Multiplexed Gene Expression and Fusion Transcript Analysis to Detect ALK Fusions in Lung Cancer

The Journal of Molecular Diagnostics, Vol. 15, No. 1, January 2013

jmd.amjpathol.org

Multiplexed Gene Expression and Fusion Transcript Analysis to Detect ALK Fusions in Lung Cancer Maruja E. Lira,* Tae Min Kim,yz Donghui Huang,* Shibing Deng,* Youngil Koh,z Bogun Jang,x Heounjeong Go,x Se-Hoon Lee,yz Doo Hyun Chung,x Woo Ho Kim,x Eric F.P.M. Schoenmakers,* Yoon-La Choi,{ Keunchil Park,k Jin Seok Ahn,k Jong-Mu Sun,k Myung-Ju Ahn,k Dong-Wan Kim,yz and Mao Mao* From Pfizer Oncology,* San Diego, California; the Cancer Research Institute,y Seoul National University College of Medicine, Seoul, South Korea; the Departments of Internal Medicinez and Pathology,x Seoul National University Hospital, Seoul, South Korea; and the Departments of Pathology{ and Medicine,k Samsung Medical Center, Seoul, South Korea Accepted for publication August 24, 2012. Address correspondence to Dong-Wan Kim, M.D., Ph.D, Department of Internal Medicine, Seoul National University Hospital, 101 Daehak-ro, Jongno-gu, Seoul 110-744, South Korea; or Mao Mao, M.D., Ph.D, Pfizer Oncology, 10724 Science Center Dr, San Diego, CA 92121. E-mail: [email protected] or mao.mao@pfizer.com.

Anaplastic lymphoma kinase gene (ALK) fusions have been identified in approximately 5% of nonsmall-cell lung carcinomas (NSCLCs) and define a distinct subpopulation of patients with lung cancer who are highly responsive to ALK kinase inhibitors, such as crizotinib. Because of this profound therapeutic implication, the latest National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology recommend upfront ALK screening for all patients with NSCLC. The Food and Drug Administrationeapproved companion diagnostic test (ie, fluorescence in situ hybridization) for identification of ALK-positive patients, however, is complex and has considerable limitations in terms of cost and throughput, making it difficult to screen many patients. To explore alternative screening modalities for detecting ALK fusions, we designed a combination of two transcript-based assays to detect for presence or absence of ALK fusions using NanoString’s nCounter technology. By using this combined gene expression and ALK fusion detection strategy, we developed a multiplexed assay with a quantitative scoring modality that is highly sensitive, reproducible, and capable of detecting low-abundant ALK fusion transcripts, even in samples with a low tumor cell content. In 66 archival NSCLC samples, our results were highly concordant to prior results obtained by fluorescence in situ hybridization and IHC. Our assay offers a cost-effective, easyto-perform, high-throughput, and FFPE-compatible screening alternative for detection of ALK fusions. (J Mol Diagn 2013, 15: 51e61; http://dx.doi.org/10.1016/j.jmoldx.2012.08.006)

Chromosomal aberrations targeting the anaplastic lymphoma kinase gene (ALK ), which resides on the short arm of chromosome 2, at 2p23, have been identified in various cancer types, including anaplastic large-cell lymphoma,1 non-small-cell lung carcinoma (NSCLC),2 and inflammatory myofibroblastic tumors.3 In these neoplasms, chromosomal translocations (or inversions for that matter) result in the (generally up-regulated) expression of an oncogenic ALK fusion protein mediating aberrant signal transduction, leading to uncontrolled cell growth. ALK, a receptor tyrosine kinase belonging to the insulin receptor superfamily, is believed to play a normal physiological role in murine brain development; in adult humans, the endogenous wild-type ALK expression is low and generally confined to the central nervous system.4 As a result of the ALK-targeting Copyright ª 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jmoldx.2012.08.006

tumorigenic chromosomal anomalies, a chimeric ALK protein containing the ALK tyrosine kinase domain fused to the N-terminal region of its fusion partner becomes expressed. Through ligand-independent activation, ALK fusion proteins constitutively transmit signals via phosphatidylinositol 3kinase/Akt and RAS/RAF/extracellular signaleregulated kinase signaling pathways, leading to enhanced cell survival and proliferation.2,5 These ALK-driven tumors rely specifically on the fusion oncoprotein for continued growth, Supported in part by a grant from Korean Health Technology R&D Project, Ministry of Health and Welfare, Republic of Korea (A110057). M.E.L. and T.M.K. contributed equally to this work. Disclosures: M.E.L., D.H., S.D., E.F.P.M.S., and M.M. are employed by and own stock in Pfizer, Inc. D.-W.K. received consulting fees and honoraria from Pfizer, Inc.

Lira et al and define a distinct patient subgroup that greatly benefits from targeted ALK inhibition. ALK fusions to echinoderm microtubule-like protein 4 (EML4) are found in approximately 2% to 5% of nonpreselected NSCLC cases,6,7 and were first identified in a lung adenocarcinoma from a Japanese patient harboring a paracentric chromosomal inversion of the short arm of chromosome 2.2 This inversion fused the 50 end of EML4 (exons 1 to 13) to the 30 end (beginning at exon 20) of ALK. The resulting fusion (designated variant 1) contained N-terminal portions of EML4 fused to the entire ALK cytoplasmic tyrosine kinase domain. Since then, several alternative oncogenic fusions have been identified, all containing variable truncations in EML4, invariably fused to ALK exon 20. In addition, ALK fusions involving KIF5B (residing at chromosome 10p11) and TFG (residing at chromosome 3q21) have also been reported in NSCLCs but are found at much lower frequencies.8e10 Crizotinib (PF-02341066), a dual MET/ALK-specific kinase inhibitor, has previously shown its ability to induce apoptosis in ALK fusion-positive cancer cell line xenografts11 and, after an impressive clinical efficacy in ALK-positive patients, has recently been approved by the Food and Drug Administration for the treatment of locally advanced or metastatic ALK-positive NSCLCs.12 Phase 3 clinical trials are under way in which clinical outcomes of crizotinib-treated patients are compared with those receiving standard first- and second-line therapies in advanced ALK-rearranged NSCLCs. Several clinically validated methods are available for the detection of ALK fusions, including fluorescence in situ hybridization (FISH), immunohistochemistry (IHC), and RTPCR. Crizotinib-centered clinical trials use an FISH-based test that was recently approved by the Food and Drug Administration as the standard companion diagnostic test for crizotinib. This assay (the Vysis ALK Break Apart FISH Probe Kit; Abbott Molecular, Downers Grove, IL) uses neighboring, differentially labeled break-apart probes, which specifically detect the 50 and 30 ends of the ALK gene, respectively.13 Normally, the corresponding red and green fluorescent signals are in close proximity, whereas any ALK rearrangement spatially separates the probes and, thereby, their signals, resulting in distinct and isolated red and green spots. At least 15% of all analyzed cells must be positive to score a break-apart signal.12,14,15 The FISH assay has undergone extensive validation in the clinical setting and is the gold standard for detection of ALK rearrangement. A disadvantage of this diagnostic assay lies in the fact that the signal can be subtle and, consequently, hard to interpret, requiring specialized technical expertise. It is also considerably more expensive compared with IHC and RT-PCR.16 IHC, on the other hand, detects expression of ALK protein. Because ALK expression is normally absent in the lung, the presence of ALK protein is indicative of a possible ALK rearrangement. Although IHC is relatively inexpensive, readily available in pathology laboratories, and suitable as a screening tool, it requires highly sensitive and specific ALK

