.