- Email: [email protected]
Multiplexed spectral coding for simultaneous detection of DNA hybridization reactions based on FRET
Sensors and Actuators B 134 (2008) 146–157
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Multiplexed spectral coding for simultaneous detection of DNA hybridization reactions based on FRET Let´ıcia Giestas a , Guilherme N.M. Ferreira b , Pedro V. Baptista c , Jo˜ao Carlos Lima a,∗ a
REQUIMTE, Departamento de Qu´ımica, Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal IBB-Institute for Biotechnology and Bioengeneering, Centro de Biomedicina Molecular e Estrutural, Universidade do Algarve, 8000 Faro, Portugal c Centro Investigac¸˜ ao em Gen´etica Molecular Humana, Secc¸˜ ao Autonoma de Biotecnologia, Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal b
a r t i c l e
i n f o
Article history: Received 14 January 2008 Received in revised form 26 February 2008 Accepted 16 April 2008 Available online 2 May 2008 Keywords: Spectral coding Optical multiplexing FRET DNA hybridization
a b s t r a c t Fluorescence resonance energy transfer (FRET) is widely used in spectral codification of information at the molecular level, and can be used to generate several layers of information on a DNA chip. We used two oligonucleotides (probes) labeled with different donor (harvesting) molecules in hybridization experiments with complementary oligonucleotides labeled with four different acceptors (targets). By looking at the fluorescence response of the sample after “specific” excitation of each donor molecule (by “specific” we mean a wavelength where one of the donors is predominantly excited), we inspected the possibility to identify the complementary oligonucleotide hybridized to the probe, in mixtures containing two donor probe/acceptor target pairs. In most samples (13 out of the 16 possible), it is trivial to identify the complementary target that is hybridized to the excited donor probe in the mixtures. The major limitations of the chosen system arise when very different concentrations of donor probe/acceptor target pairs are present in the same sample. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Spectral codification of information at the molecular level, i.e., the use of probes associated to specific molecules that allow the use of light to initiate, monitor or control the course of molecular events selectively has emerged as a rapidly growing field with applications in biology, chemistry and medicine [1–6]. The advantages of the use of these molecular probes include a fine control over the input and output of information at nano-size scales and in otherwise inaccessible sites. One such example is the use of fluorescent probes in DNA chips that are used to detect single nucleotide polymorphisms (SNPs). A change in a single base (A, T, G or C) of a codifying or non-codifying region of DNA, is termed as single nucleotide polymorphism. With the discovery of the human genome sequence, it is now known that two unrelated people differ at about 1 base in every 1000 of the 3 billion bases on their genome, so any individual will have about 3 million SNPs [7]. Some of these result in disease whereas others induce genetic variations. Therefore, a pre-requisite for the identification of a disease-associated SNP is the rapid screening of a high number of SNPs for a given DNA target sequence. In order to fulfill this need, several very elegant screening technolo-
∗ Corresponding author. E-mail address: [email protected] (J.C. Lima). 0925-4005/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.snb.2008.04.038
gies have been developed based on the use of probes that fluoresce on hybridization [8,9]. The use of fluorescent probes in DNA chips is frequently associated to the use of fluorescence resonant energy transfer (FRET), which facilitates the use of a single excitation wavelength and the readout of different emission wavelengths corresponding to different events. FRET is the radiationless transfer of excitation energy from a donor (d) molecule, usually attached to a specific DNA target sequence (TS), to an acceptor (a) molecule, usually linked to an oligonucleotide which is complementary (CS) to the DNA target sequence (TS). FRET is a probabilistic event based on the interaction between the transition dipoles of the donor and acceptor and depends on: (i) the degree of spectral overlap of the donor emission and acceptor absorption; (ii) the distance between the two dipoles; (iii) the orientation of the two dipoles; and (iv) the magnitude of the fluorescence quantum yield of the donor [10–14]. When the target sequence containing the donor (d-TS) hybridizes with its complementary sequence containing the acceptor (a-CS), the donor and acceptor are brought into sufficiently close contact that FRET occurs and fluorescence emission of the acceptor is observed as a result of selective excitation of the donor molecule and energy transfer from the donor to the acceptor. Thus, a judicious choice of the donor–acceptor pair is necessary in order to obtain high energy transfer efficiencies. Presently, DNA arrays exist which are made up of 500,000 wells, where the information generated in each well is based on the use of
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
147
Fig. 1. Schematic representation of a multilayer DNA chip for the detection of SNPs.
a single donor molecule attached to a DNA target sequence (d-TS) with the need for four different acceptor molecules attached to four different possible complementary sequences (a1 -CS1 A, a2 -CS2 T, a3 -CS3 G and a4 -CS4 C) that have clearly different distinguishable fluorescence emissions among them in order to identify one single SNP. If instead of one donor, several donors can be used attached to different DNA target sequences, then this methodology can be extended to the simultaneous identification of several DNA target sequences (d1 -TS1 , d2 -TS2 , d3 -TS3 ) within the same DNA chip well. Therefore, the use of multiple donors in the same DNA chip can be used to generate several layers of information on a DNA chip increasing the number of DNA target sequences that can be screened, thereby reducing the time and cost of identifying SNPs. Fig. 1 illustrates the presented concept to the detection of SNPs in a multilayer DNA chip. The use of multiple donor probes in DNA chips has been hindered partially because in many cases it is not trivial to clearly distinguish the information obtained from the selective excitation
of donor 1 from the information obtained from donor 2 (in the simplest case). The success in distinguishing between the information given by the different donor/acceptor pairs depends on the choice of the proper donor–acceptor pair molecules which in turn depends on their spectral characteristics. Specifically, the absorption of the different donors used must be as distinct as possible in such a way that it is possible to excite each of the donors specifically. The donors’ emission, however, should desirably occur at the same region enabling the energy transfer with similar efficiencies to the different acceptors. The acceptors, in their turn, should absorb in the same region but must have well distinct fluorescence emissions. This implies that the molecules must have very different Stokes shifts. All these requisites are difficult to fulfill perfectly. In addition, the use of several chromophores posses difficulties to the discrimination of signals. The usually broad absorption and emission bands turns the specific excitation of the different donor molecules difficult. Even with only two donors, the amount of crosstalk is non-negligible, which makes the discrimination non-trivial,
148
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Table 1 Possible donor/acceptor pairs combinations between the two donors (Alexa Fluor® 430 and Alexa Fluor® 514) and the four acceptors (Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633) Donor/acceptor pair Alexa Fluor® 430/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633
Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 633
especially when the concentration of the fluorophores is very different. The potential of multiplexed coding has been explored by several research groups [6,7]. Walt and collaborators have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with microspheres containing surface immobilized molecular beacons that undergo a conformational transition accompanied by a change in the fluorescence signal. Using several molecular beacons, each designed to recognize a different target they demonstrate the selective detection of genomic cystic fibrosis related targets. The microspheres are codified using different entrapped dyes. Specific excitation of the dyes is used to discriminate the bead position in the array. Nie et al. developed multicolor optical coding for biological assays embedding different-sized quantum dots into polymeric microbeads. The basic concept was to develop structures that have molecular recognition abilities and also built-in codes for rapid target identification. In their work, specific excitation of the beads was not aimed, neither is possible. Despite the several advantages displayed by quantum dots with respect to the narrowness of the emission lines and long-term stability, they are not appropriated for the particular applications where specific excitation of the probe is necessary. It is true that the usually broad absorption and emission bands of molecular fluorophores (organic dyes or luminescent metal complexes) turn difficult the discrimination of multiple signals; nevertheless, they are still the appropriated codifiers when excitation codification is necessary. In this work, we explore the use of multiple donors for FRET-based SNP detections, addressing the limitations of their application to the spectral codification for the simultaneous detection of different DNA sequence targets in a single vial. Effects of cross excitation are evaluated and the conditions of application of this concept are outlined. 2. Materials and methods Donors and acceptors were chosen from the Alexa Fluor® family on the basis of their spectroscopic characteristics. Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donors and Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 were chosen as acceptors. The 20 bp oligonucleotide 5 TGGGACCACGACTGTCTGCT3 was labeled with either 5 -C6 amino-dT-Alexa Fluor® 430 or 5 -C6 amino-dT-Alexa Fluor®
514 or used with no label (blank probe). The oligonucleotide (5 TCGTGGTCCC3 ) was 5 labeled with one of the chosen acceptors: C6 amino-dT-Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 or used with no label (blank target). In all experiments, the number of nucleotides separating donor and acceptor was 10 bp and the sequences were kept the same to avoid differentiated hybridization in the different combinations. The labeled oligonucleotides were purchased from STAB Vida (Portugal) and were used with no further purification. All labeled oligonucleotides were resuspended in TE buffer (10 mM Tris, pH 7.6, 0.1 mM EDTA; all reagents were of analytical grade). Equimolar quantities of each probe (donor labeled) and of each target (acceptor labeled) were mixed separately according to the optimal pairing—Alexa Fluor® 430/Alexa Fluor® 546; Alexa Fluor® 430/Alexa Fluor® 568; Alexa Fluor® 430/Alexa Fluor® 594; Alexa Fluor® 430/Alexa Fluor® 633. Similar mixtures were prepared with Alexa Fluor® 514-labeled oligonucleotides. The mixtures were then heated at 70 ◦ C for 5 min, allowed to cool down to room temperature (Biometra Tpersonal thermocycler) and stored at 4 ◦ C overnight. The annealed donor-labeled and acceptor-labeled oligonucleotides were mixed at 4 ◦ C in such a manner that the two different donorlabeled oligonucleotides are present in the same solution at the same molar concentration (1.25 × 10−7 M in 10 mM Tris, pH 7.6, 0.1 mM EDTA 100 mM NaCl). All the possible combinations for FRET between the two donors and the four different acceptors were tested (see Table 1). The prepared mixtures were kept at 4 ◦ C. Samples containing excess of one of the donors were prepared in the same way as the samples above but adding 2×, 5× and 10× excess of each of the donor-labeled probes pre-hybridized (using the same procedure) with blank target. The samples with excess of one of the donor-labeled probe/acceptor-labeled pairs were also prepared using more sample (2×, 5× and 10× more) of the corresponding pre-hybridized pair. Fluorescence emission spectra were recorded on a HoribaJobin-Yvon SPEX Fluorolog 3.22 spectrofluorimeter at right angle geometry with 2 nm bandwidth excitation and emission slits. The fluorescence measurements were performed in a 4 mm optical path quartz cuvette (STARNA, Germany) at 5 ◦ C (ThermoNESLAB RTE7 water bath). The temperature-dependent assays were performed with prehybridized samples and always prepared in the same way. Fluorescence spectra were collected from 5 to 60 ◦ C, taking care to ensure that for each spectrum recorded, the temperature was
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 2. (A) Normalized absorption and (B) normalized fluorescence emission spectra of the donor-labeled oligodeoxynucleotides and of the acceptor-labeled oligodeoxynucleotides. Alexa Fluor® 430 donor-labeled probe (—); Alexa Fluor® 514 ); Alexa Fluor® 546 acceptor-labeled target (- - -); Alexa donor-labeled probe ( Fluor® 568 acceptor-labeled target (· · ·); Alexa Fluor® 594 acceptor-labeled target (- · - · -); Alexa Fluor® 633 acceptor-labeled target (- · · - · · -).