Sections (4 mm thick) were deparaffinized, dehydrated, immersed in 0.2 N HCl, and incubated in 1 mol/L NaSCN for

52

jmd.amjpathol.org

antibodies and the involvement of trained pathologists to interpret the staining results. ALK expression levels in NSCLCs are, for instance, much lower than in anaplastic large-cell lymphomas; consequently, antibodies used in the latter tumor type are not sensitive enough for routine use in NSCLCs.15 Methods are evolving to generate more sensitive and specific antibodies for IHC detection in NSCLCs.10,15,17 Both methods previously described indicate either the presence or absence of ALK fusion, regardless of the fusion partner. RT-PCR is a technique offering a unique advantage of variant detection with the possibility for precise EML4ALK variant identification when combined with subsequent DNA sequencing. This approach relies on generating a PCR product using an array of primer pair combinations specifically designed to detect all known EML4-ALK variants.18,19 Obviously, multiple primer sets and PCRs are necessary to reliably detect all possible fusion isoforms, and the availability of good-quality RNA is essential for optimal results. RNA from formalin-fixed, paraffin-embedded (FFPE) tissues poses additional technical challenges in some cases, precluding FFPE samples from analysis. The identification of patients with ALK fusion NSCLCs who are most likely to benefit from ALK inhibition is crucial to the clinical success of ALK inhibitors. In the early-phase trial of crizotinib, during which the drug achieved a 57% response rate, approximately 1500 patients were screened by FISH to identify 82 ALK-positive patients.12 The many patients qualifying for screening underlie the need for a high-throughput and cost-effective screening modality. An optimal assay should be sensitive and specific but should also be economical, easy to perform, preferably automated, and readily adaptable to the workflow of clinical service laboratories. In this study, we explored a novel and alternative method for detecting ALK fusions by direct, multiplexed transcript profiling using NanoString’s gene expression platform.

Materials and Methods Archival Tissue Samples NSCLC samples (34 ALK-positive and 33 ALK-negative samples) were obtained from Seoul National University Hospital (SNUH) and Samsung Medical Center (SMC) (both in Seoul, South Korea) with prior full informed consent of the patients and with approval from the SNUH and SMC ethical committee/internal review board. Samples were selected based on ALK fusion status, as determined by FISH and/or IHC. Tumor cell content was assessed based on H&E-stained slides. Control NSCLC cell lines, NCI-H3122, NCI-H2228, and A549, were obtained from ATCC (Manassas, VA), xenografted, and preserved as FFPE tissue blocks.

FISH

-

The Journal of Molecular Diagnostics

ALK Fusion Detection in Lung Cancer 30 minutes at 80 C. Sections were then immersed in pepsin solution for 40 minutes. Dual-probe hybridization for ALK was performed according to the instructions of the supplier, using the LSI ALK break-apart probe set (Vysis, Downers Grove, IL). The probe mixture was applied to the slides, which were then incubated in a humidified atmosphere with Hybrite (Vysis) at 77 C for 5 minutes to simultaneously denature the probe and target DNA and subsequently at 37 C for 16 hours for hybridization. The slides were then immersed in 0.3% NP-40/0.4 times standard saline citrate for 5 minutes at room temperature, followed by 0.3% NP-40/0.4 times standard saline citrate for 5 minutes at 72 C. The nuclei were counterstained with DAPI. ALK FISH was considered positive when >15% of at least 50 tumor cells analyzed showed splitting apart of the fluorescent probes flanking the ALK locus. The FISH results were scored unbiased (ie, without prior knowledge of pre-existing IHC results).

IHC Staining ALK IHC was performed using the Bond-max automated immunostainer (Leica Microsystems, Milton Keynes, UK). Paraffin sections (3 mm thick) were evaluated for IHC staining according to standard protocols. Each paraffin section was dewaxed, followed by heat-induced epitope retrieval: heating for 20 minutes at 100 C in Epitope Retrieval Solution pH 9.0 (Leica Microsystems). Subsequent antibody-specific steps were performed according to the

manufacturer’s instructions. Slides were incubated with mouse monoclonal antibody for ALK (clone 5A4; Novocastra, Newcastle upon Tyne, UK) at 1:50 dilution. Antibody binding was detected by a standard detection kit (BondPolymer Refine Detection kit; Leica Microsystems). Mayer’s hematoxylin was used as the counterstain. Various normal and cancer TMA blocks were included as negative and positive controls. For ALK, IHC was interpreted as follows: negative, no staining; equivocal, faint cytoplasmic staining without any background staining; and positive, moderate to strong cytoplasmic staining in >10% of tumor cells.

