- Email: [email protected]
Multiplex PCR for the diagnosis of red sea bream iridoviruses isolated in Korea
Aquaculture 235 (2004) 139 – 152 www.elsevier.com/locate/aqua-online
Multiplex PCR for the diagnosis of red sea bream iridoviruses isolated in Korea Joon Bum Jeong a, Kyung Hyun Park b, Ho Yeoul Kim a, Su Hee Hong a,1, Ki Hong Kim a, Joon-Ki Chung a, Jack L. Komisar c, Hyun Do Jeong a,* a
Department of Aquatic Life Medicine, Pukyong National University, 599-1 Dae Yeon Dong, Nam Ku, Busan 608-737, South Korea b South Sea Fisheries Research Institute, National Fisheries R & D Institute, Yeo Su, Jeon-nam, South Korea c Department of Immunology, Walter Reed Army institute of Research, 503 Robert Grant Avenue Silver Spring, MD 20910-7500, USA Received 2 September 2003; received in revised form 10 February 2004; accepted 14 February 2004
Abstract Amplification by the polymerase chain reaction (PCR) was done to determine the presence of red sea bream iridovirus (RSIV) in sea perch (Lateolabrax sp.) imported from China, targeting four genomic regions, the ribonucleotide reductase small subunit (RNRS) gene, the adenosine triphosphatase (ATPase) gene, the DNA polymerase (DPOL) gene, and the Pst I restriction fragment, which have been considered to be potential target regions for the diagnosis of RSIV infection. In contrast to two other RSIVs, RSIV Sachun and RSIV Namhae, which were isolated in Korea, the newly isolated RSIV CH-1 was not detected by PCR with one reported primer set specific for the Pst I restriction fragment. We cloned full-length Pst I restriction fragments from the genomic DNA of three different RSIVs after PCR with primers derived from regions just outside the Pst I restriction fragment using previously reported sequences (4436 bp long and designated as the K1 region), and sequenced the resulting cloned DNA. Two locations of sequence variation, around positions 24 – 41 and 425 – 446 in the Pst I restriction fragment, were found in closely related viruses. Nucleotide differences at the first position in RSIV CH-1 prevented the binding of the sense primer derived from the sequence of the reference strain (RSIV Ehime-1) and appeared to cause a negative result in PCR amplification of the targeted Pst I restriction fragment. For differentiation of these three different RSIVs, two primers, NF and CR, specific to RSIV Namhae and CH-1, respectively, were strategically designed by taking advantage of the nucleotide substitutions and a deletion of * Corresponding author. Tel.: +82-51-620-6143; fax: +82-51-628-7430. E-mail address: [email protected] (H. Do Jeong). 1 Present address: College of Life Sciences, Kangneung National University, Gangneung, Gangwon Province 210-702, South Korea. 0044-8486/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2004.02.011
140
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
three successive nucleotides in the two variable positions of the Pst I restriction fragment. The specificity of these primers in general PCR was confirmed by using viral genomic DNAs and plasmids containing target genes of the different RSIVs as templates. In multiplex PCR with all four primers derived from two variable and two conserved positions in the Pst I restriction fragment of RSIV, it was possible to distinguish the three different RSIVs, RSIV Namhae, Sachun, and CH-1, from one another depending upon the different sizes of the PCR amplicons. Thus, the multiplex PCR developed in this study using a minimum number of strategically designed primers provides a basis for rapid and simple differentiation of RSIVs from different hosts or countries merely by the observation of the predicted amplicons and without the necessity of making nucleotide sequence comparisons. D 2004 Elsevier B.V. All rights reserved. Keywords: Red sea bream iridovirus; Korea; Sea perch imported; Diagnosis; DNA homology; Multiplex PCR
1. Introduction Since the mid-1980s, iridoviral agents have been recognized in the epizootic hematopoietic necrosis virus (EHNV), the European sheatfish (Silurus glanis) virus (ESV), and the European catfish (Ictalurus melas) virus (ECV) (Langdon, 1989; Ahne et al., 1989; Pozet et al., 1992). These three iridoviruses were shown to be related to each other and to frog virus 3 (FV3), a member of the genus Ranavirus in the family iridoviridae (Hedrick et al., 1992). Beginning about the early 1990s, other types of iridovirus infections, the chromide cichlid (Etroplus maculatus) iridovirus, the red sea bream (Pagrus major) iridovirus, the ‘‘sleepy grouper disease’’ virus, the fresh water angelfish (Pterophyllum scalare) iridovirus, and the mandarin fish (Siniperca chuati) infectious spleen and kidney necrosis virus (ISKNV) have been identified (Amstrong and Ferguson, 1989; Inouye et al., 1992; Chua et al., 1994; Rodger et al., 1997; He et al., 2001). The relationships among these iridoviruses are currently being investigated. One of the reported iridoviruses, red sea bream iridovirus (RSIV), is a piscine iridovirus and causes an acute and highly contagious disease. Since 1990, outbreaks of this viral infection, which is designated as red sea bream iridoviral disease (RSIVD), have been causing severe economic losses in Asian countries including Korea (Sohn et al., 2000; Jung and Oh, 2000), Japan (Inouye, 1992), Thailand (Sudthongkong et al., 2002), Taiwan (Chou et al., 1998), and China (He et al., 2001). This disease has caused mass mortality among cultured marine fish, which include 18 species of Perciformes, one species of Pleuronectiformes, and one species of Tetradontiformes (Matsuoka et al., 1996). A recent survey showed that more than 25 species of fish are susceptible to this virus (Nakajima, 1997). Conventional diagnosis of RSIVD is based upon electron-microscopic detection of viral particles or the appearance of enlarged cells in the spleen, kidney, gills, heart, and liver. However, with increased information available on the genomic regions of RSIV, polymerase chain reaction (PCR) amplification has been developed to provide a rapid, simple, and sensitive method for the detection of the virus-specific nucleic acids. At present, PCR analysis with primer sets based on the nucleotide sequences of the DNA polymerase (DPOL) gene, the adenosine triphosphatase (ATPase) gene, the ribonucleotide
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
141
reductase small subunit (RNRS) gene, and the Pst I restriction fragment, are being used. Miyata et al. (1997) also generated primers for PCR using the nucleotide sequences of the four cloned Pst I restriction fragments from randomly chosen RSIV genomic DNA sequences. These results suggested that iridoviruses isolated from different geographical areas might have been derived from a single origin as shown by PCR specificity and amplified products of the same size. However, it was necessary to determine more precisely if there are any differences in the nucleotide sequences or the transmission routes of the RSIV isolates that were studied. Recently we analyzed the nucleotide sequences of the PCR fragments produced from the four genomic regions considered to be potential targets for the diagnosis of RSIV infection (Jeong et al., 2003). In comparing the nucleotide sequences of nine RSIVs isolated in Korea with those of RSIV Ehime-1 as a reference strain of RSIV, we found two different types of RSIVs. One type is represented by RSIV Namhae, which produced PCR fragments 100% homologous to those of the reference sequence of RSIV Ehime-1, and the other type, RSIV Sachun, is a major type of RSIVs isolated in Korea, showing 96.6% to 98.7% nucleotide sequence homology with the reference sequence of RSIV Ehime-1 depending upon the template DNA regions used for PCR. These results caused us to suspect that even though RSIVs isolated in various geographical areas are genetically very similar, they have the potential to produce different types of variants. The aim of this study was to expand the information on the genomic nucleotide sequences considered to be potential targets for PCR diagnosis and to test the feasibility of developing rapid methods to distinguish RSIVs from each other, especially RSIVs isolated from the fish cultured in Korea and imported from China.