stable at least for 3 min to guarantee temperature stabilization of the sample. 3. Results and discussion 3.1. Characterization of the pairs 3.1.1. Spectral characteristics of the fluorophores Fluorophores Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donor (harvesting) molecules, and Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 were chosen as acceptors (emitters). The normalized absorption and emission spectra of each donor and acceptor are shown in Fig. 2A and B, respectively. Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donors because the emission of each donor has significant overlap with the absorption of each acceptor in order to maximize energy transfer efficiency upon hybridization. Also, the absorption spectrum of each donor shows that preferential excitation of one donor with minimal excitation of the other donor, as well as the other acceptors, is possible. This is an important factor to consider when more than one fluorophore is present in the same solution. The excitation wavelength for the donor–acceptor pairs containing the donor
149
Fig. 3. Fluorescence emission spectra of samples of donor-labeled oligodeoxynucleotide hybridized with the blank target (complementary sequence containing no acceptor) and with each one of the acceptor-labeled oligodeoxynucleotides upon excitation of (A) Alexa Fluor® 430 (—); Alexa Fluor® 430 probe/Alexa Fluor® 546 target pair (- - -); Alexa Fluor® 430 probe/Alexa Fluor® 568 target pair (· · ·); Alexa Fluor® 430 probe/Alexa Fluor® 594 target pair (- · - · -); Alexa Fluor® 430 probe/Alexa Fluor® 633 target pair (- · · - · · -) at 430 nm and (B) of Alexa Fluor® 514 (—); Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair (- - -); Alexa Fluor® 514 probe/Alexa Fluor® 568 target pair (· · ·); Alexa Fluor® 514 probe/Alexa Fluor® 594 target pair (- · - · -); Alexa Fluor® 514 probe/Alexa Fluor® 633 target pair (- · · - · · -) at 500 nm.
Alexa Fluor® 430 probe was chosen at 430 nm, which is the maximum absorption of the fluorophore, while excitation at 500 nm was chosen for the pairs containing the Alexa Fluor® 514 probe, in order to minimize direct excitation of the other fluorophores (Fig. 2A). The acceptors emission maxima are sufficiently separated to allow the distinction of the individual peaks (Alexa Fluor® 546 emission maximum at 570 nm, Alexa Fluor® 568 at 602 nm, Alexa Fluor® 594 at 620 nm, and Alexa Fluor® 633 at 650 nm, Fig. 2B). Larger separations would be desirable; however, this would also imply a larger separation between the absorption bands of the acceptors, resulting in significant differences in the overlap with the donors’ emission, which would translate into very different FRET efficiencies. 3.1.2. FRET between pairs The emission spectra of the Alexa Fluor® 430 probe hybridized with a complementary non-labeled oligonucleotide sequence (blank target) is shown in Fig. 3A. Hybridization with complementary sequences labeled with any of the chosen acceptor
150
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157 Table 2 Estimated FRET efficiencies for the different pairs of donor-labeled oligodeoxynucleotides and acceptor-labeled oligodeoxynucleotides (donor and acceptor separated by 10 base pairs) in TE buffer 100 mM NaCl Donor/acceptor
Alexa Fluor® 546
Alexa Fluor® 568
Alexa Fluor® 594
Alexa Fluor® 633
Alexa Fluor® 430 Alexa Fluor® 514
40% 46%
57% 61%
47% 41%
57% 40%
pair and light competition and direct excitation have minor contribution. At sufficiently high temperatures, after the melting, a slight decrease can be observed in the fluorescence of both fluorophores due to the increase of the contribution of non-radiative processes to the excited state deactivation. From both plateaus of donor emission profile (before and after melting), it is possible to estimate a lower limit (due to the contribution of the non-radiative rate for decay) for the efficiency of energy transfer (47% in the case of Alexa Fluor® 430/Alexa Fluor® 546). The energy transfer efficiency estimated from the quenching of the donor’s fluorescence in the hybridized pair at constant temperature (5 ◦ C) are similar to the ones obtained from the temperature variation studies, within an error of 10% (40% in the case of Alexa Fluor® 430/Alexa Fluor® 546). In this case, the values are also lower limits due to the fact that a 100% hybridization yield is considered. These results are summarized in Table 2. 3.2. Characterization of mixture responses
Fig. 4. (A) Fluorescence emission spectra of Alexa Fluor® 430 probe/Alexa Fluor® 546 target pair at increasing temperatures; starting at 5 ◦ C and increasing 3 ◦ C for each different spectrum till the temperature reaches 60 ◦ C. (B) Fluorescence emission profile along the temperature variation at the emission wavelength of the donor Alexa Fluor® 430 probe at 540 nm (䊉) and at the emission wavelength of the acceptor Alexa Fluor® 546 at 570 nm ().