RNA Extraction Total RNA was isolated from one to three FFPE tissue sections (10 mm thick) using Agencourt FormaPure-Nucleic Acid Extraction from FFPE Tissue kit (Beckman-Coulter, Indianapolis, IN). The manufacturer’s protocol for RNA extraction was followed with an additional DNase treatment step. RNA concentration was assessed using the Nanodrop 8000 (Thermo-Scientific, Wilmington, DE).

ALK Fusion Transcript Assay nCounter assays were performed in duplicate, according to the manufacturer’s protocol (NanoString, Seattle, WA). Briefly, 500 ng of total RNA was hybridized to nCounter probe sets for 16 hours at 65 C. Samples were processed

Figure 1 Detection of ALK fusion transcripts and quantification of ALK 50 and 30 expression levels using nCounter assay. A: Schematic representation of ALK fusion probe sets and sequences recognized. B: ALK fusion variants are identified by a common ALK exon 20 reporter probe and frequencies (Freq) in NSCLCs. C: Schematic representation of ALK 50 and 30 expression assay and location of probe sets relative to ALK fusion junction. Ex, exon.

The Journal of Molecular Diagnostics

-

jmd.amjpathol.org

53

Lira et al using an automated nCounter Sample Prep Station (NanoString Technologies, Inc., Seattle, WA). Cartridges containing immobilized and aligned reporter complex were subsequently imaged on an nCounter Digital Analyzer (NanoString Technologies, Inc.) set at 1155 fields of view. Reporter counts were collected using NanoString’s nSolver analysis software version 1, normalized, and analyzed as described later.

Statistical Analysis Data were normalized in two steps. First, six positive internal controls were used to remove potential systematic differences between individual hybridization experiments. Table 1

Probe Sets for NanoString nCounter Analysis of ALK Expression and ALK Fusion Variants Probe

Gene symbol ALK

Accession no. location NG_009445.1

ALK exon 1

Reporter probe

ALK_5 -1 50 -CTACTCGCGCCTGCAGAGGAAGAGTCTGGCAGTTGACTTCGTGGTGCCCT0

ALK_5 -2

NG_009445.1

ALK exon 5

ALK

NG_009445.1

ALK

NG_009445.1

ALK_50 -3 ALK exons 8-9 ALK exon 18 ALK_50 -4

ALK

NG_009445.1

ALK

NG_009445.1

ALK

NG_009445.1

ALK_30 -1 ALK exons 22-23 ALK_30 -2 ALK exons 26-27 ALK exon 29 ALK_30 -3

ALK

NG_009445.1

ALK 30 UTR

ALK_30 -4

EML4-ALK V1

AB_274722

E13;A20

EML4-ALK V2

AB_275889

E20;A20

EML4-ALK V3a AB_374361

E6a;A20

EML4-ALK V5a AB_374364

E2;A20

EML4-ALK V50

NA

E18;A20

KIF5B-ALK

AB_462413

K24;A20

TFG-ALKS

AF125093.1

T3;A20

GAPDH

NM_002046.3 GAPDH

ALK exon 20 ALK exon 20 ALK exon 20 ALK exon 20 ALK exon 20 ALK exon 20 ALK exon 20 GAPDH

GUSB

NM_000181.1 GUSB

GUSB

exons 1-2

POLR2A

exons 4-5 NM_004152.2 OAZ1 exons 2-3 NM_000937.2 POLR2A exon 20-21

Target sequence

0

ALK

OAZ1

Specifically, the sum of the intensity (Si) from the six positive control probes was calculated for sample (ie, replicate) i, individual probe intensity for sample i was then scaled by the normalization factor S/Si, where S Z mean of Si. Second, the scaled intensity of sample i (obtained from step 1) was further normalized using housekeeping genes to remove any effect that might be attributed to, for instance, differences in the amount of input RNA. If Hi is the geometric mean of the intensity from the four housekeeping genes for sample i, the second step normalization factor was then defined as H/Hi. Background was determined from the eight excision repair cross-complementingenegative control probes. The mean and SD were calculated from the negative controls,

OAZ1 POLR2A

CGCTCTTCCGTGTCTACGCCCGGGACCTACTGCTGCCACCATCCTCCTCG-30 5 -ACAGTGCTCCAGGGAAGAATCGGGCGTCCAGACAACCCATTTCGAGTGGCCCTGGAATACATCTCCAGTGGAAACCGCAGCTTGTCTGCAGTGGACTTCT-30 50 -CCCGCTTCTGAAAGTGCTACAGTGACCAGTGCTACGTTTCCTGCACCGATCAAGAGCTCTCCATGTGAGCTCCGAATGTCCTGGCTCATTCGTGGAGTCT-30 0 5 -TAAAAGTGATGGAAGGCCACGGGGAAGTGAATATTAAGCATTATCTAAACTGCAGTCACTGTGAGGTAGACGAATGTCACATGGACCCTGAAAGCCACAA-30 50 -AGACGCTGCCTGAAGTGTGCTCTGAACAGGACGAACTGGATTTCCTCATGGAAGCCCTGATCATCAGCAAATTCAACCACCAGAACATTGTTCGCTGCAT-30 0 5 -CAGAGGCCTTCATGGAAGGAATATTCACTTCTAAAACAGACACATGGTCCTTTGGAGTGCTGCTATGGGAAATCTTTTCTCTTGGATATATGCCATACCC-30 0 5 -TTGTGGAACCCAACGTACGGCTCCTGGTTTACAGAGAAACCCACCAAAAAGAATAATCCTATAGCAAAGAAGGAGCCACACGACAGGGGTAACCTGGGGC-30 0 5 -GTCGCACACTCACTTCTCTTCCTTGGGATCCCTAAGACCGTGGAGGAGAGAGAGGCAATGGCTCCTTCACAAACCAGAGACCAAATGTCACGTTTTGTTT-30 0 5 -ATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 50 -GACAACAAGTATATAATGTCTAACTCGGGAGACTATGAAATATTGTACTTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 0 5 -AAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 50 -ATCTCTGAAGATCATGTGGCCTCAGTGAAAAAATCAGTCTCAAGTAAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 0 5 -ATCCACACAGACGGGAATGAACAGCTCTCTGTGATGCGCTACTCAATAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 50 -GCAGTCAGGTCAAAGAATATGGCCAGAAGAGGGCATTCTGCACAGATTGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 0 5 -CTTGGAACCACCTGGAGAACCAGGACCTTCCACCAATATTCCTGAAAATGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAG-30 50 -TCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTT-30 0 5 -CGGTCGTGATGTGGTCTGTGGCCAACGAGCCTGCGTCCCACCTAGAATCTGCTGGCTACTACTTGAAGATGGTGATCGCTCACACCAAATCCTTGGACCC-30 50 -GGTGGGCGAGGGAATAGTCAGAGGGATCACAATCTTTCAGCTAACTTATTCTACTCCGATGATCGGCTGAATGTAACAGAGGAACTAACGTCCAACGACA-30 0 5 -TTCCAAGAAGCCAAAGACTCCTTCGCTTACTGTCTTCCTGTTGGGCCAGTCCGCTCGAGATGCTGAGAGAGCCAAGGATATTCTGTGCCGTCTGGAGCAT-30 0