2. Materials and methods 2.1. Viruses Imported sea perch (Lateolabrax sp.) weighing 5 –7 g obtained as a live fly from China were screened for the presence of RSIV using PCR with the primers of Kurita et al. (1998), which were derived from the DPOL gene. Among 24 batches imported from China in April of 2000 and 2001, we found two batches of fish showing the presence of RSIV, as indicated by the amplicons obtained from spleen samples, and designated the viruses in those samples as RSIV CH-1 and RSIV CH-2. We have also obtained two RSIVs that are representative of Korea, Namhae and Sachun, in sea perch (Lateolabrax sp.) weighing 100 g, and rock bream (Oplegnathus fasciatus) weighing 100 g and suffering from typical RSIV infection in September of 1999 and 2000 from the aquatic farms of the South Sea in Korea. 2.2. Isolation of viral nucleic acids For DNA isolation, samples of about 20 mg of spleen from diseased fish were homogenized in 355 Al of TE buffer (100 mM TrisCl, 10 mM EDTA) and centrifuged at 8000 g for 10 min. Supernatants were treated with 40 Al of 10% SDS and 5 Al of 20 mg/ml proteinase K (Roche Molecular Biochemicals, Germany) for 1 h at 37 jC. After three
142
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
extractions with phenol-chloroform, the DNA was precipitated with ethanol in the presence of 0.3 M sodium acetate, redissolved in 50 Al TE buffer, and stored at 80 jC until use. 2.3. PCR Four oligonucleotide primer sets based on the nucleotide sequence of the RNRS gene, the ATPase gene, the DPOL gene, and the Pst I restriction fragment were synthesized (Bioneer, Taejon, Korea) for use in PCR assays (Table 1). These primers have been published and used for the diagnosis of RSIV infection (Kurita et al., 1998; Oshima et al., 1998). PCR amplification was carried out in a 50 Al reaction mixture containing the extracted viral nucleic acids (100 ng of the extracted total nucleic acids), 10 mM Tris– HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% w/v gelatin, 0.5% Tween-20, 200 AM of each dNTP, 1 AM of each primer, 1.25 U AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT, USA) with a Perkin-Elmer 2400 thermal cycler (Perkin-Elmer). After 2 min of predenaturation at 94 jC, the mixtures were incubated for 30 cycles at 94 jC for 30 s, 55 jC for 30 s and 72 jC for 30 s, followed by an extension period at 72 jC for 7 min. The PCR products were purified by agarose gel electrophoresis using a Prep-A-Gene DNA Purification system (Bio-Rad Laboratories, Hercules, CA, USA) and cloned into the TOPO-TA vector and transformed into the Escherichia coli competent cells following the instructions of the manufacturer (Invitrogen, Carlsbad, CA, USA). After purification of the cloned plasmid using a Plasmid Miniprep Kit (Bio-Rad Laboratories), the target DNA fragment was sequenced using the Big Dye Terminator Cycle DNA Sequencing Kit (ABI PRISM, PE Applied Biosystems, Foster City, CA, USA) and an automatic sequencer. To avoid errors due to the PCR process, PCR was performed three times with the same primers and each PCR product was cloned and sequenced. Nucleotide sequences were compared based upon a gene alignment program, MACAW (Version 2.0.5. National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD, USA) for the RSIV DNA sequences. 2.4. Multiplex PCR with newly designed primers To analyze the complete Pst I restriction fragments of all the different RSIVs, a primer set, KF (sense direction: 5V-CTGCAGTTGCCGCTCAAACA-3V) and KR (antisense Table 1 Primers used for the diagnosis of RSIV infection by the PCR method Genomic regions
Primer
Oligonucleotide sequence (5Vto 3Vdirection)
Expected size of amplicons
GenBank accession number
Reference
RNRS gene
VF VR 3F 3R 4F 4R 1F 1R
GCATGTATGCTGTTTAGACA GAGCATCAAGCAGGCGATCT CAAACCACAGCGCGGCAAGT AGTAGCGCACCATGTCCTCC CGGGGGCAATGACGACTACA CCGCCTGTGCCTTTTCTGGA CTCAAACACTCTGGCTCATC GCACCAACACATCTCCTATC
187 bp
AB018418
Oshima et al. (1998)
563 bp
AB007367
Kurita et al. (1998)
567 bp
AB007366
Kurita et al. (1998)
570 bp
AB006954
Kurita et al. (1998)
ATPase gene DPOL gene Pst I fragment
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
143
direction: 5V-CTGCAGTGCAGACACATAC-3V), was designed using the nucleotide sequence of the K1 region (Jeong et al., 2003) using sequences just upstream and just downstream of the Pst I restriction fragment. After 33 cycles of PCR, each DNA fragment amplified from the various RSIVs was cloned and sequenced by the methods described above. After comparison of the nucleotide sequences using the MACAW program, two primers, NF (sense direction: 5V-TGGCTCATCTATGTCATC-3V) and CR (antisense direction: 5V-CTGACTGTGGCTTGCCACG-3V), were designed based on the sequences of two variable regions in the Pst I restriction fragment of RSIV Namhae and CH-1, respectively. Two other primers, AF (sense direction: 5V-TACAACATGCTCCGCCAAGA-3V) and AR (antisense direction: 5V-TAAAGTAGTGAGGGCAGAAG-3V), were designed using the sequences of conserved regions found in all three different RSIVs. Multiplex PCR amplification was carried out in a 50 Al reaction mixture containing the extracted viral nucleic acids (100 ng of the extracted total nucleic acids), 10 mM Tris – HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% w/v gelatin, 0.5% Tween-20, 200 AM of each dNTP, 1 AM of each two sense and two antisense primer, 1.25 U AmpliTaq DNA polymerase (Perkin-Elmer) with a Perkin-Elmer 2400 thermal cycler (Perkin-Elmer). After 2 min of predenaturation at 94 jC, the mixtures were incubated for 35 cycles at 94 jC for 30 s, 55 jC for 30 s and 72 jC for 30 s, followed by an extension period at 72 jC for 7 min. After 1% gel electrophoresis, DNA bands were stained with ethidium bromide and then visualized by UV transillumination.
3. Results 3.1. Amplification of DNA of the different RSIVs Four RSIVs, two from rock bream (O. fasciatus) cultured in Korea and two from sea perch (Lateolabrax sp.) imported from China, were analyzed by PCR. For PCR, we used the primers that have been reported to detect the specific genes of RSIV in other laboratories (Kurita et al., 1998; Oshima et al., 1998) (Table 1). Three sets of primers corresponding to the RNRS gene, the ATPase gene and the DPOL gene were usable for all the different RSIV isolates as shown by the fact that they produced the expected amplicons, 187, 563, and 567 bp, respectively. Interestingly, a primer set derived from the Pst I restriction fragment, 1F and 1R (Kurita et al., 1998) produced the expected amplicons from the DNA of both RSIV Sachun and Namhae but not from the DNA of RSIV CH-1 and CH-2 (Fig. 1). However, when we used another primer set (KF and KR) designed from the nucleotide sequence of the K1 region just upstream and downstream of the Pst I restriction fragment, amplified DNA fragments of the expected size 1095 bp (or 1092 bp) were detected after 30 cycles of PCR from all different RSIV isolates including two from Korea and two from China (Fig. 2). To analyze the nucleotide sequence variation in the Pst I restriction fragment in order to understand the negative result in PCR with the 1F and 1R primer set, each DNA fragment amplified from the four different RSIV isolates using KF and KR primers in PCR was cloned in the TOPO vector and sequenced. The cloned full-length Pst I restriction fragment of RSIV CH-1 appeared to have 100% and 93.3% nucleotide sequence homology with the sequences of RSIV CH-
144
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Fig. 1. Detection of the DNA isolated from RSIVs by PCR with different RSIV-specific primers. (A) The product of PCR amplification with primers VF and VR (RNRS gene); (B) the product of PCR amplification with primers 3F and 3R (ATPase gene); (C) the product of PCR amplification with primers 4F and 4R (DPOL gene); (D) the product of PCR amplification with primers 1F and 1R (Pst I restriction fragment); Lanes 1, 5, 9 and 13, DNA of RSIV Namhae; Lanes 2, 6, 10 and 14, DNA of RSIV Sachun; Lanes 3, 7, 11 and 15, DNA of RSIV CH-1; Lanes 4, 8, 12 and 16, DNA of RSIV CH-2; M, 100 bp DNA ladder.
2 and RSIV Namhae, respectively (Figs. 2 and 3). The homology of the partially sequenced RNRS, ATPase, and DPOL genes of RSIV CH-1 using the amplicons produced after PCR with the reported primers (Table 1) were 93.8%, 96%, and 98.3% compared with those of RSIV Namhae, respectively (data not shown). In comparing the nucleotide sequence corresponding to the 1F primer, there was only a single nucleotide difference at the 18th position of the 1F region in the DNA of RSIV Sachun. However, RSIV CH-1 showed five nucleotide differences at the 3Vend of the 1F region, which is known to be an important part of the primer for successful PCR amplification (Fig. 3). This five-nucleotide
Fig. 2. Amplification of DNA of RSIVs using PCR with the KF and KR primers, flanking the 5Vand 3Vend of the Pst I restriction fragment, respectively. Lane 1, DNA of RSIV Namhae; Lane 2, DNA of RSIV Sachun; Lane 3, DNA of RSIV CH-1; Lane 4, DNA of RSIV CH-2; M, 100 bp DNA ladder.
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
145
Fig. 3. Primer design for discrimination of the different types of RSIVs found in Korea. Comparison of the nucleotide sequences was based on the Pst I restriction fragment in the genomic regions of RSIVs. Identical residues and gaps are represented as dots and dashes, respectively. The primers used for multiplex PCR and for cloning are boxed in black and white colors, respectively. The ends of the Pst I restriction fragment are indicated with the underlined 1F/1R primer regions of Kurita et al. (1998). N, RSIV Namhae; S, RSIV Sachun; C, RSIV CH-1.