fluorophores quench the donor emission, and additionally the emission of the acceptor dominates the fluorescence spectrum of the donor–acceptor pair (Fig. 3A). Fig. 3B shows the same effect for donor Alexa Fluor® 514. At least partially, the emission of the acceptors observed as a result of excitation of the donors at 430 and 500 nm will come from direct excitation of each acceptor because the acceptors also absorb slightly at these wavelengths (Fig. 2A). For the same reason, part of the quenching observed for the donors emission results from absorption of the excitation light by the acceptors (less excitation light reaches the donors when the acceptors are present because the acceptors absorb some of the excitation light and therefore compete with the donors). To access the effect of direct absorption of the excitation energy by the acceptors in the quenching of the donor emission and the emission from the acceptors, the temperature profile of the pairs was followed by fluorescence (Fig. 4). Observation of the Alexa Fluor® 430 probe emission profile in the oligonucleotide duplex formed with Alexa Fluor® 546 target (Fig. 4B) shows that the increase of temperature results in an increase in the fluorescence of the donor and a decrease in the fluorescence of the acceptor, which occurs due to the duplex melting and the separation of donor and acceptor. This shows that both quenching of the donor and emission of the acceptor results essentially from energy transfer within the
3.2.1. FRET in the mixtures All the possible donor–acceptor pairs were formed (all the possible combinations of the two donors with the four acceptors, i.e., 2 × 4) by mixing probes (donors) and targets (acceptors) in equimolar concentrations at 4 ◦ C and allowing the annealing overnight. The hybridized pairs were then mixed in all the possible combinations containing two different donors in each mixture (2 × 8). The mixture was performed at 4 ◦ C and maintained at 4 ◦ C in order to avoid denaturation and uncontrolled reannealing. These prehybridized samples constitute an economical way of mimicking the donor/acceptor pairs that would be obtained through a SNP detection assay (Fig. 1), allowing us to characterize the fluorescence signatures expected in a real assay. Simultaneously, with pre-hybridized pairs we have an exact knowledge of the sample composition, which allows us to test the accuracy in the discrimination of the fluorescence response from individual pairs in the mixtures. The results of the 16 possible mixtures are shown in Table 3. 3.2.2. Evaluation of the “cross-talk” An unavoidable limitation to the discrimination of individual fluorescence responses in samples with several fluorophores comes from “cross-talk” (cross-excitation as a result of and spectral overlap of the fluorophores). It is our intention to focus the study on the “cross-talk” problem and for this we need to eliminate interferences that could give rise to false “cross-talk” signals, such has cross-hybridization. For this reason, all the studies were performed at 5 ◦ C with well known pre-hybridized samples. To evaluate cross-excitation of the different fluorophores at 430 and 500 nm the fluorescence emission spectra of each donor hybridized with blank targets and of each acceptor hybridized with blank probes (non-labeled oligonucleotides) are represented in Fig. 5. Excitation at 430 nm, produces the desirable excitation of donor Alexa Fluor® 430 but also significant excitation of donor Alexa Fluor® 546 and acceptor
Excited donor
Sample number Alexa Fluor® 430 (exc. 430 nm) Alexa Fluor® 514 (exc. 500 nm) a b c
Possible combinations Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 633
1 570
2 570
3 570
4 570
5 602
6 602
7 602
8 602
9 620
10 612a
11 620
12 650b
13 650
14 650
15 650
16 650
570
602
620
650
570
602
615c
650
570
602
620
650
570
602
620
650
Appears at lower wavelengths (612 nm instead of 620 nm) as a result of the contribution of Alexa Fluor® 568 (em = 602 nm) to the emission after FRET from donor Alexa Fluor® 514 that is also being excited at 430 nm. The emission from Alexa Fluor® 594 at 620 nm appears superimposed on the emission at 650 nm resulting from a fraction of direct excitation of Alexa Fluor® 633 acceptor and Alexa Fluor® 514 donor absorption at 430 nm. Appears at lower wavelengths (615 nm instead of 620 nm) as a result of the contribution of direct excitation, at 500 nm, of acceptor Alexa Fluor® 568 (em = 602 nm).
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Table 3 Emission band maxima for samples containing the two donors paired with each one of the four possible acceptors upon excitation of Alexa Fluor® 430 at 430 nm and of Alexa Fluor® 514 at 500 nm, and after deconvolution of the fluorescence emission response of the respective donor with equimolar concentrations of donors and acceptors
151
152
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 5. Fluorescence emission spectra with (A) 430 nm excitation and (B) 500 nm excitation, of Alexa Fluor® 430 donor probe hybridized with blank target (· · ·); Alexa Fluor® 514 donor probe hybridized with blank target (- - -); Alexa Fluor® 546 acceptor-labeled target hybridized with blank probe (—); Alexa Fluor® 568 acceptorlabeled target hybridized with blank probe (—); Alexa Fluor® 594 acceptor-labeled ); Alexa Fluor® 633 acceptor-labeled tartarget hybridized with blank probe ( ). All samples are at the same concentration get hybridized with blank probe ( (1.25 × 10−7 M).
Alexa Fluor® 633, and minor excitation of the other acceptors (Fig. 5A). Although Alexa Fluor® 430 absorption is dominant at this wavelength; the difference in fluorescence quantum yields dictates non-negligible cross-talk. As we will show below, cross-talk can, however, be filtered from the data using these spectra. Fluorescence spectra from a mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor® 514 probe/Alexa Fluor® 546 target excited at 430 and 500 nm are shown in Fig. 6A. Despite the presence of the cross-talk shown previously, the spectral responses at each excitation wavelength clearly identifies the acceptor paired to the corresponding donor, i.e., exciting at 430 nm the emission of Alexa Fluor® 568 is dominant and upon excitation at 500 nm the emission of Alexa Fluor® 546 is revealed. This situation is common to 13 of the 16 possible combinations that give rise to a trivial identification of the pairs (Table 3). More interestingly is the situation that occurs upon excitation at 430 nm of the mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 594 target and Alexa Fluor® 514 probe/Alexa Fluor® 633 target (Fig. 6B), one of the three situations where crosstalk becomes significant (Table 3). When donor Alexa Fluor® 430 is excited at 430 nm the fluorescence response, in the absence of
Fig. 6. Fluorescence emission spectra of the mixtures containing two hybridized pairs upon excitation of donor Alexa Fluor® 430 at 430 nm (—) and of donor Alexa ). The mixtures are: (A) Alexa Fluor® 430 donor probe Fluor® 514 at 500 nm ( hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 acceptor target, and (B) Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 594 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 633 acceptor target.
Fig. 7. Fluorescence emission spectra of the mixture containing Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 594 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 633 acceptor target at 430 nm excitation (—) and the spectra calculated from the fitting with Eq. (1), using a linear combination of the isolated donor probe and acceptor target emissions at the same ). concentration (1.25 × 10−7 M) (
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
153
Fig. 8. Weighting coefficients retrieved from the fitting of the spectral responses of each mixture with the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors at (A) 430 nm and (B) 500 nm excitation. The sample number figuring corresponds to the sample composition displayed in Table 3.
“cross-talk”, is expected to show an emission maximum at 620 nm (Alexa Fluor® 594 emission). However, at 620 nm the spectrum presents a shoulder and instead the maximum emission appears at 650 nm (Alexa Fluor® 633). This is due to direct excitation of donor Alexa Fluor® 514 at = 430 nm followed by energy transfer to its paired acceptor, Alexa Fluor® 633, in addition to the direct excitation of Alexa Fluor® 633 at = 430 nm as was previously seen in Fig. 5A. The spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors upon excitation at 430 and 500 nm (Fig. 5A and B, respectively), present relative intensities that are proportional to the amount of cross-talk contribution, as meaexc exc sured by the product fAlexa# = εexc Cf , where fAlexa# is the area of the fluorescence spectrum of a given fluorophore upon excitation at the wavelength exc , εexc the extinction coefficient at the excita-
tion wavelength, C the concentration of the fluorophore and f is the fluorescence quantum yield of the given fluorophore. These spectra can be used as a basis to fit the spectral response of the mixtures, Fexc , in such a way that the weighting coefficients, aexc , reflect i essentially the energy transfer within the pairs, and the cross-talk is partially filtered (Eqs. (1) and (2)). 430 430 430 430 430 430 430 F 430 = a430 1 fAlexa430 + a2 fAlexa514 + a3 fAlexa546 + a4 fAlexa568 430 430 430 + a430 5 fAlexa594 + a6 fAlexa633
(1)
500 500 500 500 500 F 500 = a500 1 fAlexa430 + a2 fAlexa514 + a3 fAlexa546 500 500 500 500 500 + a500 4 fAlexa568 + a5 fAlexa594 + a6 fAlexa633
(2)
154
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 9. Fluorescence emission spectra with (A) 430 nm excitation and (B) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× (—), 5× ( ) and 10× ( ) excess of Alexa Fluor® 430 donor probe hybridized with blank target Fluorescence emission spectra with (C) 430 nm excitation and (D) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa ) and 10× ( ) excess of Alexa Fluor® 514 donor probe Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× (—), 5× ( hybridized with blank target Fluorescence emission spectra with (E) 430 nm excitation and (F) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× excess of each donor-labeled probe hybridized with blank target (—); with 2× Alexa Fluor® 430 donor probe hybridized with blank target excess and 5× excess of Alexa Fluor® 514 donor probe hybridized with blank target ). (
Fig. 7 shows the fitting for a mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 594 target and Alexa Fluor® 514 probe/Alexa Fluor® 633 target (mixture 12) excited at 430 nm. In order to fit the contribution of Alexa Fluor® 594 in this mixture it is necessary to account for a contribution ∼14 times greater than the one resulting from direct excitation, which can only come from energy transfer from Alexa Fluor® 430. In the same way, the contribution from Alexa Fluor® 633 to the fluorescence spectrum of the mixture is ∼3 times greater than the one resulting from direct excitation of this fluorophore and obviously this excess of fluorescence is coming from energy transfer from Alexa Fluor® 514 that is also being excited at 430 nm. The coefficients retrieved from the fittings of all the mixtures are shown in Fig. 8A and B for excitation at 430 and 500 nm, respectively. On inspection of Fig. 8A and B, it can be seen that the major acceptors contribution (higher coefficient) is always given for the acceptor target that is hybridized with the donor probe that is preferentially excited. This is true for all 16 possible combinations tested and even for the three cases mentioned above (Fig. 8).