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GUSB glucuronidase, beta; NA, not available; OAZ1, ornithine decarboxylase antizyme 1; POLR2A, polymerase (RNA) II (DNA directed) polypeptide A; UTR, 50 -untranslated region.

54

jmd.amjpathol.org

-

The Journal of Molecular Diagnostics

ALK Fusion Detection in Lung Cancer and a threshold (B) was defined as the mean plus 2 SDs. A target with a normalized intensity value higher than this threshold was scored as present. The normalized intensity from sample replicates was averaged to obtain an averaged patient intensity for each probe and patient.

To summarize ALK 30 overexpression, we defined an ALK 30 overexpression score (ie, ALK30 /50 ratio) for each patient as follows: Alk30 /50 Z E3/max(A5, B), where E3 is the geometric mean of ALK 30 probe expression, A5 is the average of the ALK 50 probe expression, and B is the

Figure 2 Representative expression profiles of selected samples using an ALK fusion transcript assay. AeC: ALK-positive samples, as determined by FISH and IHC. D: Sample negative for ALK rearrangement by FISH but positive for ALK expression by IHC. EeG: Corresponding sequence chromatograms of samples are represented in A, B, and C, showing EML4-ALK V1, V2, and V3a, respectively. H: Sequence chromatogram of sample depicted in D showing an uninterrupted ALK sequence at the canonical junction site.

The Journal of Molecular Diagnostics

-

jmd.amjpathol.org

55

Lira et al background threshold previously defined. ALK 30 probes usually have a higher intensity and tend to follow a log normal distribution, whereas 50 probes have a lower intensity and are more normally distributed. Thus, we used the geometric mean for ALK 30 probes and the arithmetic mean for ALK 50 probes. Using background threshold B to floor the denominator prevents an extremely small ALK 50 expression value that could artificially inflate the score. For the fusion probe, we defined a fusion present call in a similar manner. The fusion probe for a tumor was called present if its normalized intensity was 2 SDs higher than the median, or B, whichever was larger. Herein, the median and SD were calculated from all fusion-negative samples. The SD was calculated from the median absolute deviation (MAD) from the median, which is a more robust measure of variability. Therefore, fusion present if intensity > max (B, median þ 2*SMAD), where SMAD Z 1.4826*MAD, is the standard deviation of normal distribution calculated using MAD. The percentage concordance was calculated between two platforms, and its CI was computed using Wilson’s score method. Cohen’s k statistic was also calculated for concordance analysis. Data were analyzed using standard R software, version 2.13.1 (http://www.r-project.org, last accessed September

20, 2011). Concordance analysis was conducted in SAS 9.2 (SAS Institute, Cary, NC).

RT-PCR and DNA Sequencing The precise ALK fusion variant type from SNUH ALKpositive samples was determined by RT-PCR using an RNA UltraSense One-Step RT-PCR kit (Invitrogen, Carlsbad, CA), according to primers and conditions previously described by Sanders and coworkers.18 Wild-type ALK transcripts were detected by RT-PCR using ALK exon 18 forward primer (50 -TCGCTGATCCTCTCTGTGG-30 ) and ALK exon 20 reverse primer (50 -CTTGCTCAGCTTGTACTCAGG-30 ). The resulting PCR products were separated on a 2% size-select agarose E-gel (Invitrogen) and sequenced using a 3700 ABI Prism sequencer (Life Technologies, Foster City, CA).

Results ALK Fusion Transcript Assay Design By using NanoString’s border probe approach,20e22 we designed two sequence-specific probe cocktails consisting of

Performance of ALK fusion transcript assay on experimental set and control cancer cell lines. A: ALK 30 overexpression, as measured by ALK 30 /50 score; a background threshold of twofold is denoted by a thick horizontal line. B: ALK exon 20 reporter counts; a background threshold of 60 reporter counts is denoted by a thick horizontal line. C: Concordance with FISH and IHC data, EML4-ALK variant type as determined by RT-PCR/DNA sequencing. Tumor percentage is determined by H&E staining. n/a, not applicable; NC, negative control; nd, not determined; PC, positive control.

Figure 3

56

jmd.amjpathol.org

-

The Journal of Molecular Diagnostics

ALK Fusion Detection in Lung Cancer a mixture of 50 capture and 30 reporter probes, all containing sequences complementary to a contiguous target sequence (Figure 1A). Capture probes consisted of target-specific, approximately 50-mer oligonucleotides and were biotinylated to enable downstream capture of the mRNA-probe complex. Reporter probes also consisted of target-specific 50-mer oligonucleotides coupled to a unique, color-coded tag used for signal detection. The reporter tag consisted of four spectrally distinct fluorophores attached to seven segments along the reporter backbone. The order of the fluorescently labeled color tags dictated the formation of a unique molecular bar code for each reporter. Multiplex hybridization of probe sets to mRNA resulted in the formation of a tripartite complex of capture probe/RNA target/reporter probe. On removal of excess probes, the hybridization complexes were immobilized to a streptavidin-coated surface, where application of an electrical current aligned them in the same orientation. Reporter tags were digitally imaged and counted, where the number of specific reporter tags counted corresponded to the number of transcripts present. For our ALK fusion transcript assay, we designed a single-tube, multiplexed assay to simultaneously detect EML4-ALK fusion transcripts and measure specific ALK expression patterns for several ALK exons flanking the fusion break point. For fusion detection, EML4-specific 50 capture probes and ALK-specific 30 reporter probes were designed to hybridize to approximately 50 nucleotides of