difference might be enough to inhibit the binding of the 1F primer and prevent the production of amplicons in PCR against the DNA template of RSIV CH-1 (Fig. 1). 3.2. Comparison of the DNA nucleotide sequence of the different RSIVs Although the sequences obtained were highly homologous, they were distinct from each other (Fig. 3). In comparing the corresponding regions of the primers used for PCR to
146
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
amplify the Pst I restriction fragment, strong homology, one nucleotide difference in 20 nucleotides, is seen between the nucleotide sequence of the 1R primer and the corresponding regions of RSIV CH-1. In contrast, the similarity of the nucleotide sequence of the 1F primer region among the RSIVs was much lower. Thus RSIV Sachun and CH-1 contained one nucleotide and five nucleotide substitutions, respectively, from the sequence of the 1F primer used for PCR. Importantly, the five nucleotide differences in the region corresponding to the 1F primer in RSIV CH-1 as compared to the primer itself were located at the 3Vend position of the 1F primer. This is why we could not see the production of amplicons after PCR with the 1F/1R primer set for RSIV CH-1 but not for RSIV Sachun and Namhae. Detection of the Pst I restriction fragment using PCR with the 1F/1R primer set against the purified TOPO plasmids containing the DNA fragments produced after PCR with the KF/KR primer set against different DNA of RSIVs showed exactly the same results as those obtained with the viral DNA isolated directly from the tissues of fish infected by different RSIVs (data not shown). 3.3. Discrimination of the different RSIVs by multiplex PCR As shown in Fig. 3, the Pst I restriction fragment of RSIV CH-1 had 92.9% nucleotide sequence homology with RSIV Namhae (or the reference sequence of RSIV Ehime-1). However, we found two highly variable regions with a deletion of three continuous nucleotides in RSIV Sachun and CH-1 at position 36 –38 and 432– 434, respectively. Two primers were designed using the sequences of two variable regions, 24 –41 (sense primer NF) and 425– 446 (antisense primer CR) in the Pst I restriction fragment of RSIV Namhae and CH-1, respectively. Additionally, other two primers were designed, AF (sense primer) and AR (antisense primer), derived from the sequence of 300 –319 and 836– 855 in the Pst I regions conserved in all three different RSIV isolates (Fig. 3). Although two of the primers, NF and CR, will bind specifically only to the DNA templates of RSIV Namhae and CH-1, respectively, the other two primers, AF and AR, will bind to the DNA templates of all three different types of RSIVs during PCR. The binding sites of the primers in PCR is illustrated in Fig. 4. In a PCR assay with the AF/AR primer set, amplicons of the expected sizes (556, 832, and 144 bp, respectively) were obtained from the DNA of all three types RSIVs, while with the NF/AR set only RSIV Namhae showed an amplicon, and with the AF./CR primer
Fig. 4. Strategy to discriminate the different types of RSIVs by multiplex PCR.
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
147
Fig. 5. Detection of genomic DNA of RSIVs by PCR with different primers based on the variation of DNA nucleotide sequences in the Pst I restriction fragment. (A) Product of PCR amplification with primers AF and AR; (B) product of PCR amplification with primers NF and AR; (C) product of PCR amplification with primers AF and CR; (D) product of PCR amplification with primers NF and CR; Lanes 1, 4, 7 and 10, DNA of RSIV Namhae; Lanes 2, 5, 8 and 11, DNA of RSIV Sachun; Lanes 3, 6, 9 and 12, DNA of RSIV CH-1; M, 100 bp DNA ladder.
set, only RSIV CH-1 showed an amplicon (Fig. 5). However, PCR with the NF/CR primer set with each DNA template of three different types of RSIVs did not produce any amplicons (Fig. 5D). Thus, it was possible to apply these primers to develop the multiplex PCR for both the diagnosis of the RSIV infection with discrimination of the types of infected RSIVs in fish. As shown in Table 2, template DNA of RSIV Namhae, Sachun and CH-1 will produce two amplicons of 832 and 556 bp, one amplicon of 556 bp, and two amplicons of 553 and 144 bp, respectively in multiplex PCR with the combined four primers (NF, AF, CR, and AR). The results of multiplex PCR were analyzed by electrophoresis. We found the resulting amplicons matched exactly the expected patterns and sizes of the different templates of the isolated viral DNAs. Different concentrations of viral DNA or inhibitors present in the infected tissues appear not to have interfered with the assay because the same results were obtained after PCR with the plasmids containing the target regions (Fig. 6). Additionally, when we used as templates the viral DNA isolated from equivalent amounts of infected spleens, the density of the amplicon for RSIV
Table 2 Expected size of the amplicons after multiplex PCR with the mixed four different primers Type
Number of PCR product
Involved primers
Expected size of amplicons (bp)
RSIV Namhae
2
RSIV Sachun RSIV CH-1
1 2
NF-AR AF-AR AF-AR AF-AR AF-CR
832 556 556 553 144
148
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Fig. 6. Specificity of multiplex PCR with primers, AF, AR, NF and CR, designed for analysis of different RSIVs. Product of multiplex PCR gene amplification with: (A) genomic DNA of RSIVs; (B) the cloned Pst I restriction fragment of RSIVs; Lanes 1 and 4, DNA of RSIV Namhae; Lanes 2 and 5, DNA of RSIV Sachun; Lanes 3 and 6, DNA of RSIV CH-1; M, 100 bp DNA ladder.
CH-1 was lower compared with that for RSIV Sachun or Namhae, but there was no difference in amplicon density when PCR was done with cloned TOPO plasmids containing the target regions as templates (Fig. 6).
4. Discussion Although various primers have been designed for the detection of iridoviruses by PCR gene amplification, it has not been determined whether those primers are suitable for detecting variants of RSIVs found in different species, countries, and years. We tested four primer sets targeting RSIV and, not surprisingly, found an interesting type of RSIV that is not detected by PCR with any of the widely used primer sets (Table 1, Fig. 1). In the present study, we tried to differentiate this newly isolated RSIV from other known RSIVs by PCR. This was done by taking advantage of previous findings of our laboratory, which are (1) the 3Vend flanking region (4436 bp long and designated as K1) (Jeong et al., 2003) of the DPOL gene possessed the Pst I restriction fragment of Kurita et al. (1998) spanned between ORF-1 and ORF-2 of the unknown function, (2) RSIVs isolated in Korea might be classified as two different types, RSIV Sachun as a major type and RSIV Namhae showing the same nucleotide sequence with that of RSIV Ehime-1, (3) the lowest degree of DNA sequence homology were in the PCR products derived from the Pst I restriction fragment. Recently, in 2000 and 2001, RSIV CH-1 and CH-2, respectively, were found in PCR with primer sets against the RNRS, ATPase and DPOL genes from the spleens of sea perch (Lateolabrax sp.) imported from China as a live fly for culturing in the aquatic farms of Korea. However, neither of these RSIVs was detectable in PCR with the 1F/1R primers (Kurita et al., 1998), one of the primer sets targeting the Pst I restriction fragment in the genomic regions of RSIV (Fig. 1).
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
149
Interestingly, PCR with other primer sets, 2F(5V-TACAACATGCTCCGCCAAGA-3V)/ 1R and 2F/2R(5V-GCGTTAAAGTAGTGAGGGCA-3V), omitting the 1F primer from the combinations of sense and antisense primers from among the four primers designed by Kurita et al. (1998) from the nucleotide sequence of Pst I restriction fragment, produced amplicons of the expected size (data not shown) like the PCR analyses with the primers against the regions of RNRS, ATPase, and DPOL genes (Fig. 1). In agreement with the previous report (Jeong et al., 2003), this suggested that the RNRS, ATPase, and DPOL genes are relatively highly conserved but that the Pst I restriction fragment contains nucleotide variations especially around the sequence of the 1F primer. These nucleotide variations seemed to be stable because the same results of primer specificity were found in PCR using the DNA template of RSIV CH-2 isolated in 2001, 1 year after the isolation of CH-1 (Fig. 1). Although the nucleotide sequences of the Pst I restriction fragments of RSIV Sachun and RSIV CH-1 showed relatively high homology, 96.9% and 93.3%, respectively, to the reference sequence (RSIV Ehime-1) or RSIV Namhae, there were deletions of three successive nucleotides at different positions, at 36 –38 in RSIV Sachun and at 432 –434 in RSIV CH-1 (Fig. 3). Additionally, a relatively high rate of nucleotide variation by substitution was also found around these positions. This result prompted us to develop a rapid assay system that would permit both the diagnosis and discrimination of closely related RSIV variants using a PCR assay. We strategically designed two primers, NF and CR, using the specific nucleotide sequences around the variable positions of RSIV Namhae and CH-1, respectively, for discrimination of RSIV variants (Fig. 4, Table 2). The sequences for both the NF and CR primers are present in ORF-2 in the K1 region, of which the function is unknown (Jeong et al., 2003). Thus, even though the physiological meaning of those substitutions or deletions is not clear, these positions might be less variable than the regions present in the repeating sequences that are common in many different iridoviruses (Fischer et al., 1988; Schnitzler and Darai, 1989; Bugert et al., 1993). Two other primers, AF and AR, were also designed from the conserved regions of RSIVs to detect all the different variants of RSIV. Using different combinations of these primers and template DNA from RSIVs, we confirmed the specificity of the primers by the appearance of the expected amplicons after general PCR (Fig. 5) and propose that this multiplex PCR, using these four sets of primers in a single reaction tube, producing different sizes or numbers of amplicons depending upon the template DNA of the RSIV variants, offers a more convenient and equally specific alternative to existing assays. Multiplex PCRs in the presence of each different set of primers against all different target genes have been used in many different studies for the detection or differentiation of target genes (Basco et al., 1996; Fishback et al., 1999; Ng et al., 2001; Yoo et al., 2003). However, there has not been a report of the use of multiplex PCR to detect and discriminate three different types iridoviruses, especially with a mixture of four primers derived from two specific and two conserved genomic regions of iridoviruses. A reduction in the number of primers, four in the present work rather than the six used previously for discrimination of the three different types of RSIVs, could avoid some potential problems that might occur in other multiplex PCRs (Innis et al., 1990). As illustrated in Fig. 4 and Table 2, with a 556 bp (or 553 bp) amplicon indicating the infection of RSIV, the appearance of one of other two amplicons, 144 or 832 bp, can be exploited to discriminate