3.3. Limitations of FRET detection 3.3.1. Presence of non-hybridized donor The tests so far performed verify the ability to discriminate the presence of individual probe–target pairs in a mixture containing two different pairs, given that each pair in the mixture is labeled with a different donor probe and all (or the great majority) of the donor probes are hybridized with acceptor targets. In a real assay, un-hybridized probes as well as hybridized probes may be present in the same sample. This is the case where the donor probe is in higher concentration than the acceptor target. If the difference in concentration between the donor and the acceptor is high enough, in other words if the donor probe is in excess, then the ability to discriminate the FRET signal from the overall fluorescence will be compromised. Therefore, it is crucial to clearly define the limits within which the discrimination of the correct pair of donor/acceptor is possible. The fluorescence spectra of the mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor®
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
155
Fig. 11. Fluorescence emission spectra with (A) 430 nm and (B) 500 nm excitation of the mixtures containing Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair and Alexa Fluor® 430 probe/Alexa Fluor® 568 target pairs in non-equivalent proportions; Black lines correspond to 5× (—) and 10× (- - -) excess of Alexa Fluor® 430 probe/Alexa Fluor® 568 target pair and gray lines correspond to 5× ( ) and ) excess of Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair. 10× (
Fig. 10. Weighting coefficients retrieved from the fitting of the spectral responses of the mixtures containing Alexa Fluor® 430/Alexa Fluor® 568 and Alexa Fluor® 514/Alexa Fluor® 546 and an excess of each one or of both donors with the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors at (A) 430 nm and (B) 500 nm excitation. The coefficients retrieved for the donor are presented in dark grey while the ones retrieved for the acceptors are in light grey. Sample 1: Two times excess of donor Alexa Fluor® 430/blank target; Sample 2: five times excess of donor Alexa Fluor® 430/blank target: Sample 3: 10 times excess of donor Alexa Fluor® 430/blank target; Sample 4: two times excess of donor Alexa Fluor® 514/blank target; Sample 5: five times excess of donor Alexa Fluor® 514/blank target; Sample 6: 10 times excess of donor Alexa Fluor® 514/blank target; Sample 7: two times excess of donor Alexa Fluor® 430/blank target and two times excess of donor Alexa Fluor® 514/blank target; Sample 8: two times excess of donor Alexa Fluor® 430/blank target and five times excess of donor Alexa Fluor® 514/blank target.
514 probe/Alexa Fluor® 546 target, in the presence of increasing amounts (2, 5 and 10 times excess) of Alexa Fluor® 430 probe/blank target with excitation at 430 nm (Fig. 9A) and at 500 nm (Fig. 9B) is shown. The same for an excess of Alexa Fluor® 514 probe/blank target is shown in Fig. 9C for excitation at 430 nm and in Fig. 9D for excitation at 500 nm and in Fig. 9E and 9F for a simultaneous excess of both donors.
The fitting procedure described by Eqs. (1) and (2) was applied for these mixtures and the retrieved coefficients are presented in Fig. 10. The effect of the increase in donor concentration is quite evident in the coefficients associated to the donor contribution to the spectrum; since the basis set of spectra used (Fig. 5A and B) do not have the excess contribution of the donors. Sample 1, with two times excess of donor Alexa Fluor® 430/blank target, shows a smaller contribution of this donor fluorescence than Samples 2 and 3, with 5 and 10 times excess, respectively. The same is observed in the case of increasing excess of donor Alexa Fluor® 514/blank target for the Samples 4–6. The increased contribution of both donors simultaneously is noticeable in Sample 7 (two times excess of donor Alexa Fluor® 430/blank target and two times excess of donor Alexa Fluor® 514/blank target) and Sample 8 (two times excess of donor Alexa Fluor® 430/blank target and five times excess of donor Alexa Fluor® 514/blank target). The coefficients associated to the acceptors, however, are much less sensitive to the donor concentration, which is expected from the fact that the major contribution to the acceptors coefficients comes from energy transfer that only occurs within the hybridized donor probe–acceptor target pairs. Only at a 10 times excess of one of the donors (Samples 3 and 5) or at an excess of both donors (Samples 7 and 8) is a small effect on the acceptor coefficients noticed. This variation is greater for the less significant acceptor coefficient (∼30%), i.e., for the acceptor that is not connected to the donor that
156
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Alexa Fluor® 430 at 500 nm does not result in energy transfer to the acceptors. This turns out to be an efficient filter since the read out at the emission wavelength of the acceptors does not contain information about the excess of non-hybridized donors. We must, however, take into account that in a real situation, an a priori excess of donor can lead upon hybridization to an excess of one of the pairs. In this case, the direct excitation of Alexa Fluor® 514 at 430 nm or Alexa Fluor® 430 at 500 nm will result in significant cross-talk that will be reflected in the acceptors emission through FRET. In Fig. 11, the fluorescence spectra of mixtures containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor® 514 probe/Alexa Fluor® 546 target, in different proportions, are shown. The coefficients retrieved from the fitting of the mixture spectra in Fig. 11 with a linear combination of the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors (Fig. 5A and B), are summarized in Fig. 12. It can clearly be seen that a five times excess of the pair Alexa Fluor® 514 probe/Alexa Fluor® 546 target relatively to the pair Alexa Fluor® 430 probe/Alexa Fluor® 568 target (Fig. 11, Sample 3), yields for excitation at 430 nm a coefficient for Alexa Fluor® 546 acceptor that is the double of the one retrieved for Alexa Fluor® 568. In fact, at this excess, we are no longer exciting preferentially Alexa Fluor® 430. Also in the case of a five times excess of non hybridized Alexa Fluor® 514 (Fig. 10, Sample 5), Alexa Fluor® 430 was not being preferentially excited with excitation at = 430 nm, but in this case the discrimination effect of the FRET within the pair was sufficient to clearly indicate the correct acceptor target. 4. Conclusions
Fig. 12. Weighting coefficients retrieved from the fitting of the spectral responses of mixtures Alexa Fluor® 430/Alexa Fluor® 568 and Alexa Fluor® 514/Alexa Fluor® 546 containing excess of the one of the pairs at (A) 430 nm and (B) 500 nm excitation. The coefficients retrieved for the donor are presented in dark grey while the ones retrieved for the acceptors are in light grey. Sample 1: Five times excess of the pair Alexa Fluor® 430/Alexa Fluor® 568; Sample 2: 10 times excess of the pair Alexa Fluor® 430/Alexa Fluor® 568; Sample 3: five times excess of the Alexa Fluor® 514/Alexa Fluor® 546; Sample 4: 10 times excess of the Alexa Fluor® 514/Alexa Fluor® 546.
% is being excited preferentially. For the acceptor that is paired to the donor that is preferentially excited, which is always the acceptor with the highest coefficient (Fig. 10), the variation is always below 25% even in the case of a 10 times excess of one of the donors. In the concentration range studied, there is no error associated to the discrimination of the hybridized pair in these conditions. 3.3.2. Relative concentration of each pair Despite the fact that an excess of non-hybridized donor does not compromise the identification of the hybridized pairs, within the concentration range tested, we must take into account that this results exclusively from the fact that the non-negligible excitation of non-hybridized Alexa Fluor® 514 at 430 nm or non-hybridized
The use of organic chromophores poses important difficulties to the discrimination of signals due to the usually broad absorption and emission bands and the difficulty to specifically excite the different molecules. Even with only two labels (donors), the amount of cross-talk is non-negligible, which makes the discrimination nontrivial, especially when the concentration of the fluorophores is very different. Nevertheless, we have shown that a set of spectra obtained for the fluorophores can be used to fit the experimental spectra of the mixtures containing two donors hybridized with different acceptors, in such a way that the undesirable contribution of direct excitation of the second donor and of the acceptors is filtered, and FRET contribution is unequivocally evidenced. We have also shown that FRET itself acts as a filter towards distorting influences such as the presence of excess of non-hybridized donor. Under these conditions, the specific excitation of the donor in lower concentration is not possible. Despite that, the interference of the excess of non-hybridized donor absorbing at the excitation wavelength can be eliminated within a given limit. This occurs because the established coding principle implies the identification of the event looking at the acceptors emission, and only hybridized donors signal the event occurrence. However, as a result of the spectral overlap in the absorption of the two donors selected, if one of the donor/acceptor pairs is in sufficient excess, then it would produce a FRET response of the pair that is in excess even at the “specific” excitation of the other pair (present in lower concentration). This fact sets an important limitation to the application of the coding principle presented with these fluorophores. As such, in a real application it is desirable that the amount of donor probes used for the different event probing be at equivalent concentrations. Acknowledgements The authors thank Prof. Frank Quina and Dr. Melinda Noronha for valuable suggestions. The authors are also grateful to the
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fundac¸˜ ao para a Ciˆencia e Tecnologia (Portugal) for financial support (PROJECTS). L.G. thanks the Fundac¸˜ ao para a Ciˆencia e Tecnologia for a Ph.D. fellowship POSI/SFRH/BD/13783/2003.
157
[14] R.M. Clegg, Fluorescence resonance energy transfer, Curr. Opin. Biotechnol. 6 (1995) 103–110.