EML4 and ALK flanking the fusion junction, respectively (Table 1). EML4-ALK fusion isoforms were characterized by variable truncations in EML4, universally fused to the ALK kinase domain usually beginning at exon 20 (Table 1). Most EML4-ALK fusion variants shared the same downstream ALK exon 20 junction; thus, assignment of a unique reporter tag for each isoform was not possible because of use of the same molecular barcode to the downstream reporter probe. Thus, a common reporter probe designated as ALK exon 20, paired with the appropriate variant capture probe, would detect a preselected, expandable set of fusion transcripts containing ALK exon 20 sequences (Figure 1B). Capture probe sequences were designed to detect all major isoforms of EML4-ALK fusions (namely, variants 1, 2, and 3 with combined frequencies close to 70%).2,8,23 In addition, capture probes for EML4-ALK variants 5a and 50 19,24 and alternative (ie, non-EML4) fusion partners, such as KIF5B and TFG,10,25 were included. For ALK gene expression, we designed probe sets across the entire ALK transcript, four probe sets designated as ALK 50 -1 to 50 -4, corresponding to ALK exons proximal to the intron 19 fusion break point and ALK 30 -1 to 30 -4, corresponding to ALK exons distal to the fusion break point (Figure 1C and Table 1). We hypothesized that because ALK is not normally expressed in adult tissues, high reporter counts arising from probe sets located 30 , but not 50 , of the ALK fusion junction were indicative of an ALK fusion.

Figure 4

Performance of ALK fusion assay on SNUH validation set and control cancer cell lines. A: ALK 30 overexpression as measured by ALK 30 /50 score; a background threshold of twofold is denoted by a thick horizontal line. B: ALK exon 20 reporter counts; a background threshold of 60 reporter counts is denoted by a thick horizontal line. C: ALK fusion calls using analysis criteria formulated on experimental set, EML4-ALK variant type as determined by RT-PCR/DNA sequencing. Tumor percentage as determined by H&E staining. Samples SN41 and SN43 are from the same patient but from different FFPE tissue blocks. AM, adrenal metastasis; BM, bone metastasis; BrM, brain metastasis; CL, cell line; C/R, crizotinib-acquired resistance; N, treatment naïve; n/a, not applicable; nd, not determined; P, primary NSCLC; PC, positive control; PE, pleural effusion.

The Journal of Molecular Diagnostics

-

jmd.amjpathol.org

57

Lira et al

Experimental Set We initially assessed the performance of our assay to detect the presence or absence of ALK fusions in an experimental set composed of eight ALK-positive and 19 ALK-negative NSCLC tumor samples independently tested by both FISH and IHC methods. As independent controls, we used ALK-positive cancer cell lines NCIH3122 (containing EML4-ALK variant 1) and NCI-H2228 (containing EML4-ALK variants 3a/b) and an ALKnegative cancer cell line, A549.26 RNA from FFPE tissues was directly hybridized in a single-tube assay format of multiplexed capture and reporter probe sets. Figure 2 depicts representative expression profiles of selected samples showing normalized reporter counts obtained for ALK exon 20 and ALK 50 and 30 reporter probes. Three samples (SN11, SN46, and SN36) that were previously scored positive for ALK fusion by FISH and IHC displayed the expected expression profiles indicative for ALK fusion, being high reporter counts for ALK exon 20 and high reporter counts for the ALK probe sets located 30 , but not 50 , of the fusion junction (Figure 2, AeC). DNA sequencing of RT-PCR products from samples SN11, SN46, and SN36 confirmed the presence of ALK fusion variants 1, 2, and 3, respectively (Figure 2, EeG). Interestingly, sample SN31, which was part of our validation set, and which was previously reported as negative for ALK

fusion by FISH, yet equivocal for ALK protein expression by IHC, exhibited an expression profile consistent with both prior methods. Low reporter counts for ALK exon 20 and high reporter counts for probes throughout the ALK transcript were observed, indicating the absence of ALK fusion but the aberrant activation of ALK expression in sample SN31 (Figure 2D). RT-PCR using primers specific for ALK exon 18 and ALK exon 20 readily yielded a PCR product, the sequence of which corresponded to wild-type ALK, a transcript not normally expressed in adult tissues (Figure 2H).

Threshold Setting Figure 3 provides a summary of results obtained with the ALK fusion transcript assay on the experimental set, along with control cancer cell lines. To summarize ALK 30 overexpression, we developed a standard scoring method by which we calculated the ratio of the 30 /50 probes to generate an ALK 30 /50 score (see Materials and Methods). By using this method, we found a clearly distinct scoring intervaldifference between FISH-positive (smallest score, 4.85) and FISH-negative (largest score, 0.787) samples. We arbitrarily set a ratio of 2, which was close to the middle point in fold difference between the smallest score in FISH-positive samples and the largest score in FISHnegative samples, as the cutoff to separate predicted ALK

Figure 5 Performance of ALK fusion assay on SMC validation set and control cancer cell lines. A: ALK 30 overexpression, as measured by ALK 30 /50 score; a background threshold of twofold is denoted by a thick horizontal line. B: ALK exon 20 reporter counts; a background threshold of 60 reporter counts is denoted by a thick horizontal line. C: Predicted call based on NanoString result and FISH/IHC data; tumor percentage as determined by H&E staining. CR, complete response; N, treatment naïve; n/a, not applicable; NC, negative control; nd, not determined; PC, positive control; PD, progressive disease; PR, partial response.