150
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
RSIV Sachun or CH-1 from RSIV Namhae. Recently, He et al. (2001) have isolated ISKNV from the mandarin fish in China and determined the complete genomic sequence. The nucleotide sequence of the Pst I restriction fragment of this virus was distinguishable from but very similar to those of three other types of RSIVs that we isolated. The Pst I restriction fragments for the NF and CR primers appeared to be very homologous, with 18/ 18 and 15/19 nucleotides, respectively, identical to those of RSIV Namhae. Thus, even though ISKNV or other members of the RSIV group of iridoviruses (Essbauer and Ahne, 2001) have not yet been found in Korea, they may in fact be present or they may spread to this region in the future, and in that case our multiplex PCR, by amplifying the DNA of these other iridoviruses, might produce amplicons the same size as those of RSIV Namhae. To address this problem, our multiplex PCR, which was designed to distinguish the three different RSIV variants found in Korea, might be modified by designing some additional primers based on the variable nucleotide sequences or various deletions in certain genomic regions of the different RSIVs in order to be able to use the assay to distinguish many other RSIV variants found in different countries or hosts. Further comparisons of nucleotide sequences of long genomic regions of various RSIVs are under way in our laboratories and might be useful in developing more powerful multiplex PCR methods and to understand the taxonomic relationships of RSIV variants. The multiplex PCR reaction for RSIV CH-1 showed a lower amplicon density compared with those of RSIV Sachun or Namhae (Fig. 6). Similar results were also found by PCR with a primer set designed in this study and with primer sets used in other laboratories previously (Figs. 1 and 2). Thus, the amount of viral DNA or numbers of virions in the RSIV CH-1-infected tissues is less than in tissues infected with RSIV Sachun or Namhae. Although it would be necessary to do other analyses, like studying the individual stages of viral infection or the numbers of TCID50 for a more accurate understanding of this difference, two points can be made. One is the time of year when the isolation is made. It has been reported that outbreaks of RSIVD occur in late summer or early autumn. We isolated RSIV CH-1 and CH-2 in April. At this time, it is hard to find RSIVD. Another factor is the health of the infected fish. Most of the reported RSIVs including RSIV Sachun and Namhae were isolated from fish showing typical symptoms of RSIVD or mass mortality. However, we isolated RSIV CH-1 and CH-2 from fish that did not show any differences from healthy fish externally or as seen by the observation of internal tissues. Unfortunately, we could not sample the infected batch of sea perch (Lateolabrax sp.) which was intended to be imported because it was returned to China as a consequence of the finding of RSIV in the tissues. There needs to be further study to determine whether the mechanism of infection of RSIV CH-1 is different from that of other RSIVs, or whether persistent infection without mass mortality in fish, even during the winter season, is possible. Additionally, it is difficult to determine whether this different variant of RSIV is already widely disseminated among various countries or whether there is still an opportunity to contain its spread. Studies are ongoing in our laboratories to answer this question. In summary, nucleotide sequence comparisons between RSIVs isolated from imported fish and two representative RSIVs isolated in Korea showed some sequence variations in closely related viruses. Using those variations, a multiplex PCR assay with strategically
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
151
designed primers was developed as a simple and rapid method for both the diagnosis and discrimination of different RSIV isolates from fish. The relationships among the RSIVs in Asian countries and other piscine iridoviruses will be a future focus of our and other laboratories.
Acknowledgements The present work (KRF-2002-041-F00046) was supported by the Korea Research Foundation Grant of 2002.
References Ahne, W., Schlotfeldt, H.J., Ogawa, M., 1989. Fish viruses: isolation of an icosahedral cytoplasmic deoxyribovirus from sheatfish (Silurus glanis). J. Vet. Med. 36, 333 – 336. Amstrong, R.D., Ferguson, H.W., 1989. Systemic viral disease of the chromide cichlid Etroplus maculatus. Dis. Aquat. Org. 7, 155 – 157. Basco, L.K., Pecoulas, P.E., Bras, J.L., Wilson, C.M., 1996. Plasmodium falciparum: molecular characterization of multidrug-resistant Cambodian isolates. Exp. Parasitol. 82, 97 – 103. Bugert, J.J., Raab, K., Rosen-Wolff, A., Janssen, W., Darai, G., 1993. Determination of the position of the boundaries of the terminal repetitive sequences within the genome of Molluscum contagiosum virus type I by DNA nucleotide analysis. Virology 192, 391 – 396. Chou, H.Y., Hsu, C.C., Peng, T.Y., 1998. Isolation and characterization of a pathogenic iridovirus from cultured grouper (Epinephelus sp.) in Taiwan. Fish Pathol. 33, 201 – 206. Chua, F.H.C., Ng, M.L., Ng, K.L., Loo, J.J., Wee, J.Y., 1994. Investigation of outbreaks of a novel disease, ‘sleepy grouper disease’, affecting the brown-spotted grouper, Epinephelus tauvina. Forskal. J. Fish. Dis. 17, 417 – 427. Essbauer, S., Ahne, W., 2001. Viruses of lower vertebrates. J. Vet. Med., Ser. B 48, 403 – 475. Fischer, M., Schnitzler, P., Scholz, J., Rosen-Wolff, A., Delius, H., Darai, G., 1988. DNA nucleotide sequence analysis of the Pvu II DNA fragment L of the genome of insect iridescent virus type 6 reveals a complex cluster of multiple tandem, overlapping and interdigitated repetitive DNA elements. Virology 167, 497 – 506. Fishback, A.G., Danzmann, R.G., Sakamoto, T., Ferguson, M.M., 1999. Optimization of semi-automated microsatellite multiplex polymerase chain reaction systems for rainbow trout (Oncorhynchus mykiss). Aquaculture 172, 247 – 254. He, J.G., Deng, M., Weng, S.P., Li, Z., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2001. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291, 126 – 139. Hedrick, R.P., Mcdowell, T.S., Ahne, W., Torhy, C., de Kinkelin, P., 1992. Properties of three iridovirus-like agents associated with systemic infections of fish. Dis. Aquat. Org. 13, 203 – 209. Innis, A.M., Gelfand, H.D., Sninsky, J.J., White, J.T., 1990. PCR Protocols: A Guide to Methods and Application. Academic Press, 24-28 Oval Road, London NW1 7DX, pp. 272 – 281. Inouye, K., Yamano, K., Maeno, Y., Nakajima, K., Matsuoka, M., Wada, Y., Sorimachi, M., 1992. Iridovirus infection of cultured red sea bream, Pagrus major. Fish Pathol. 27, 19 – 27 (in Japanese with English abstract). Jeong, J.B., Jun, L.J., Yoo, M.H., Kim, M.S., Komisar, J.L., Jeong, H.D., 2003. Characterization of the DNA nucleotide sequences in the genome of red sea bream iridoviruses isolated in Korea. Aquaculture 220, 119 – 133. Jung, S.J., Oh, M.J., 2000. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J. Fish Dis. 23, 223 – 226. Kurita, J., Nakajima, K., Hirono, I., Aoki, T., 1998. Polymerase chain reaction (PCR) amplification of DNA of red sea bream iridovirus (RSIV). Fish Pathol. 33, 17 – 23.
152
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Langdon, J.S., 1989. Experimental transmission and pathogenicity of epizootic haematopoietic necrosis virus (EHNV) in redfin perch, Perca fluviatilis L. J. Fish Dis. 12, 295 – 310. Matsuoka, S., Inouye, K., Nakajima, K., 1996. Cultured fish species affected by red sea bream iridoviral disease from 1991 to 1995. Fish Pathol. 31, 233 – 234 (in Japanese with English summary). Miyata, M., Matsuno, K., Jung, S.J., Danayadol, Y., Miyazaki, T., 1997. Genetic similarity of iridoviruses from Japan and Thailand. J. Fish Dis. 20, 127 – 134. Nakajima, K., 1997. Red sea bream iridovirus in Japan. Antigen analysis and comparison with other fish iridoviruses. NRIA International Workshop. New Approach to Viral Diseases of Aquatic Animals, Kyoto. National Research Institute of Aquaculture, Nansei, Japan, pp. 108 – 118. Ng, L.K., Martin, I., Alfa, M., Mulvey, M., 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 15, 125 – 209. Oshima, S., Hata, J., Hirasawa, N., Ohtaka, T., Hirono, I., Aoki, T., Yamashita, S., 1998. Rapid diagnosis of red sea bream iridovirus infection using the polymerase chain reaction. Dis. Aquat. Org. 32, 87 – 90. Pozet, F., Morand, M., Moussa, A., Torhy, C., de Kinkelin, P., 1992. Isolation and preliminary characterization of a pathogenic icosahedral deoxyribovirus from the catfish (Ictalurus melas). Dis. Aquat. Org. 14, 35 – 42. Rodger, H.D., Kobs, M., Macartney, A., Frerichs, G.N., 1997. Systemic iridovirus infection in freshwater angelfish, Pterophyllum scalare (Liechtenstein). J. Fish Dis. 20, 69 – 72. Schnitzler, P., Darai, G., 1989. Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses. Virology 172, 32 – 41. Sohn, S.G., Choi, D.L., Do, J.W., Hwang, G.Y., Park, J.W., 2000. Mass mortalities of cultured striped beakperch, Oplegnathus fasciatus by iridoviral infection. J. Fish Pathol. 13 (2), 121 – 127 (in Korean with English abstract). Sudthongkong, C., Miyata, M., Miyazaki, T., 2002. Viral DNA sequences of genes encoding the ATPase and the major capsid protein of tropical iridovirus isolates which are pathogenic to fishes in Japan, South China Sea and Southeast Asian countries. Arch. Virol. 147, 2089 – 2109. Yoo, M.H., Huh, M.D., Kim, E.H., Lee, H.H., Jeong, H.D., 2003. Characterization of chloramphenicol acetyltransferase gene by multiplex polymerase chain reaction in multidrug-resistant strains isolated from aquatic environment. Aquaculture 217, 11 – 21.