Biographies References [1] A.R. Clapp, L. Medintz, M. Mauro, B.R. Fisher, M.G. Bawendi, H. Mattoussi, Fluorescence resonance energy transfer between quantum dot donors and dyelabeled protein acceptors, J. Am. Chem. Soc. 126 (2003) 301–310. [2] R.J. Fulton, R.L. McDade, P.L. Smith, L.J. Kienker, J.R. Kettman Jr., Advanced multiplexed analysis with the FlowMetrix (TM) system, Clin. Chem. 43 (1997) 1749–1756. [3] J. Ju, et al., Design and synthesis of fluorescence energy transfer dye-labeled primers and their application for DNA sequencing and analysis, Anal. Biochem. 231 (1995) 131–140. [4] J. Liu, Y. Lu, Multi-fluorophore fluorescence resonance energy transfer for probing nucleic acids structure and folding, Methods Mol. Biol. 335 (2006) 257– 271. [5] R.M. Clegg, A.I.H. Murchie, A. Zechel, D.M.J. Lilley, Observing the helical geometry of double-stranded DNA in solution by fluorescence resonance energy transfer, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 2994–2998. [6] F.J. Steemers, J.A. Ferguson, D.R. Walt, Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays, Nat. Biotechnol. 18 (2000) 91–94. [7] M. Han, X. Gao, J.Z. Su, S. Nie, Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules, Nat. Biotechnol. 19 (2001) 631–635. [8] L. Melton, On the trail of SNPs, Nature 422 (2003) 917–923. [9] S. Tyagi, F.R. Kramer, Molecular beacons: probes that fluoresce upon hybridization, Nat. Biotechnol. 14 (1996) 303–308. [10] L.G. Kostrikis, S. Tyagi, M.M. Mhlanga, D.D. Ho, F.R. Kramer, Spectral genotyping of human alleles, Science 279 (1998) 1228–1229. [11] J.R. Lakowicz, Principles of Fluorescence Spectroscopy, second ed., Kluwer Academic/Plenum, New York, USA, 1999. [12] B.W. Van Der Meer, G.I. Coker, S.-Y. Simon Chen, Resonance Energy Transfer: Theory and Data, VCH, New York, USA, 1994. [13] P. Wu, L. Brand, Resonance energy transfer: methods and applications, Anal. Biochem. 218 (1994) 1–13.
Let´ıcia Giestas has graduated in Biochemistry at the Faculdade de Ciˆencias da Universidade de Lisboa in 2000 and currently is doing her PhD at the Department of Chemistry of Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa (FCT/UNL). Guilherme N.M. Ferreira has graduated in Chemical Engineering (1995), at Instituto ´ Superior Tecnico, Portugal, where he also obtained is PhD in Biotechnology (2000). He was appointed assistant professor at the Universidade do Algarve in 2007 where he also obtained his habilitation (2007). His research interests are focused in the development of novel technologies for sensing and detecting biological recognition reactions, sensors and devices incorporating detection systems based on microelectronic, optical and microelectromecanical detection. Pedro Viana Baptista holds a degree in Pharmaceutical Sciences (1996) from the Universidade de Lisboa and a PhD in Human Molecular Genetics by The Faculty of Medicine, University of London. Currently, he is assistant professor of Molecular Genetics at Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa (FCT/UNL) and group leader in Nanotechnology at the Human Molecular Genetics Research Centre (Department of Life Sciences – FCT/UNL). His research interests include the molecular epidemiology of genetic diseases, bionanotechnology based systems for DNA and RNA detection and characterization. J.C. Lima received his PhD in chemistry from the Technical University of Lisbon, IST in 1996. He was appointed assistant professor in the New University of Lisbon in 2000, teaching inorganic chemistry, photochemistry, chemistry structure and bonding, and physical chemistry at the Department of Chemistry of the New University of Lisbon. He is a member of the Portuguese Chemical Society. His research interests concern fluorescence of proteins, flavylium salts with different substitution patterns and fluorescent chemosensors. He is a member (researcher) of REQUIMTE (a national associated laboratory denoted to research in green chemistry).
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Multiplexed spectral coding for simultaneous detection of DNA hybridization reactions based on FRET Let´ıcia Giestas a , Guilherme N.M. Ferreira b , Pedro V. Baptista c , Jo˜ao Carlos Lima a,∗ a
REQUIMTE, Departamento de Qu´ımica, Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal IBB-Institute for Biotechnology and Bioengeneering, Centro de Biomedicina Molecular e Estrutural, Universidade do Algarve, 8000 Faro, Portugal c Centro Investigac¸˜ ao em Gen´etica Molecular Humana, Secc¸˜ ao Autonoma de Biotecnologia, Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal b
a r t i c l e
i n f o
Article history: Received 14 January 2008 Received in revised form 26 February 2008 Accepted 16 April 2008 Available online 2 May 2008 Keywords: Spectral coding Optical multiplexing FRET DNA hybridization
a b s t r a c t Fluorescence resonance energy transfer (FRET) is widely used in spectral codification of information at the molecular level, and can be used to generate several layers of information on a DNA chip. We used two oligonucleotides (probes) labeled with different donor (harvesting) molecules in hybridization experiments with complementary oligonucleotides labeled with four different acceptors (targets). By looking at the fluorescence response of the sample after “specific” excitation of each donor molecule (by “specific” we mean a wavelength where one of the donors is predominantly excited), we inspected the possibility to identify the complementary oligonucleotide hybridized to the probe, in mixtures containing two donor probe/acceptor target pairs. In most samples (13 out of the 16 possible), it is trivial to identify the complementary target that is hybridized to the excited donor probe in the mixtures. The major limitations of the chosen system arise when very different concentrations of donor probe/acceptor target pairs are present in the same sample. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Spectral codification of information at the molecular level, i.e., the use of probes associated to specific molecules that allow the use of light to initiate, monitor or control the course of molecular events selectively has emerged as a rapidly growing field with applications in biology, chemistry and medicine [1–6]. The advantages of the use of these molecular probes include a fine control over the input and output of information at nano-size scales and in otherwise inaccessible sites. One such example is the use of fluorescent probes in DNA chips that are used to detect single nucleotide polymorphisms (SNPs). A change in a single base (A, T, G or C) of a codifying or non-codifying region of DNA, is termed as single nucleotide polymorphism. With the discovery of the human genome sequence, it is now known that two unrelated people differ at about 1 base in every 1000 of the 3 billion bases on their genome, so any individual will have about 3 million SNPs [7]. Some of these result in disease whereas others induce genetic variations. Therefore, a pre-requisite for the identification of a disease-associated SNP is the rapid screening of a high number of SNPs for a given DNA target sequence. In order to fulfill this need, several very elegant screening technolo-
∗ Corresponding author. E-mail address: [email protected] (J.C. Lima). 0925-4005/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.snb.2008.04.038
gies have been developed based on the use of probes that fluoresce on hybridization [8,9]. The use of fluorescent probes in DNA chips is frequently associated to the use of fluorescence resonant energy transfer (FRET), which facilitates the use of a single excitation wavelength and the readout of different emission wavelengths corresponding to different events. FRET is the radiationless transfer of excitation energy from a donor (d) molecule, usually attached to a specific DNA target sequence (TS), to an acceptor (a) molecule, usually linked to an oligonucleotide which is complementary (CS) to the DNA target sequence (TS). FRET is a probabilistic event based on the interaction between the transition dipoles of the donor and acceptor and depends on: (i) the degree of spectral overlap of the donor emission and acceptor absorption; (ii) the distance between the two dipoles; (iii) the orientation of the two dipoles; and (iv) the magnitude of the fluorescence quantum yield of the donor [10–14]. When the target sequence containing the donor (d-TS) hybridizes with its complementary sequence containing the acceptor (a-CS), the donor and acceptor are brought into sufficiently close contact that FRET occurs and fluorescence emission of the acceptor is observed as a result of selective excitation of the donor molecule and energy transfer from the donor to the acceptor. Thus, a judicious choice of the donor–acceptor pair is necessary in order to obtain high energy transfer efficiencies. Presently, DNA arrays exist which are made up of 500,000 wells, where the information generated in each well is based on the use of
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
147
Fig. 1. Schematic representation of a multilayer DNA chip for the detection of SNPs.