58

jmd.amjpathol.org

-

The Journal of Molecular Diagnostics

ALK Fusion Detection in Lung Cancer fusion-positive and fusion-negative calls, and to facilitate automatic result calling. As expected, positive control cancer cell lines, NCI-H3122 and NCI-H2228, exhibited a >10-fold ALK 30 /50 ratio (Figure 3A). All eight ALK-positive samples also displayed an ALK 30 /50 ratio higher than the cutoff. In contrast, ALK-negative samples, including the A549 cancer cell line, exhibited an ALK 30 /50 ratio lower than the cutoff. Likewise for fusion detection, we looked at the reporter counts obtained for the ALK exon 20 reporter. A reporter count of 60 was designated as the background threshold level (see Materials and Methods). Consistent with ALK 30 overexpression, all ALK-positive and ALK-negative samples registered reporter counts higher or lower than the fusion reporter threshold, respectively (Figure 3B). DNA sequencing of RT-PCR products confirmed the presence of ALK fusion (namely, EML4-ALK variant 1) in six of the eight positive samples (Figure 3C). There was insufficient material for the remaining two positive samples for RT-PCR analysis. Although ALK 30 overexpression and ALK fusionspecific assays were complementary to each other, they were two independent assays performed in a multiplexed, single-tube format. The samples scoring positive by either method were considered as ALK fusion positive in our assay.

Validation Sets We next sought to validate our assay and analysis criteria on two independent cohorts obtained from SNUH and SMC. Samples from SNUH consisted of six independent ALK-positive samples from lung cancer metastasis (bone, adrenal gland and brain metastatic tumors, and pleural effusion) and 13 ALK-negative samples from primary lung tumors, as determined by FISH and/or IHC assays. All ALK fusion-positive samples were obtained from patients who were treated with crizotinib but later developed acquired resistance. Of the six ALK-positive samples, two specimens were obtained before treatment and four specimens were obtained after relapse. The assay was performed in a blinded manner; data analysis was performed using the scoring method formulated on the experimental set. Both ALK 30 overexpression and ALK exon 20 reporter counts yielded results concordant with FISH and/or IHC results (Figure 4). Large differences in levels of ALK expression were noted between individual samples. One ALK-positive tumor (SN42), in particular, exhibited an ALK 30 /50 ratio of 1.69, which was slightly lower than the threshold (ratio Z 2);

however, the count for the ALK exon 20 reporter was higher than the fusion assay threshold (60 counts) and, thus, is considered ALK positive in our assay. In addition, SN42 had the lowest tumor cell content among the positive samples. All of the four crizotinib-acquired resistant tumors were ALK fusion positive, which indicated that the refractory tumors were still harboring ALK fusion. The second validation set consisted of 20 NSCLC samples from SMC. This set was enriched for ALK-positive samples composed of 19 ALK-positive and 1 ALK-negative sample, as determined by FISH analysis. Eleven of the samples were also independently analyzed by IHC at SMC. Of the 19 ALK-positive samples (by FISH), 17 participated in a crizotinib trial. Fifteen patients showed a partial/complete response to crizotinib, whereas two patients showed no response. In our assay, 17 of the 19 ALK-positive (FISH) samples were predicted to be ALK positive (Figure 5). There were two samples with discordant FISH and NanoString results. Patient SMC5 was ALK positive by FISH but was negative in both our assay and IHC. SMC9, which was also ALK positive by FISH, was negative in our assay (no IHC data available); this patient harbored an EGFR L858R mutation. Both patients showed no response to crizotinib. There was one sample with discordant IHC and NanoString results. SMC2, which exhibited a partial response to crizotinib, was positive for ALK by both FISH and our assay, but was deemed negative by IHC. Interestingly, SMC19, which was ALK positive in all three platforms and responded favorably to crizotinib, exhibited a high ALK 30 /50 ALK score but low fusion-specific reporter counts. This tumor likely contained a rare ALK variant not covered by our fusion-specific probe sets.

Assay Performance Based on 66 samples analyzed, we evaluated the performance of our assay for sensitivity, specificity, reproducibility, and concordance to prior FISH and IHC results. Unlike anaplastic large-cell lymphoma, ALK fusions in NSCLCs were expressed at low levels. In this study, we included all archival samples without regard to tumor content, which ranged from 10% to 100%. We successfully detected low-level ALK fusion transcripts in samples with a tumor content as low as 10%. In contrast, the background level was low in ALK-negative samples, even in samples with a tumor cell content as high as 90% to 100%, indicating a high level of assay specificity. A low level of variability

Table 2

Concordance of NanoString to FISH and IHC

Variable

NanoString versus FISH

NanoString versus IHC

NanoString versus FISH and IHC

FISH versus IHC

No. of concordant samples No. of discordant samples % Concordance (95% CI) Cohen’s k

27 2 93.1 (78.0e98.1) 0.76

28 2 93.3 (78.7e98.2) 0.87

17 0 100 (81.6e100) 1.00

17 3 85 (64.0e94.8) 0.57

The Journal of Molecular Diagnostics

-

jmd.amjpathol.org

59

Lira et al was also observed in replicate samples. We observed interpatient variability in reporter counts between samples, which might be attributable to tumor heterogeneity. For overall concordance analysis, we calculated the percentage concordance and Cohen’s k statistic of our assay to FISH or IHC, and a combination of FISH and IHC from the two validation sets (n Z 39). We also looked at the concordance between FISH and IHC platforms. Table 2 summarizes the concordance of our assay for each platform, yielding a concordance of approximately 93% (95% CI, approximately 78% to 98%) to either FISH (n Z 27 of 29) or IHC (n Z 28 of 30) results, with a k statistic >0.75. The overall concordance between FISH and IHC results was 85% (17 of 20; 95% CI, 64% to 95%) and had a k value of 0.57. In samples that were concordant in both FISH and IHC, our assay was also 100% concordant with FISH and IHC.