Multiplex PCR for the diagnosis of red sea bream iridoviruses isolated in Korea Joon Bum Jeong a, Kyung Hyun Park b, Ho Yeoul Kim a, Su Hee Hong a,1, Ki Hong Kim a, Joon-Ki Chung a, Jack L. Komisar c, Hyun Do Jeong a,* a
Department of Aquatic Life Medicine, Pukyong National University, 599-1 Dae Yeon Dong, Nam Ku, Busan 608-737, South Korea b South Sea Fisheries Research Institute, National Fisheries R & D Institute, Yeo Su, Jeon-nam, South Korea c Department of Immunology, Walter Reed Army institute of Research, 503 Robert Grant Avenue Silver Spring, MD 20910-7500, USA Received 2 September 2003; received in revised form 10 February 2004; accepted 14 February 2004
Abstract Amplification by the polymerase chain reaction (PCR) was done to determine the presence of red sea bream iridovirus (RSIV) in sea perch (Lateolabrax sp.) imported from China, targeting four genomic regions, the ribonucleotide reductase small subunit (RNRS) gene, the adenosine triphosphatase (ATPase) gene, the DNA polymerase (DPOL) gene, and the Pst I restriction fragment, which have been considered to be potential target regions for the diagnosis of RSIV infection. In contrast to two other RSIVs, RSIV Sachun and RSIV Namhae, which were isolated in Korea, the newly isolated RSIV CH-1 was not detected by PCR with one reported primer set specific for the Pst I restriction fragment. We cloned full-length Pst I restriction fragments from the genomic DNA of three different RSIVs after PCR with primers derived from regions just outside the Pst I restriction fragment using previously reported sequences (4436 bp long and designated as the K1 region), and sequenced the resulting cloned DNA. Two locations of sequence variation, around positions 24 – 41 and 425 – 446 in the Pst I restriction fragment, were found in closely related viruses. Nucleotide differences at the first position in RSIV CH-1 prevented the binding of the sense primer derived from the sequence of the reference strain (RSIV Ehime-1) and appeared to cause a negative result in PCR amplification of the targeted Pst I restriction fragment. For differentiation of these three different RSIVs, two primers, NF and CR, specific to RSIV Namhae and CH-1, respectively, were strategically designed by taking advantage of the nucleotide substitutions and a deletion of * Corresponding author. Tel.: +82-51-620-6143; fax: +82-51-628-7430. E-mail address: [email protected] (H. Do Jeong). 1 Present address: College of Life Sciences, Kangneung National University, Gangneung, Gangwon Province 210-702, South Korea. 0044-8486/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2004.02.011
140
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
three successive nucleotides in the two variable positions of the Pst I restriction fragment. The specificity of these primers in general PCR was confirmed by using viral genomic DNAs and plasmids containing target genes of the different RSIVs as templates. In multiplex PCR with all four primers derived from two variable and two conserved positions in the Pst I restriction fragment of RSIV, it was possible to distinguish the three different RSIVs, RSIV Namhae, Sachun, and CH-1, from one another depending upon the different sizes of the PCR amplicons. Thus, the multiplex PCR developed in this study using a minimum number of strategically designed primers provides a basis for rapid and simple differentiation of RSIVs from different hosts or countries merely by the observation of the predicted amplicons and without the necessity of making nucleotide sequence comparisons. D 2004 Elsevier B.V. All rights reserved. Keywords: Red sea bream iridovirus; Korea; Sea perch imported; Diagnosis; DNA homology; Multiplex PCR
1. Introduction Since the mid-1980s, iridoviral agents have been recognized in the epizootic hematopoietic necrosis virus (EHNV), the European sheatfish (Silurus glanis) virus (ESV), and the European catfish (Ictalurus melas) virus (ECV) (Langdon, 1989; Ahne et al., 1989; Pozet et al., 1992). These three iridoviruses were shown to be related to each other and to frog virus 3 (FV3), a member of the genus Ranavirus in the family iridoviridae (Hedrick et al., 1992). Beginning about the early 1990s, other types of iridovirus infections, the chromide cichlid (Etroplus maculatus) iridovirus, the red sea bream (Pagrus major) iridovirus, the ‘‘sleepy grouper disease’’ virus, the fresh water angelfish (Pterophyllum scalare) iridovirus, and the mandarin fish (Siniperca chuati) infectious spleen and kidney necrosis virus (ISKNV) have been identified (Amstrong and Ferguson, 1989; Inouye et al., 1992; Chua et al., 1994; Rodger et al., 1997; He et al., 2001). The relationships among these iridoviruses are currently being investigated. One of the reported iridoviruses, red sea bream iridovirus (RSIV), is a piscine iridovirus and causes an acute and highly contagious disease. Since 1990, outbreaks of this viral infection, which is designated as red sea bream iridoviral disease (RSIVD), have been causing severe economic losses in Asian countries including Korea (Sohn et al., 2000; Jung and Oh, 2000), Japan (Inouye, 1992), Thailand (Sudthongkong et al., 2002), Taiwan (Chou et al., 1998), and China (He et al., 2001). This disease has caused mass mortality among cultured marine fish, which include 18 species of Perciformes, one species of Pleuronectiformes, and one species of Tetradontiformes (Matsuoka et al., 1996). A recent survey showed that more than 25 species of fish are susceptible to this virus (Nakajima, 1997). Conventional diagnosis of RSIVD is based upon electron-microscopic detection of viral particles or the appearance of enlarged cells in the spleen, kidney, gills, heart, and liver. However, with increased information available on the genomic regions of RSIV, polymerase chain reaction (PCR) amplification has been developed to provide a rapid, simple, and sensitive method for the detection of the virus-specific nucleic acids. At present, PCR analysis with primer sets based on the nucleotide sequences of the DNA polymerase (DPOL) gene, the adenosine triphosphatase (ATPase) gene, the ribonucleotide
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
141
reductase small subunit (RNRS) gene, and the Pst I restriction fragment, are being used. Miyata et al. (1997) also generated primers for PCR using the nucleotide sequences of the four cloned Pst I restriction fragments from randomly chosen RSIV genomic DNA sequences. These results suggested that iridoviruses isolated from different geographical areas might have been derived from a single origin as shown by PCR specificity and amplified products of the same size. However, it was necessary to determine more precisely if there are any differences in the nucleotide sequences or the transmission routes of the RSIV isolates that were studied. Recently we analyzed the nucleotide sequences of the PCR fragments produced from the four genomic regions considered to be potential targets for the diagnosis of RSIV infection (Jeong et al., 2003). In comparing the nucleotide sequences of nine RSIVs isolated in Korea with those of RSIV Ehime-1 as a reference strain of RSIV, we found two different types of RSIVs. One type is represented by RSIV Namhae, which produced PCR fragments 100% homologous to those of the reference sequence of RSIV Ehime-1, and the other type, RSIV Sachun, is a major type of RSIVs isolated in Korea, showing 96.6% to 98.7% nucleotide sequence homology with the reference sequence of RSIV Ehime-1 depending upon the template DNA regions used for PCR. These results caused us to suspect that even though RSIVs isolated in various geographical areas are genetically very similar, they have the potential to produce different types of variants. The aim of this study was to expand the information on the genomic nucleotide sequences considered to be potential targets for PCR diagnosis and to test the feasibility of developing rapid methods to distinguish RSIVs from each other, especially RSIVs isolated from the fish cultured in Korea and imported from China.