a single donor molecule attached to a DNA target sequence (d-TS) with the need for four different acceptor molecules attached to four different possible complementary sequences (a1 -CS1 A, a2 -CS2 T, a3 -CS3 G and a4 -CS4 C) that have clearly different distinguishable fluorescence emissions among them in order to identify one single SNP. If instead of one donor, several donors can be used attached to different DNA target sequences, then this methodology can be extended to the simultaneous identification of several DNA target sequences (d1 -TS1 , d2 -TS2 , d3 -TS3 ) within the same DNA chip well. Therefore, the use of multiple donors in the same DNA chip can be used to generate several layers of information on a DNA chip increasing the number of DNA target sequences that can be screened, thereby reducing the time and cost of identifying SNPs. Fig. 1 illustrates the presented concept to the detection of SNPs in a multilayer DNA chip. The use of multiple donor probes in DNA chips has been hindered partially because in many cases it is not trivial to clearly distinguish the information obtained from the selective excitation
of donor 1 from the information obtained from donor 2 (in the simplest case). The success in distinguishing between the information given by the different donor/acceptor pairs depends on the choice of the proper donor–acceptor pair molecules which in turn depends on their spectral characteristics. Specifically, the absorption of the different donors used must be as distinct as possible in such a way that it is possible to excite each of the donors specifically. The donors’ emission, however, should desirably occur at the same region enabling the energy transfer with similar efficiencies to the different acceptors. The acceptors, in their turn, should absorb in the same region but must have well distinct fluorescence emissions. This implies that the molecules must have very different Stokes shifts. All these requisites are difficult to fulfill perfectly. In addition, the use of several chromophores posses difficulties to the discrimination of signals. The usually broad absorption and emission bands turns the specific excitation of the different donor molecules difficult. Even with only two donors, the amount of crosstalk is non-negligible, which makes the discrimination non-trivial,
148
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Table 1 Possible donor/acceptor pairs combinations between the two donors (Alexa Fluor® 430 and Alexa Fluor® 514) and the four acceptors (Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633) Donor/acceptor pair Alexa Fluor® 430/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633
Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 633
especially when the concentration of the fluorophores is very different. The potential of multiplexed coding has been explored by several research groups [6,7]. Walt and collaborators have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with microspheres containing surface immobilized molecular beacons that undergo a conformational transition accompanied by a change in the fluorescence signal. Using several molecular beacons, each designed to recognize a different target they demonstrate the selective detection of genomic cystic fibrosis related targets. The microspheres are codified using different entrapped dyes. Specific excitation of the dyes is used to discriminate the bead position in the array. Nie et al. developed multicolor optical coding for biological assays embedding different-sized quantum dots into polymeric microbeads. The basic concept was to develop structures that have molecular recognition abilities and also built-in codes for rapid target identification. In their work, specific excitation of the beads was not aimed, neither is possible. Despite the several advantages displayed by quantum dots with respect to the narrowness of the emission lines and long-term stability, they are not appropriated for the particular applications where specific excitation of the probe is necessary. It is true that the usually broad absorption and emission bands of molecular fluorophores (organic dyes or luminescent metal complexes) turn difficult the discrimination of multiple signals; nevertheless, they are still the appropriated codifiers when excitation codification is necessary. In this work, we explore the use of multiple donors for FRET-based SNP detections, addressing the limitations of their application to the spectral codification for the simultaneous detection of different DNA sequence targets in a single vial. Effects of cross excitation are evaluated and the conditions of application of this concept are outlined. 2. Materials and methods Donors and acceptors were chosen from the Alexa Fluor® family on the basis of their spectroscopic characteristics. Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donors and Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 were chosen as acceptors. The 20 bp oligonucleotide 5 TGGGACCACGACTGTCTGCT3 was labeled with either 5 -C6 amino-dT-Alexa Fluor® 430 or 5 -C6 amino-dT-Alexa Fluor®
514 or used with no label (blank probe). The oligonucleotide (5 TCGTGGTCCC3 ) was 5 labeled with one of the chosen acceptors: C6 amino-dT-Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 or used with no label (blank target). In all experiments, the number of nucleotides separating donor and acceptor was 10 bp and the sequences were kept the same to avoid differentiated hybridization in the different combinations. The labeled oligonucleotides were purchased from STAB Vida (Portugal) and were used with no further purification. All labeled oligonucleotides were resuspended in TE buffer (10 mM Tris, pH 7.6, 0.1 mM EDTA; all reagents were of analytical grade). Equimolar quantities of each probe (donor labeled) and of each target (acceptor labeled) were mixed separately according to the optimal pairing—Alexa Fluor® 430/Alexa Fluor® 546; Alexa Fluor® 430/Alexa Fluor® 568; Alexa Fluor® 430/Alexa Fluor® 594; Alexa Fluor® 430/Alexa Fluor® 633. Similar mixtures were prepared with Alexa Fluor® 514-labeled oligonucleotides. The mixtures were then heated at 70 ◦ C for 5 min, allowed to cool down to room temperature (Biometra Tpersonal thermocycler) and stored at 4 ◦ C overnight. The annealed donor-labeled and acceptor-labeled oligonucleotides were mixed at 4 ◦ C in such a manner that the two different donorlabeled oligonucleotides are present in the same solution at the same molar concentration (1.25 × 10−7 M in 10 mM Tris, pH 7.6, 0.1 mM EDTA 100 mM NaCl). All the possible combinations for FRET between the two donors and the four different acceptors were tested (see Table 1). The prepared mixtures were kept at 4 ◦ C. Samples containing excess of one of the donors were prepared in the same way as the samples above but adding 2×, 5× and 10× excess of each of the donor-labeled probes pre-hybridized (using the same procedure) with blank target. The samples with excess of one of the donor-labeled probe/acceptor-labeled pairs were also prepared using more sample (2×, 5× and 10× more) of the corresponding pre-hybridized pair. Fluorescence emission spectra were recorded on a HoribaJobin-Yvon SPEX Fluorolog 3.22 spectrofluorimeter at right angle geometry with 2 nm bandwidth excitation and emission slits. The fluorescence measurements were performed in a 4 mm optical path quartz cuvette (STARNA, Germany) at 5 ◦ C (ThermoNESLAB RTE7 water bath). The temperature-dependent assays were performed with prehybridized samples and always prepared in the same way. Fluorescence spectra were collected from 5 to 60 ◦ C, taking care to ensure that for each spectrum recorded, the temperature was
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 2. (A) Normalized absorption and (B) normalized fluorescence emission spectra of the donor-labeled oligodeoxynucleotides and of the acceptor-labeled oligodeoxynucleotides. Alexa Fluor® 430 donor-labeled probe (—); Alexa Fluor® 514 ); Alexa Fluor® 546 acceptor-labeled target (- - -); Alexa donor-labeled probe ( Fluor® 568 acceptor-labeled target (· · ·); Alexa Fluor® 594 acceptor-labeled target (- · - · -); Alexa Fluor® 633 acceptor-labeled target (- · · - · · -).
stable at least for 3 min to guarantee temperature stabilization of the sample. 3. Results and discussion 3.1. Characterization of the pairs 3.1.1. Spectral characteristics of the fluorophores Fluorophores Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donor (harvesting) molecules, and Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594 and Alexa Fluor® 633 were chosen as acceptors (emitters). The normalized absorption and emission spectra of each donor and acceptor are shown in Fig. 2A and B, respectively. Alexa Fluor® 430 and Alexa Fluor® 514 were chosen as donors because the emission of each donor has significant overlap with the absorption of each acceptor in order to maximize energy transfer efficiency upon hybridization. Also, the absorption spectrum of each donor shows that preferential excitation of one donor with minimal excitation of the other donor, as well as the other acceptors, is possible. This is an important factor to consider when more than one fluorophore is present in the same solution. The excitation wavelength for the donor–acceptor pairs containing the donor
149
Fig. 3. Fluorescence emission spectra of samples of donor-labeled oligodeoxynucleotide hybridized with the blank target (complementary sequence containing no acceptor) and with each one of the acceptor-labeled oligodeoxynucleotides upon excitation of (A) Alexa Fluor® 430 (—); Alexa Fluor® 430 probe/Alexa Fluor® 546 target pair (- - -); Alexa Fluor® 430 probe/Alexa Fluor® 568 target pair (· · ·); Alexa Fluor® 430 probe/Alexa Fluor® 594 target pair (- · - · -); Alexa Fluor® 430 probe/Alexa Fluor® 633 target pair (- · · - · · -) at 430 nm and (B) of Alexa Fluor® 514 (—); Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair (- - -); Alexa Fluor® 514 probe/Alexa Fluor® 568 target pair (· · ·); Alexa Fluor® 514 probe/Alexa Fluor® 594 target pair (- · - · -); Alexa Fluor® 514 probe/Alexa Fluor® 633 target pair (- · · - · · -) at 500 nm.