Discussion In this study, we describe a novel method for the detection of ALK fusion transcripts using NanoString’s gene expression technology. Our method relies on direct, digital detection of ALK fusion transcripts and ALK 30 overexpression. In principle, the assay incorporates advantages of both FISH and IHC methods for fusion detection and ALK expression via transcript profiling. NanoString technology is notable for its high sensitivity, reproducibility, and wide dynamic range.20,21 Its ability to detect low-abundance mRNA species is an added benefit because ALK fusions are expressed at low levels in NSCLCs, a characteristic requiring the use of highly sensitive and specific antibodies for IHC detection. It is also amenable to degraded RNA from FFPE tissue samples and does not require cDNA synthesis or PCR amplification that can introduce potential amplification bias. Probe sets are multiplexed in a single reaction, thereby obviating the need for multiple PCRs, as is the case when using an RT-PCRebased method. After solution-based hybridization, subsequent steps are semi-automated and standardized, and can be performed in a relatively high-throughput manner. The combined fusion detection and ALK 30 overexpression strategy afforded increased confidence in ALK fusion detection. Because of the unique ALK exon 20 break point sequence shared among several variants, the ALK exon 20 reporter probe allowed detection of the common ALK fusions (ie, EML4-ALK variants 1, 2, and 3a) with combined frequencies among ALK-positive NSCLC cases of close to 70%. Although the assay cannot discriminate the precise EML4-ALK variant type, present/absent calls for ALK fusion are sufficient for diagnostic screening purposes. Recently, NanoString released a leukemia fusion gene expression panel incorporating a unique junction probe design allowing for variant discrimination in fusions sharing the

60

same downstream exons. The ALK fusion transcript assay could be further expanded to enable variant discrimination and incorporate the rarer variants comprising the remaining 30% not covered by the ALK exon 20 probe. Reporter counts obtained from the ALK 30 overexpression portion of the assay can compensate for known or yet to be identified variants not covered by the fusion detection part of the assay. The technology could also be expanded to include ALK variants in NSCLCs and alternative ALK fusions, as described for other cancer types (in particular, anaplastic large-cell lymphoma). Interestingly, the assay also enabled the detection of aberrantly expressed wild-type ALK in one of the patients; however, the clinical benefit of ALK inhibitors in wild-type ALK-expressing tumors needs to be further investigated. Although further validation on a larger sample size is required for this assay to be considered in clinical practice, we have demonstrated the feasibility of NanoString-based transcript profiling as an alternate method for detection of ALK fusions in NSCLCs. In two independent validation sets (n Z 39), our assay showed high concordance to FISH and IHC. All samples predicted to be positive in our assay responded favorably to crizotinib. There were two discordant cases observed in which patients were categorized as ALK positive by FISH but were negative by our assay. The same patients showed no clinical response to crizotinib, suggesting FISH false-positive results. Considering the subjective nature and inherent interobserver variability in FISH and IHC assessment (67%), this may be a plausible explanation for the discordance.27 In summary, we have developed an alternative method for screening ALK fusions in NSCLC using direct, digital transcript profiling with NanoString’s nCounter technology. This would be advantageous in laboratories already equipped with a NanoString instrument, in which, in addition to standard gene expression and DNA copy number analyses, ALK fusion detection can be incorporated as an added application. The assay is highly sensitive, quantitative, reproducible, easy to perform, automatable, and costeffective. We believe that the ALK fusion transcript assay may be a more practical method for screening patients with NSCLC and should be considered as a prescreening option before FISH in the identification of rare ALK fusion tumors for ALK-targeted therapies.

Acknowledgments We thank Lars Engstrom for providing control cancer cell lines and Helen Zou and James Christensen for scientific advice.

References 1. Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, Saltman DL, Look AT: Fusion of a kinase gene, ALK, to a nucleolar

jmd.amjpathol.org

-

The Journal of Molecular Diagnostics

ALK Fusion Detection in Lung Cancer

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

protein gene NPM, in non-Hodgkin’s lymphoma. Science 1994, 263: 1281e1284 Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, Bando M, Ohno S, Ishikawa Y, Aburatani H, Niki T, Sohara Y, Sugiyama Y, Mano H: Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007, 448:561e566 Griffin CA, Hawkins AL, Dvorak C, Henkle C, Ellingham T, Perlman EJ: Recurrent involvement of 2p23 in inflammatory myofibroblastic tumors. Cancer Res 1999, 59:2776e2780 Mosse YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, Laquaglia MJ, Sennett R, Lynch JE, Perri P, Laureys G, Speleman F, Kim C, Hou C, Hakonarson H, Torkamani A, Schork NJ, Brodeur GM, Tonini GP, Rappaport E, Devoto M, Maris JM: Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 2008, 455:930e935 Takezawa K, Okamoto I, Nishio K, Janne PA, Nakagawa K: Role of ERK-BIM and STAT3-survivin signaling pathways in ALK inhibitorinduced apoptosis in EML4-ALK-positive lung cancer. Clin Cancer Res 2011, 17:2140e2148 Perner S, Wagner PL, Demichelis F, Mehra R, Lafargue CJ, Moss BJ, Arbogast S, Soltermann A, Weder W, Giordano TJ, Beer DG, Rickman DS, Chinnaiyan AM, Moch H, Rubin MA: EML4-ALK fusion lung cancer: a rare acquired event. Neoplasia 2008, 10: 298e302 Solomon B, Varella-Garcia M, Camidge DR: ALK gene rearrangements: a new therapeutic target in a molecularly defined subset of nonsmall cell lung cancer. J Thorac Oncol 2009, 4:1450e1454 Rikova K, Guo A, Zeng Q, Possemato A, Yu J, Haack H, Nardone J, Lee K, Reeves C, Li Y, Hu Y, Tan Z, Stokes M, Sullivan L, Mitchell J, Wetzel R, Macneill J, Ren JM, Yuan J, Bakalarski CE, Villen J, Kornhauser JM, Smith B, Li D, Zhou X, Gygi SP, Gu TL, Polakiewicz RD, Rush J, Comb MJ: Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer. Cell 2007, 131: 1190e1203 Sasaki T, Rodig SJ, Chirieac LR, Janne PA: The biology and treatment of EML4-ALK non-small cell lung cancer. Eur J Cancer 2010, 46: 1773e1780 Takeuchi K, Choi YL, Togashi Y, Soda M, Hatano S, Inamura K, Takada S, Ueno T, Yamashita Y, Satoh Y, Okumura S, Nakagawa K, Ishikawa Y, Mano H: KIF5B-ALK, a novel fusion oncokinase identified by an immunohistochemistry-based diagnostic system for ALKpositive lung cancer. Clin Cancer Res 2009, 15:3143e3149 Christensen JG, Zou HY, Arango ME, Li Q, Lee JH, McDonnell SR, Yamazaki S, Alton GR, Mroczkowski B, Los G: Cytoreductive antitumor activity of PF-2341066, a novel inhibitor of anaplastic lymphoma kinase and c-Met, in experimental models of anaplastic large-cell lymphoma. Mol Cancer Ther 2007, 6:3314e3322 Kwak EL, Bang YJ, Camidge DR, Shaw AT, Solomon B, Maki RG, Ou SH, Dezube BJ, Janne PA, Costa DB, Varella-Garcia M, Kim WH, Lynch TJ, Fidias P, Stubbs H, Engelman JA, Sequist LV, Tan W, Gandhi L, Mino-Kenudson M, Wei GC, Shreeve SM, Ratain MJ, Settleman J, Christensen JG, Haber DA, Wilner K, Salgia R, Shapiro GI, Clark JW, Iafrate AJ: Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 2010, 363: 1693e1703 Shaw AT, Yeap BY, Mino-Kenudson M, Digumarthy SR, Costa DB, Heist RS, Solomon B, Stubbs H, Admane S, McDermott U, Settleman J, Kobayashi S, Mark EJ, Rodig SJ, Chirieac LR, Kwak EL, Lynch TJ, Iafrate AJ: Clinical features and outcome of patients with non-small-cell lung cancer who harbor EML4-ALK. J Clin Oncol 2009, 27:4247e4253 Camidge DR, Kono SA, Flacco A, Tan AC, Doebele RC, Zhou Q, Crino L, Franklin WA, Varella-Garcia M: Optimizing the detection of lung cancer patients harboring anaplastic lymphoma kinase (ALK)