2. Materials and methods 2.1. Viruses Imported sea perch (Lateolabrax sp.) weighing 5 –7 g obtained as a live fly from China were screened for the presence of RSIV using PCR with the primers of Kurita et al. (1998), which were derived from the DPOL gene. Among 24 batches imported from China in April of 2000 and 2001, we found two batches of fish showing the presence of RSIV, as indicated by the amplicons obtained from spleen samples, and designated the viruses in those samples as RSIV CH-1 and RSIV CH-2. We have also obtained two RSIVs that are representative of Korea, Namhae and Sachun, in sea perch (Lateolabrax sp.) weighing 100 g, and rock bream (Oplegnathus fasciatus) weighing 100 g and suffering from typical RSIV infection in September of 1999 and 2000 from the aquatic farms of the South Sea in Korea. 2.2. Isolation of viral nucleic acids For DNA isolation, samples of about 20 mg of spleen from diseased fish were homogenized in 355 Al of TE buffer (100 mM TrisCl, 10 mM EDTA) and centrifuged at 8000 g for 10 min. Supernatants were treated with 40 Al of 10% SDS and 5 Al of 20 mg/ml proteinase K (Roche Molecular Biochemicals, Germany) for 1 h at 37 jC. After three
142
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
extractions with phenol-chloroform, the DNA was precipitated with ethanol in the presence of 0.3 M sodium acetate, redissolved in 50 Al TE buffer, and stored at 80 jC until use. 2.3. PCR Four oligonucleotide primer sets based on the nucleotide sequence of the RNRS gene, the ATPase gene, the DPOL gene, and the Pst I restriction fragment were synthesized (Bioneer, Taejon, Korea) for use in PCR assays (Table 1). These primers have been published and used for the diagnosis of RSIV infection (Kurita et al., 1998; Oshima et al., 1998). PCR amplification was carried out in a 50 Al reaction mixture containing the extracted viral nucleic acids (100 ng of the extracted total nucleic acids), 10 mM Tris– HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% w/v gelatin, 0.5% Tween-20, 200 AM of each dNTP, 1 AM of each primer, 1.25 U AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT, USA) with a Perkin-Elmer 2400 thermal cycler (Perkin-Elmer). After 2 min of predenaturation at 94 jC, the mixtures were incubated for 30 cycles at 94 jC for 30 s, 55 jC for 30 s and 72 jC for 30 s, followed by an extension period at 72 jC for 7 min. The PCR products were purified by agarose gel electrophoresis using a Prep-A-Gene DNA Purification system (Bio-Rad Laboratories, Hercules, CA, USA) and cloned into the TOPO-TA vector and transformed into the Escherichia coli competent cells following the instructions of the manufacturer (Invitrogen, Carlsbad, CA, USA). After purification of the cloned plasmid using a Plasmid Miniprep Kit (Bio-Rad Laboratories), the target DNA fragment was sequenced using the Big Dye Terminator Cycle DNA Sequencing Kit (ABI PRISM, PE Applied Biosystems, Foster City, CA, USA) and an automatic sequencer. To avoid errors due to the PCR process, PCR was performed three times with the same primers and each PCR product was cloned and sequenced. Nucleotide sequences were compared based upon a gene alignment program, MACAW (Version 2.0.5. National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD, USA) for the RSIV DNA sequences. 2.4. Multiplex PCR with newly designed primers To analyze the complete Pst I restriction fragments of all the different RSIVs, a primer set, KF (sense direction: 5V-CTGCAGTTGCCGCTCAAACA-3V) and KR (antisense Table 1 Primers used for the diagnosis of RSIV infection by the PCR method Genomic regions
Primer
Oligonucleotide sequence (5Vto 3Vdirection)
Expected size of amplicons
GenBank accession number
Reference
RNRS gene
VF VR 3F 3R 4F 4R 1F 1R
GCATGTATGCTGTTTAGACA GAGCATCAAGCAGGCGATCT CAAACCACAGCGCGGCAAGT AGTAGCGCACCATGTCCTCC CGGGGGCAATGACGACTACA CCGCCTGTGCCTTTTCTGGA CTCAAACACTCTGGCTCATC GCACCAACACATCTCCTATC
187 bp
AB018418
Oshima et al. (1998)
563 bp
AB007367
Kurita et al. (1998)
567 bp
AB007366
Kurita et al. (1998)
570 bp
AB006954
Kurita et al. (1998)
ATPase gene DPOL gene Pst I fragment
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
143
direction: 5V-CTGCAGTGCAGACACATAC-3V), was designed using the nucleotide sequence of the K1 region (Jeong et al., 2003) using sequences just upstream and just downstream of the Pst I restriction fragment. After 33 cycles of PCR, each DNA fragment amplified from the various RSIVs was cloned and sequenced by the methods described above. After comparison of the nucleotide sequences using the MACAW program, two primers, NF (sense direction: 5V-TGGCTCATCTATGTCATC-3V) and CR (antisense direction: 5V-CTGACTGTGGCTTGCCACG-3V), were designed based on the sequences of two variable regions in the Pst I restriction fragment of RSIV Namhae and CH-1, respectively. Two other primers, AF (sense direction: 5V-TACAACATGCTCCGCCAAGA-3V) and AR (antisense direction: 5V-TAAAGTAGTGAGGGCAGAAG-3V), were designed using the sequences of conserved regions found in all three different RSIVs. Multiplex PCR amplification was carried out in a 50 Al reaction mixture containing the extracted viral nucleic acids (100 ng of the extracted total nucleic acids), 10 mM Tris – HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% w/v gelatin, 0.5% Tween-20, 200 AM of each dNTP, 1 AM of each two sense and two antisense primer, 1.25 U AmpliTaq DNA polymerase (Perkin-Elmer) with a Perkin-Elmer 2400 thermal cycler (Perkin-Elmer). After 2 min of predenaturation at 94 jC, the mixtures were incubated for 35 cycles at 94 jC for 30 s, 55 jC for 30 s and 72 jC for 30 s, followed by an extension period at 72 jC for 7 min. After 1% gel electrophoresis, DNA bands were stained with ethidium bromide and then visualized by UV transillumination.
3. Results 3.1. Amplification of DNA of the different RSIVs Four RSIVs, two from rock bream (O. fasciatus) cultured in Korea and two from sea perch (Lateolabrax sp.) imported from China, were analyzed by PCR. For PCR, we used the primers that have been reported to detect the specific genes of RSIV in other laboratories (Kurita et al., 1998; Oshima et al., 1998) (Table 1). Three sets of primers corresponding to the RNRS gene, the ATPase gene and the DPOL gene were usable for all the different RSIV isolates as shown by the fact that they produced the expected amplicons, 187, 563, and 567 bp, respectively. Interestingly, a primer set derived from the Pst I restriction fragment, 1F and 1R (Kurita et al., 1998) produced the expected amplicons from the DNA of both RSIV Sachun and Namhae but not from the DNA of RSIV CH-1 and CH-2 (Fig. 1). However, when we used another primer set (KF and KR) designed from the nucleotide sequence of the K1 region just upstream and downstream of the Pst I restriction fragment, amplified DNA fragments of the expected size 1095 bp (or 1092 bp) were detected after 30 cycles of PCR from all different RSIV isolates including two from Korea and two from China (Fig. 2). To analyze the nucleotide sequence variation in the Pst I restriction fragment in order to understand the negative result in PCR with the 1F and 1R primer set, each DNA fragment amplified from the four different RSIV isolates using KF and KR primers in PCR was cloned in the TOPO vector and sequenced. The cloned full-length Pst I restriction fragment of RSIV CH-1 appeared to have 100% and 93.3% nucleotide sequence homology with the sequences of RSIV CH-
144
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Fig. 1. Detection of the DNA isolated from RSIVs by PCR with different RSIV-specific primers. (A) The product of PCR amplification with primers VF and VR (RNRS gene); (B) the product of PCR amplification with primers 3F and 3R (ATPase gene); (C) the product of PCR amplification with primers 4F and 4R (DPOL gene); (D) the product of PCR amplification with primers 1F and 1R (Pst I restriction fragment); Lanes 1, 5, 9 and 13, DNA of RSIV Namhae; Lanes 2, 6, 10 and 14, DNA of RSIV Sachun; Lanes 3, 7, 11 and 15, DNA of RSIV CH-1; Lanes 4, 8, 12 and 16, DNA of RSIV CH-2; M, 100 bp DNA ladder.
2 and RSIV Namhae, respectively (Figs. 2 and 3). The homology of the partially sequenced RNRS, ATPase, and DPOL genes of RSIV CH-1 using the amplicons produced after PCR with the reported primers (Table 1) were 93.8%, 96%, and 98.3% compared with those of RSIV Namhae, respectively (data not shown). In comparing the nucleotide sequence corresponding to the 1F primer, there was only a single nucleotide difference at the 18th position of the 1F region in the DNA of RSIV Sachun. However, RSIV CH-1 showed five nucleotide differences at the 3Vend of the 1F region, which is known to be an important part of the primer for successful PCR amplification (Fig. 3). This five-nucleotide
Fig. 2. Amplification of DNA of RSIVs using PCR with the KF and KR primers, flanking the 5Vand 3Vend of the Pst I restriction fragment, respectively. Lane 1, DNA of RSIV Namhae; Lane 2, DNA of RSIV Sachun; Lane 3, DNA of RSIV CH-1; Lane 4, DNA of RSIV CH-2; M, 100 bp DNA ladder.
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
145
Fig. 3. Primer design for discrimination of the different types of RSIVs found in Korea. Comparison of the nucleotide sequences was based on the Pst I restriction fragment in the genomic regions of RSIVs. Identical residues and gaps are represented as dots and dashes, respectively. The primers used for multiplex PCR and for cloning are boxed in black and white colors, respectively. The ends of the Pst I restriction fragment are indicated with the underlined 1F/1R primer regions of Kurita et al. (1998). N, RSIV Namhae; S, RSIV Sachun; C, RSIV CH-1.
difference might be enough to inhibit the binding of the 1F primer and prevent the production of amplicons in PCR against the DNA template of RSIV CH-1 (Fig. 1). 3.2. Comparison of the DNA nucleotide sequence of the different RSIVs Although the sequences obtained were highly homologous, they were distinct from each other (Fig. 3). In comparing the corresponding regions of the primers used for PCR to
146
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
amplify the Pst I restriction fragment, strong homology, one nucleotide difference in 20 nucleotides, is seen between the nucleotide sequence of the 1R primer and the corresponding regions of RSIV CH-1. In contrast, the similarity of the nucleotide sequence of the 1F primer region among the RSIVs was much lower. Thus RSIV Sachun and CH-1 contained one nucleotide and five nucleotide substitutions, respectively, from the sequence of the 1F primer used for PCR. Importantly, the five nucleotide differences in the region corresponding to the 1F primer in RSIV CH-1 as compared to the primer itself were located at the 3Vend position of the 1F primer. This is why we could not see the production of amplicons after PCR with the 1F/1R primer set for RSIV CH-1 but not for RSIV Sachun and Namhae. Detection of the Pst I restriction fragment using PCR with the 1F/1R primer set against the purified TOPO plasmids containing the DNA fragments produced after PCR with the KF/KR primer set against different DNA of RSIVs showed exactly the same results as those obtained with the viral DNA isolated directly from the tissues of fish infected by different RSIVs (data not shown). 3.3. Discrimination of the different RSIVs by multiplex PCR As shown in Fig. 3, the Pst I restriction fragment of RSIV CH-1 had 92.9% nucleotide sequence homology with RSIV Namhae (or the reference sequence of RSIV Ehime-1). However, we found two highly variable regions with a deletion of three continuous nucleotides in RSIV Sachun and CH-1 at position 36 –38 and 432– 434, respectively. Two primers were designed using the sequences of two variable regions, 24 –41 (sense primer NF) and 425– 446 (antisense primer CR) in the Pst I restriction fragment of RSIV Namhae and CH-1, respectively. Additionally, other two primers were designed, AF (sense primer) and AR (antisense primer), derived from the sequence of 300 –319 and 836– 855 in the Pst I regions conserved in all three different RSIV isolates (Fig. 3). Although two of the primers, NF and CR, will bind specifically only to the DNA templates of RSIV Namhae and CH-1, respectively, the other two primers, AF and AR, will bind to the DNA templates of all three different types of RSIVs during PCR. The binding sites of the primers in PCR is illustrated in Fig. 4. In a PCR assay with the AF/AR primer set, amplicons of the expected sizes (556, 832, and 144 bp, respectively) were obtained from the DNA of all three types RSIVs, while with the NF/AR set only RSIV Namhae showed an amplicon, and with the AF./CR primer
Fig. 4. Strategy to discriminate the different types of RSIVs by multiplex PCR.