Alexa Fluor® 430 probe was chosen at 430 nm, which is the maximum absorption of the fluorophore, while excitation at 500 nm was chosen for the pairs containing the Alexa Fluor® 514 probe, in order to minimize direct excitation of the other fluorophores (Fig. 2A). The acceptors emission maxima are sufficiently separated to allow the distinction of the individual peaks (Alexa Fluor® 546 emission maximum at 570 nm, Alexa Fluor® 568 at 602 nm, Alexa Fluor® 594 at 620 nm, and Alexa Fluor® 633 at 650 nm, Fig. 2B). Larger separations would be desirable; however, this would also imply a larger separation between the absorption bands of the acceptors, resulting in significant differences in the overlap with the donors’ emission, which would translate into very different FRET efficiencies. 3.1.2. FRET between pairs The emission spectra of the Alexa Fluor® 430 probe hybridized with a complementary non-labeled oligonucleotide sequence (blank target) is shown in Fig. 3A. Hybridization with complementary sequences labeled with any of the chosen acceptor
150
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157 Table 2 Estimated FRET efficiencies for the different pairs of donor-labeled oligodeoxynucleotides and acceptor-labeled oligodeoxynucleotides (donor and acceptor separated by 10 base pairs) in TE buffer 100 mM NaCl Donor/acceptor
Alexa Fluor® 546
Alexa Fluor® 568
Alexa Fluor® 594
Alexa Fluor® 633
Alexa Fluor® 430 Alexa Fluor® 514
40% 46%
57% 61%
47% 41%
57% 40%
pair and light competition and direct excitation have minor contribution. At sufficiently high temperatures, after the melting, a slight decrease can be observed in the fluorescence of both fluorophores due to the increase of the contribution of non-radiative processes to the excited state deactivation. From both plateaus of donor emission profile (before and after melting), it is possible to estimate a lower limit (due to the contribution of the non-radiative rate for decay) for the efficiency of energy transfer (47% in the case of Alexa Fluor® 430/Alexa Fluor® 546). The energy transfer efficiency estimated from the quenching of the donor’s fluorescence in the hybridized pair at constant temperature (5 ◦ C) are similar to the ones obtained from the temperature variation studies, within an error of 10% (40% in the case of Alexa Fluor® 430/Alexa Fluor® 546). In this case, the values are also lower limits due to the fact that a 100% hybridization yield is considered. These results are summarized in Table 2. 3.2. Characterization of mixture responses
Fig. 4. (A) Fluorescence emission spectra of Alexa Fluor® 430 probe/Alexa Fluor® 546 target pair at increasing temperatures; starting at 5 ◦ C and increasing 3 ◦ C for each different spectrum till the temperature reaches 60 ◦ C. (B) Fluorescence emission profile along the temperature variation at the emission wavelength of the donor Alexa Fluor® 430 probe at 540 nm (䊉) and at the emission wavelength of the acceptor Alexa Fluor® 546 at 570 nm ().
fluorophores quench the donor emission, and additionally the emission of the acceptor dominates the fluorescence spectrum of the donor–acceptor pair (Fig. 3A). Fig. 3B shows the same effect for donor Alexa Fluor® 514. At least partially, the emission of the acceptors observed as a result of excitation of the donors at 430 and 500 nm will come from direct excitation of each acceptor because the acceptors also absorb slightly at these wavelengths (Fig. 2A). For the same reason, part of the quenching observed for the donors emission results from absorption of the excitation light by the acceptors (less excitation light reaches the donors when the acceptors are present because the acceptors absorb some of the excitation light and therefore compete with the donors). To access the effect of direct absorption of the excitation energy by the acceptors in the quenching of the donor emission and the emission from the acceptors, the temperature profile of the pairs was followed by fluorescence (Fig. 4). Observation of the Alexa Fluor® 430 probe emission profile in the oligonucleotide duplex formed with Alexa Fluor® 546 target (Fig. 4B) shows that the increase of temperature results in an increase in the fluorescence of the donor and a decrease in the fluorescence of the acceptor, which occurs due to the duplex melting and the separation of donor and acceptor. This shows that both quenching of the donor and emission of the acceptor results essentially from energy transfer within the
3.2.1. FRET in the mixtures All the possible donor–acceptor pairs were formed (all the possible combinations of the two donors with the four acceptors, i.e., 2 × 4) by mixing probes (donors) and targets (acceptors) in equimolar concentrations at 4 ◦ C and allowing the annealing overnight. The hybridized pairs were then mixed in all the possible combinations containing two different donors in each mixture (2 × 8). The mixture was performed at 4 ◦ C and maintained at 4 ◦ C in order to avoid denaturation and uncontrolled reannealing. These prehybridized samples constitute an economical way of mimicking the donor/acceptor pairs that would be obtained through a SNP detection assay (Fig. 1), allowing us to characterize the fluorescence signatures expected in a real assay. Simultaneously, with pre-hybridized pairs we have an exact knowledge of the sample composition, which allows us to test the accuracy in the discrimination of the fluorescence response from individual pairs in the mixtures. The results of the 16 possible mixtures are shown in Table 3. 3.2.2. Evaluation of the “cross-talk” An unavoidable limitation to the discrimination of individual fluorescence responses in samples with several fluorophores comes from “cross-talk” (cross-excitation as a result of and spectral overlap of the fluorophores). It is our intention to focus the study on the “cross-talk” problem and for this we need to eliminate interferences that could give rise to false “cross-talk” signals, such has cross-hybridization. For this reason, all the studies were performed at 5 ◦ C with well known pre-hybridized samples. To evaluate cross-excitation of the different fluorophores at 430 and 500 nm the fluorescence emission spectra of each donor hybridized with blank targets and of each acceptor hybridized with blank probes (non-labeled oligonucleotides) are represented in Fig. 5. Excitation at 430 nm, produces the desirable excitation of donor Alexa Fluor® 430 but also significant excitation of donor Alexa Fluor® 546 and acceptor
Excited donor
Sample number Alexa Fluor® 430 (exc. 430 nm) Alexa Fluor® 514 (exc. 500 nm) a b c
Possible combinations Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 546 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 568 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 594 + Alexa Fluor® 514/Alexa Fluor® 633
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 546
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 568
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 594
Alexa Fluor® 430/Alexa Fluor® 633 + Alexa Fluor® 514/Alexa Fluor® 633
1 570
2 570
3 570
4 570
5 602
6 602
7 602
8 602
9 620
10 612a
11 620
12 650b
13 650
14 650
15 650
16 650
570
602
620
650
570
602
615c
650
570
602
620
650
570
602
620
650
Appears at lower wavelengths (612 nm instead of 620 nm) as a result of the contribution of Alexa Fluor® 568 (em = 602 nm) to the emission after FRET from donor Alexa Fluor® 514 that is also being excited at 430 nm. The emission from Alexa Fluor® 594 at 620 nm appears superimposed on the emission at 650 nm resulting from a fraction of direct excitation of Alexa Fluor® 633 acceptor and Alexa Fluor® 514 donor absorption at 430 nm. Appears at lower wavelengths (615 nm instead of 620 nm) as a result of the contribution of direct excitation, at 500 nm, of acceptor Alexa Fluor® 568 (em = 602 nm).
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Table 3 Emission band maxima for samples containing the two donors paired with each one of the four possible acceptors upon excitation of Alexa Fluor® 430 at 430 nm and of Alexa Fluor® 514 at 500 nm, and after deconvolution of the fluorescence emission response of the respective donor with equimolar concentrations of donors and acceptors
151
152
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 5. Fluorescence emission spectra with (A) 430 nm excitation and (B) 500 nm excitation, of Alexa Fluor® 430 donor probe hybridized with blank target (· · ·); Alexa Fluor® 514 donor probe hybridized with blank target (- - -); Alexa Fluor® 546 acceptor-labeled target hybridized with blank probe (—); Alexa Fluor® 568 acceptorlabeled target hybridized with blank probe (—); Alexa Fluor® 594 acceptor-labeled ); Alexa Fluor® 633 acceptor-labeled tartarget hybridized with blank probe ( ). All samples are at the same concentration get hybridized with blank probe ( (1.25 × 10−7 M).
Alexa Fluor® 633, and minor excitation of the other acceptors (Fig. 5A). Although Alexa Fluor® 430 absorption is dominant at this wavelength; the difference in fluorescence quantum yields dictates non-negligible cross-talk. As we will show below, cross-talk can, however, be filtered from the data using these spectra. Fluorescence spectra from a mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor® 514 probe/Alexa Fluor® 546 target excited at 430 and 500 nm are shown in Fig. 6A. Despite the presence of the cross-talk shown previously, the spectral responses at each excitation wavelength clearly identifies the acceptor paired to the corresponding donor, i.e., exciting at 430 nm the emission of Alexa Fluor® 568 is dominant and upon excitation at 500 nm the emission of Alexa Fluor® 546 is revealed. This situation is common to 13 of the 16 possible combinations that give rise to a trivial identification of the pairs (Table 3). More interestingly is the situation that occurs upon excitation at 430 nm of the mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 594 target and Alexa Fluor® 514 probe/Alexa Fluor® 633 target (Fig. 6B), one of the three situations where crosstalk becomes significant (Table 3). When donor Alexa Fluor® 430 is excited at 430 nm the fluorescence response, in the absence of
Fig. 6. Fluorescence emission spectra of the mixtures containing two hybridized pairs upon excitation of donor Alexa Fluor® 430 at 430 nm (—) and of donor Alexa ). The mixtures are: (A) Alexa Fluor® 430 donor probe Fluor® 514 at 500 nm ( hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 acceptor target, and (B) Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 594 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 633 acceptor target.