The Journal of Molecular Diagnostics

-

jmd.amjpathol.org

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

gene rearrangements potentially suitable for ALK inhibitor treatment. Clin Cancer Res 2010, 16:5581e5590 Mino-Kenudson M, Chirieac LR, Law K, Hornick JL, Lindeman N, Mark EJ, Cohen DW, Johnson BE, Janne PA, Iafrate AJ, Rodig SJ: A novel, highly sensitive antibody allows for the routine detection of ALK-rearranged lung adenocarcinomas by standard immunohistochemistry. Clin Cancer Res 2010, 16:1561e1571 Atherly A, Camidge D: The cost-effectiveness of screening lung cancer patients for targeted drug sensitivity markers. Br J Cancer 2012, 106: 1100e1106 Rodig SJ, Mino-Kenudson M, Dacic S, Yeap BY, Shaw A, Barletta JA, Stubbs H, Law K, Lindeman N, Mark E, Janne PA, Lynch T, Johnson BE, Iafrate AJ, Chirieac LR: Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population. Clin Cancer Res 2009, 15:5216e5223 Sanders HR, Li HR, Bruey JM, Scheerle JA, Meloni-Ehrig AM, Kelly JC, Novick C, Albitar M: Exon scanning by reverse transcriptase-polymerase chain reaction for detection of known and novel EML4-ALK fusion variants in non-small cell lung cancer. Cancer Genet 2011, 204:45e52 Takeuchi K, Choi YL, Soda M, Inamura K, Togashi Y, Hatano S, Enomoto M, Takada S, Yamashita Y, Satoh Y, Okumura S, Nakagawa K, Ishikawa Y, Mano H: Multiplex reverse transcriptionPCR screening for EML4-ALK fusion transcripts. Clin Cancer Res 2008, 14:6618e6624 Geiss GK, Bumgarner RE, Birditt B, Dahl T, Dowidar N, Dunaway DL, Fell HP, Ferree S, George RD, Grogan T, James JJ, Maysuria M, Mitton JD, Oliveri P, Osborn JL, Peng T, Ratcliffe AL, Webster PJ, Davidson EH, Hood L, Dimitrov K: Direct multiplexed measurement of gene expression with color-coded probe pairs. Nature Biotechnol 2008, 26:317e325 Malkov VA, Serikawa KA, Balantac N, Watters J, Geiss G, MashadiHossein A, Fare T: Multiplexed measurements of gene signatures in different analytes using the Nanostring nCounter Assay System. BMC Res Notes 2009, 2:80 Reis PP, Waldron L, Goswami RS, Xu W, Xuan Y, Perez-Ordonez B, Gullane P, Irish J, Jurisica I, Kamel-Reid S: mRNA transcript quantification in archival samples using multiplexed, color-coded probes. BMC Biotechnol 2011, 11:46 Choi YL, Takeuchi K, Soda M, Inamura K, Togashi Y, Hatano S, Enomoto M, Hamada T, Haruta H, Watanabe H, Kurashina K, Hatanaka H, Ueno T, Takada S, Yamashita Y, Sugiyama Y, Ishikawa Y, Mano H: Identification of novel isoforms of the EML4ALK transforming gene in non-small cell lung cancer. Cancer Res 2008, 68:4971e4976 Wong DW, Leung EL, So KK, Tam IY, Sihoe AD, Cheng LC, Ho KK, Au JS, Chung LP, Pik Wong M: The EML4-ALK fusion gene is involved in various histologic types of lung cancers from nonsmokers with wild-type EGFR and KRAS. Cancer 2009, 115:1723e1733 Hernandez L, Pinyol M, Hernandez S, Bea S, Pulford K, Rosenwald A, Lamant L, Falini B, Ott G, Mason DY, Delsol G, Campo E: TRKfused gene (TFG) is a new partner of ALK in anaplastic large cell lymphoma producing two structurally different TFG-ALK translocations. Blood 1999, 94:3265e3268 Sakamoto H, Tsukaguchi T, Hiroshima S, Kodama T, Kobayashi T, Fukami TA, Oikawa N, Tsukuda T, Ishii N, Aoki Y: CH5424802, a selective ALK inhibitor capable of blocking the resistant gatekeeper mutant. Cancer Cell 2011, 19:679e690 Wallander M, Geiersbach K, Tripp S, Layfield L: Comparison of reverse transcription-polymerase chain reaction, immunohistochemistry, and fluorescence in situ hybridization methodologies for detection of echinoderm microtubule-associated proteinlike 4-anaplastic lymphoma kinase fusion-positive non-small cell lung carcinoma: implications for optimal clinical testing. Arch Pathol Lab Med 2012, 136:796e803

61