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
147
Fig. 5. Detection of genomic DNA of RSIVs by PCR with different primers based on the variation of DNA nucleotide sequences in the Pst I restriction fragment. (A) Product of PCR amplification with primers AF and AR; (B) product of PCR amplification with primers NF and AR; (C) product of PCR amplification with primers AF and CR; (D) product of PCR amplification with primers NF and CR; Lanes 1, 4, 7 and 10, DNA of RSIV Namhae; Lanes 2, 5, 8 and 11, DNA of RSIV Sachun; Lanes 3, 6, 9 and 12, DNA of RSIV CH-1; M, 100 bp DNA ladder.
set, only RSIV CH-1 showed an amplicon (Fig. 5). However, PCR with the NF/CR primer set with each DNA template of three different types of RSIVs did not produce any amplicons (Fig. 5D). Thus, it was possible to apply these primers to develop the multiplex PCR for both the diagnosis of the RSIV infection with discrimination of the types of infected RSIVs in fish. As shown in Table 2, template DNA of RSIV Namhae, Sachun and CH-1 will produce two amplicons of 832 and 556 bp, one amplicon of 556 bp, and two amplicons of 553 and 144 bp, respectively in multiplex PCR with the combined four primers (NF, AF, CR, and AR). The results of multiplex PCR were analyzed by electrophoresis. We found the resulting amplicons matched exactly the expected patterns and sizes of the different templates of the isolated viral DNAs. Different concentrations of viral DNA or inhibitors present in the infected tissues appear not to have interfered with the assay because the same results were obtained after PCR with the plasmids containing the target regions (Fig. 6). Additionally, when we used as templates the viral DNA isolated from equivalent amounts of infected spleens, the density of the amplicon for RSIV
Table 2 Expected size of the amplicons after multiplex PCR with the mixed four different primers Type
Number of PCR product
Involved primers
Expected size of amplicons (bp)
RSIV Namhae
2
RSIV Sachun RSIV CH-1
1 2
NF-AR AF-AR AF-AR AF-AR AF-CR
832 556 556 553 144
148
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Fig. 6. Specificity of multiplex PCR with primers, AF, AR, NF and CR, designed for analysis of different RSIVs. Product of multiplex PCR gene amplification with: (A) genomic DNA of RSIVs; (B) the cloned Pst I restriction fragment of RSIVs; Lanes 1 and 4, DNA of RSIV Namhae; Lanes 2 and 5, DNA of RSIV Sachun; Lanes 3 and 6, DNA of RSIV CH-1; M, 100 bp DNA ladder.
CH-1 was lower compared with that for RSIV Sachun or Namhae, but there was no difference in amplicon density when PCR was done with cloned TOPO plasmids containing the target regions as templates (Fig. 6).
4. Discussion Although various primers have been designed for the detection of iridoviruses by PCR gene amplification, it has not been determined whether those primers are suitable for detecting variants of RSIVs found in different species, countries, and years. We tested four primer sets targeting RSIV and, not surprisingly, found an interesting type of RSIV that is not detected by PCR with any of the widely used primer sets (Table 1, Fig. 1). In the present study, we tried to differentiate this newly isolated RSIV from other known RSIVs by PCR. This was done by taking advantage of previous findings of our laboratory, which are (1) the 3Vend flanking region (4436 bp long and designated as K1) (Jeong et al., 2003) of the DPOL gene possessed the Pst I restriction fragment of Kurita et al. (1998) spanned between ORF-1 and ORF-2 of the unknown function, (2) RSIVs isolated in Korea might be classified as two different types, RSIV Sachun as a major type and RSIV Namhae showing the same nucleotide sequence with that of RSIV Ehime-1, (3) the lowest degree of DNA sequence homology were in the PCR products derived from the Pst I restriction fragment. Recently, in 2000 and 2001, RSIV CH-1 and CH-2, respectively, were found in PCR with primer sets against the RNRS, ATPase and DPOL genes from the spleens of sea perch (Lateolabrax sp.) imported from China as a live fly for culturing in the aquatic farms of Korea. However, neither of these RSIVs was detectable in PCR with the 1F/1R primers (Kurita et al., 1998), one of the primer sets targeting the Pst I restriction fragment in the genomic regions of RSIV (Fig. 1).
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
149
Interestingly, PCR with other primer sets, 2F(5V-TACAACATGCTCCGCCAAGA-3V)/ 1R and 2F/2R(5V-GCGTTAAAGTAGTGAGGGCA-3V), omitting the 1F primer from the combinations of sense and antisense primers from among the four primers designed by Kurita et al. (1998) from the nucleotide sequence of Pst I restriction fragment, produced amplicons of the expected size (data not shown) like the PCR analyses with the primers against the regions of RNRS, ATPase, and DPOL genes (Fig. 1). In agreement with the previous report (Jeong et al., 2003), this suggested that the RNRS, ATPase, and DPOL genes are relatively highly conserved but that the Pst I restriction fragment contains nucleotide variations especially around the sequence of the 1F primer. These nucleotide variations seemed to be stable because the same results of primer specificity were found in PCR using the DNA template of RSIV CH-2 isolated in 2001, 1 year after the isolation of CH-1 (Fig. 1). Although the nucleotide sequences of the Pst I restriction fragments of RSIV Sachun and RSIV CH-1 showed relatively high homology, 96.9% and 93.3%, respectively, to the reference sequence (RSIV Ehime-1) or RSIV Namhae, there were deletions of three successive nucleotides at different positions, at 36 –38 in RSIV Sachun and at 432 –434 in RSIV CH-1 (Fig. 3). Additionally, a relatively high rate of nucleotide variation by substitution was also found around these positions. This result prompted us to develop a rapid assay system that would permit both the diagnosis and discrimination of closely related RSIV variants using a PCR assay. We strategically designed two primers, NF and CR, using the specific nucleotide sequences around the variable positions of RSIV Namhae and CH-1, respectively, for discrimination of RSIV variants (Fig. 4, Table 2). The sequences for both the NF and CR primers are present in ORF-2 in the K1 region, of which the function is unknown (Jeong et al., 2003). Thus, even though the physiological meaning of those substitutions or deletions is not clear, these positions might be less variable than the regions present in the repeating sequences that are common in many different iridoviruses (Fischer et al., 1988; Schnitzler and Darai, 1989; Bugert et al., 1993). Two other primers, AF and AR, were also designed from the conserved regions of RSIVs to detect all the different variants of RSIV. Using different combinations of these primers and template DNA from RSIVs, we confirmed the specificity of the primers by the appearance of the expected amplicons after general PCR (Fig. 5) and propose that this multiplex PCR, using these four sets of primers in a single reaction tube, producing different sizes or numbers of amplicons depending upon the template DNA of the RSIV variants, offers a more convenient and equally specific alternative to existing assays. Multiplex PCRs in the presence of each different set of primers against all different target genes have been used in many different studies for the detection or differentiation of target genes (Basco et al., 1996; Fishback et al., 1999; Ng et al., 2001; Yoo et al., 2003). However, there has not been a report of the use of multiplex PCR to detect and discriminate three different types iridoviruses, especially with a mixture of four primers derived from two specific and two conserved genomic regions of iridoviruses. A reduction in the number of primers, four in the present work rather than the six used previously for discrimination of the three different types of RSIVs, could avoid some potential problems that might occur in other multiplex PCRs (Innis et al., 1990). As illustrated in Fig. 4 and Table 2, with a 556 bp (or 553 bp) amplicon indicating the infection of RSIV, the appearance of one of other two amplicons, 144 or 832 bp, can be exploited to discriminate
150
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
RSIV Sachun or CH-1 from RSIV Namhae. Recently, He et al. (2001) have isolated ISKNV from the mandarin fish in China and determined the complete genomic sequence. The nucleotide sequence of the Pst I restriction fragment of this virus was distinguishable from but very similar to those of three other types of RSIVs that we isolated. The Pst I restriction fragments for the NF and CR primers appeared to be very homologous, with 18/ 18 and 15/19 nucleotides, respectively, identical to those of RSIV Namhae. Thus, even though ISKNV or other members of the RSIV group of iridoviruses (Essbauer and Ahne, 2001) have not yet been found in Korea, they may in fact be present or they may spread to this region in the future, and in that case our multiplex PCR, by amplifying the DNA of these other iridoviruses, might produce amplicons the same size as those of RSIV Namhae. To address this problem, our multiplex PCR, which was designed to distinguish the three different RSIV variants found in Korea, might be modified by designing some additional primers based on the variable nucleotide sequences or various deletions in certain genomic regions of the different RSIVs in order to be able to use the assay to distinguish many other RSIV variants found in different countries or hosts. Further comparisons of nucleotide sequences of long genomic regions of various RSIVs are under way in our laboratories and might be useful in developing more powerful multiplex PCR methods and to understand the taxonomic relationships of RSIV variants. The multiplex PCR reaction for RSIV CH-1 showed a lower amplicon density compared with those of RSIV Sachun or Namhae (Fig. 6). Similar results were also found by PCR with a primer set designed in this study and with primer sets used in other laboratories previously (Figs. 1 and 2). Thus, the amount of viral DNA or numbers of virions in the RSIV CH-1-infected tissues is less than in tissues infected with RSIV Sachun or Namhae. Although it would be necessary to do other analyses, like studying the individual stages of viral infection or the numbers of TCID50 for a more accurate understanding of this difference, two points can be made. One is the time of year when the isolation is made. It has been reported that outbreaks of RSIVD occur in late summer or early autumn. We isolated RSIV CH-1 and CH-2 in April. At this time, it is hard to find RSIVD. Another factor is the health of the infected fish. Most of the reported RSIVs including RSIV Sachun and Namhae were isolated from fish showing typical symptoms of RSIVD or mass mortality. However, we isolated RSIV CH-1 and CH-2 from fish that did not show any differences from healthy fish externally or as seen by the observation of internal tissues. Unfortunately, we could not sample the infected batch of sea perch (Lateolabrax sp.) which was intended to be imported because it was returned to China as a consequence of the finding of RSIV in the tissues. There needs to be further study to determine whether the mechanism of infection of RSIV CH-1 is different from that of other RSIVs, or whether persistent infection without mass mortality in fish, even during the winter season, is possible. Additionally, it is difficult to determine whether this different variant of RSIV is already widely disseminated among various countries or whether there is still an opportunity to contain its spread. Studies are ongoing in our laboratories to answer this question. In summary, nucleotide sequence comparisons between RSIVs isolated from imported fish and two representative RSIVs isolated in Korea showed some sequence variations in closely related viruses. Using those variations, a multiplex PCR assay with strategically
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
151
designed primers was developed as a simple and rapid method for both the diagnosis and discrimination of different RSIV isolates from fish. The relationships among the RSIVs in Asian countries and other piscine iridoviruses will be a future focus of our and other laboratories.
Acknowledgements The present work (KRF-2002-041-F00046) was supported by the Korea Research Foundation Grant of 2002.
References Ahne, W., Schlotfeldt, H.J., Ogawa, M., 1989. Fish viruses: isolation of an icosahedral cytoplasmic deoxyribovirus from sheatfish (Silurus glanis). J. Vet. Med. 36, 333 – 336. Amstrong, R.D., Ferguson, H.W., 1989. Systemic viral disease of the chromide cichlid Etroplus maculatus. Dis. Aquat. Org. 7, 155 – 157. Basco, L.K., Pecoulas, P.E., Bras, J.L., Wilson, C.M., 1996. Plasmodium falciparum: molecular characterization of multidrug-resistant Cambodian isolates. Exp. Parasitol. 82, 97 – 103. Bugert, J.J., Raab, K., Rosen-Wolff, A., Janssen, W., Darai, G., 1993. Determination of the position of the boundaries of the terminal repetitive sequences within the genome of Molluscum contagiosum virus type I by DNA nucleotide analysis. Virology 192, 391 – 396. Chou, H.Y., Hsu, C.C., Peng, T.Y., 1998. Isolation and characterization of a pathogenic iridovirus from cultured grouper (Epinephelus sp.) in Taiwan. Fish Pathol. 33, 201 – 206. Chua, F.H.C., Ng, M.L., Ng, K.L., Loo, J.J., Wee, J.Y., 1994. Investigation of outbreaks of a novel disease, ‘sleepy grouper disease’, affecting the brown-spotted grouper, Epinephelus tauvina. Forskal. J. Fish. Dis. 17, 417 – 427. Essbauer, S., Ahne, W., 2001. Viruses of lower vertebrates. J. Vet. Med., Ser. B 48, 403 – 475. Fischer, M., Schnitzler, P., Scholz, J., Rosen-Wolff, A., Delius, H., Darai, G., 1988. DNA nucleotide sequence analysis of the Pvu II DNA fragment L of the genome of insect iridescent virus type 6 reveals a complex cluster of multiple tandem, overlapping and interdigitated repetitive DNA elements. Virology 167, 497 – 506. Fishback, A.G., Danzmann, R.G., Sakamoto, T., Ferguson, M.M., 1999. Optimization of semi-automated microsatellite multiplex polymerase chain reaction systems for rainbow trout (Oncorhynchus mykiss). Aquaculture 172, 247 – 254. He, J.G., Deng, M., Weng, S.P., Li, Z., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2001. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291, 126 – 139. Hedrick, R.P., Mcdowell, T.S., Ahne, W., Torhy, C., de Kinkelin, P., 1992. Properties of three iridovirus-like agents associated with systemic infections of fish. Dis. Aquat. Org. 13, 203 – 209. Innis, A.M., Gelfand, H.D., Sninsky, J.J., White, J.T., 1990. PCR Protocols: A Guide to Methods and Application. Academic Press, 24-28 Oval Road, London NW1 7DX, pp. 272 – 281. Inouye, K., Yamano, K., Maeno, Y., Nakajima, K., Matsuoka, M., Wada, Y., Sorimachi, M., 1992. Iridovirus infection of cultured red sea bream, Pagrus major. Fish Pathol. 27, 19 – 27 (in Japanese with English abstract). Jeong, J.B., Jun, L.J., Yoo, M.H., Kim, M.S., Komisar, J.L., Jeong, H.D., 2003. Characterization of the DNA nucleotide sequences in the genome of red sea bream iridoviruses isolated in Korea. Aquaculture 220, 119 – 133. Jung, S.J., Oh, M.J., 2000. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J. Fish Dis. 23, 223 – 226. Kurita, J., Nakajima, K., Hirono, I., Aoki, T., 1998. Polymerase chain reaction (PCR) amplification of DNA of red sea bream iridovirus (RSIV). Fish Pathol. 33, 17 – 23.
152
J. Bum Jeong et al. / Aquaculture 235 (2004) 139–152
Langdon, J.S., 1989. Experimental transmission and pathogenicity of epizootic haematopoietic necrosis virus (EHNV) in redfin perch, Perca fluviatilis L. J. Fish Dis. 12, 295 – 310. Matsuoka, S., Inouye, K., Nakajima, K., 1996. Cultured fish species affected by red sea bream iridoviral disease from 1991 to 1995. Fish Pathol. 31, 233 – 234 (in Japanese with English summary). Miyata, M., Matsuno, K., Jung, S.J., Danayadol, Y., Miyazaki, T., 1997. Genetic similarity of iridoviruses from Japan and Thailand. J. Fish Dis. 20, 127 – 134. Nakajima, K., 1997. Red sea bream iridovirus in Japan. Antigen analysis and comparison with other fish iridoviruses. NRIA International Workshop. New Approach to Viral Diseases of Aquatic Animals, Kyoto. National Research Institute of Aquaculture, Nansei, Japan, pp. 108 – 118. Ng, L.K., Martin, I., Alfa, M., Mulvey, M., 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 15, 125 – 209. Oshima, S., Hata, J., Hirasawa, N., Ohtaka, T., Hirono, I., Aoki, T., Yamashita, S., 1998. Rapid diagnosis of red sea bream iridovirus infection using the polymerase chain reaction. Dis. Aquat. Org. 32, 87 – 90. Pozet, F., Morand, M., Moussa, A., Torhy, C., de Kinkelin, P., 1992. Isolation and preliminary characterization of a pathogenic icosahedral deoxyribovirus from the catfish (Ictalurus melas). Dis. Aquat. Org. 14, 35 – 42. Rodger, H.D., Kobs, M., Macartney, A., Frerichs, G.N., 1997. Systemic iridovirus infection in freshwater angelfish, Pterophyllum scalare (Liechtenstein). J. Fish Dis. 20, 69 – 72. Schnitzler, P., Darai, G., 1989. Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses. Virology 172, 32 – 41. Sohn, S.G., Choi, D.L., Do, J.W., Hwang, G.Y., Park, J.W., 2000. Mass mortalities of cultured striped beakperch, Oplegnathus fasciatus by iridoviral infection. J. Fish Pathol. 13 (2), 121 – 127 (in Korean with English abstract). Sudthongkong, C., Miyata, M., Miyazaki, T., 2002. Viral DNA sequences of genes encoding the ATPase and the major capsid protein of tropical iridovirus isolates which are pathogenic to fishes in Japan, South China Sea and Southeast Asian countries. Arch. Virol. 147, 2089 – 2109. Yoo, M.H., Huh, M.D., Kim, E.H., Lee, H.H., Jeong, H.D., 2003. Characterization of chloramphenicol acetyltransferase gene by multiplex polymerase chain reaction in multidrug-resistant strains isolated from aquatic environment. Aquaculture 217, 11 – 21.