Fig. 7. Fluorescence emission spectra of the mixture containing Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 594 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 633 acceptor target at 430 nm excitation (—) and the spectra calculated from the fitting with Eq. (1), using a linear combination of the isolated donor probe and acceptor target emissions at the same ). concentration (1.25 × 10−7 M) (
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
153
Fig. 8. Weighting coefficients retrieved from the fitting of the spectral responses of each mixture with the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors at (A) 430 nm and (B) 500 nm excitation. The sample number figuring corresponds to the sample composition displayed in Table 3.
“cross-talk”, is expected to show an emission maximum at 620 nm (Alexa Fluor® 594 emission). However, at 620 nm the spectrum presents a shoulder and instead the maximum emission appears at 650 nm (Alexa Fluor® 633). This is due to direct excitation of donor Alexa Fluor® 514 at = 430 nm followed by energy transfer to its paired acceptor, Alexa Fluor® 633, in addition to the direct excitation of Alexa Fluor® 633 at = 430 nm as was previously seen in Fig. 5A. The spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors upon excitation at 430 and 500 nm (Fig. 5A and B, respectively), present relative intensities that are proportional to the amount of cross-talk contribution, as meaexc exc sured by the product fAlexa# = εexc Cf , where fAlexa# is the area of the fluorescence spectrum of a given fluorophore upon excitation at the wavelength exc , εexc the extinction coefficient at the excita-
tion wavelength, C the concentration of the fluorophore and f is the fluorescence quantum yield of the given fluorophore. These spectra can be used as a basis to fit the spectral response of the mixtures, Fexc , in such a way that the weighting coefficients, aexc , reflect i essentially the energy transfer within the pairs, and the cross-talk is partially filtered (Eqs. (1) and (2)). 430 430 430 430 430 430 430 F 430 = a430 1 fAlexa430 + a2 fAlexa514 + a3 fAlexa546 + a4 fAlexa568 430 430 430 + a430 5 fAlexa594 + a6 fAlexa633
(1)
500 500 500 500 500 F 500 = a500 1 fAlexa430 + a2 fAlexa514 + a3 fAlexa546 500 500 500 500 500 + a500 4 fAlexa568 + a5 fAlexa594 + a6 fAlexa633
(2)
154
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fig. 9. Fluorescence emission spectra with (A) 430 nm excitation and (B) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× (—), 5× ( ) and 10× ( ) excess of Alexa Fluor® 430 donor probe hybridized with blank target Fluorescence emission spectra with (C) 430 nm excitation and (D) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa ) and 10× ( ) excess of Alexa Fluor® 514 donor probe Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× (—), 5× ( hybridized with blank target Fluorescence emission spectra with (E) 430 nm excitation and (F) 500 nm excitation of mixtures of Alexa Fluor® 430 donor probe hybridized with Alexa Fluor® 568 acceptor target and Alexa Fluor® 514 donor probe hybridized with Alexa Fluor® 546 with 2× excess of each donor-labeled probe hybridized with blank target (—); with 2× Alexa Fluor® 430 donor probe hybridized with blank target excess and 5× excess of Alexa Fluor® 514 donor probe hybridized with blank target ). (
Fig. 7 shows the fitting for a mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 594 target and Alexa Fluor® 514 probe/Alexa Fluor® 633 target (mixture 12) excited at 430 nm. In order to fit the contribution of Alexa Fluor® 594 in this mixture it is necessary to account for a contribution ∼14 times greater than the one resulting from direct excitation, which can only come from energy transfer from Alexa Fluor® 430. In the same way, the contribution from Alexa Fluor® 633 to the fluorescence spectrum of the mixture is ∼3 times greater than the one resulting from direct excitation of this fluorophore and obviously this excess of fluorescence is coming from energy transfer from Alexa Fluor® 514 that is also being excited at 430 nm. The coefficients retrieved from the fittings of all the mixtures are shown in Fig. 8A and B for excitation at 430 and 500 nm, respectively. On inspection of Fig. 8A and B, it can be seen that the major acceptors contribution (higher coefficient) is always given for the acceptor target that is hybridized with the donor probe that is preferentially excited. This is true for all 16 possible combinations tested and even for the three cases mentioned above (Fig. 8).
3.3. Limitations of FRET detection 3.3.1. Presence of non-hybridized donor The tests so far performed verify the ability to discriminate the presence of individual probe–target pairs in a mixture containing two different pairs, given that each pair in the mixture is labeled with a different donor probe and all (or the great majority) of the donor probes are hybridized with acceptor targets. In a real assay, un-hybridized probes as well as hybridized probes may be present in the same sample. This is the case where the donor probe is in higher concentration than the acceptor target. If the difference in concentration between the donor and the acceptor is high enough, in other words if the donor probe is in excess, then the ability to discriminate the FRET signal from the overall fluorescence will be compromised. Therefore, it is crucial to clearly define the limits within which the discrimination of the correct pair of donor/acceptor is possible. The fluorescence spectra of the mixture containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor®
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
155
Fig. 11. Fluorescence emission spectra with (A) 430 nm and (B) 500 nm excitation of the mixtures containing Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair and Alexa Fluor® 430 probe/Alexa Fluor® 568 target pairs in non-equivalent proportions; Black lines correspond to 5× (—) and 10× (- - -) excess of Alexa Fluor® 430 probe/Alexa Fluor® 568 target pair and gray lines correspond to 5× ( ) and ) excess of Alexa Fluor® 514 probe/Alexa Fluor® 546 target pair. 10× (
Fig. 10. Weighting coefficients retrieved from the fitting of the spectral responses of the mixtures containing Alexa Fluor® 430/Alexa Fluor® 568 and Alexa Fluor® 514/Alexa Fluor® 546 and an excess of each one or of both donors with the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors at (A) 430 nm and (B) 500 nm excitation. The coefficients retrieved for the donor are presented in dark grey while the ones retrieved for the acceptors are in light grey. Sample 1: Two times excess of donor Alexa Fluor® 430/blank target; Sample 2: five times excess of donor Alexa Fluor® 430/blank target: Sample 3: 10 times excess of donor Alexa Fluor® 430/blank target; Sample 4: two times excess of donor Alexa Fluor® 514/blank target; Sample 5: five times excess of donor Alexa Fluor® 514/blank target; Sample 6: 10 times excess of donor Alexa Fluor® 514/blank target; Sample 7: two times excess of donor Alexa Fluor® 430/blank target and two times excess of donor Alexa Fluor® 514/blank target; Sample 8: two times excess of donor Alexa Fluor® 430/blank target and five times excess of donor Alexa Fluor® 514/blank target.
514 probe/Alexa Fluor® 546 target, in the presence of increasing amounts (2, 5 and 10 times excess) of Alexa Fluor® 430 probe/blank target with excitation at 430 nm (Fig. 9A) and at 500 nm (Fig. 9B) is shown. The same for an excess of Alexa Fluor® 514 probe/blank target is shown in Fig. 9C for excitation at 430 nm and in Fig. 9D for excitation at 500 nm and in Fig. 9E and 9F for a simultaneous excess of both donors.
The fitting procedure described by Eqs. (1) and (2) was applied for these mixtures and the retrieved coefficients are presented in Fig. 10. The effect of the increase in donor concentration is quite evident in the coefficients associated to the donor contribution to the spectrum; since the basis set of spectra used (Fig. 5A and B) do not have the excess contribution of the donors. Sample 1, with two times excess of donor Alexa Fluor® 430/blank target, shows a smaller contribution of this donor fluorescence than Samples 2 and 3, with 5 and 10 times excess, respectively. The same is observed in the case of increasing excess of donor Alexa Fluor® 514/blank target for the Samples 4–6. The increased contribution of both donors simultaneously is noticeable in Sample 7 (two times excess of donor Alexa Fluor® 430/blank target and two times excess of donor Alexa Fluor® 514/blank target) and Sample 8 (two times excess of donor Alexa Fluor® 430/blank target and five times excess of donor Alexa Fluor® 514/blank target). The coefficients associated to the acceptors, however, are much less sensitive to the donor concentration, which is expected from the fact that the major contribution to the acceptors coefficients comes from energy transfer that only occurs within the hybridized donor probe–acceptor target pairs. Only at a 10 times excess of one of the donors (Samples 3 and 5) or at an excess of both donors (Samples 7 and 8) is a small effect on the acceptor coefficients noticed. This variation is greater for the less significant acceptor coefficient (∼30%), i.e., for the acceptor that is not connected to the donor that
156
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Alexa Fluor® 430 at 500 nm does not result in energy transfer to the acceptors. This turns out to be an efficient filter since the read out at the emission wavelength of the acceptors does not contain information about the excess of non-hybridized donors. We must, however, take into account that in a real situation, an a priori excess of donor can lead upon hybridization to an excess of one of the pairs. In this case, the direct excitation of Alexa Fluor® 514 at 430 nm or Alexa Fluor® 430 at 500 nm will result in significant cross-talk that will be reflected in the acceptors emission through FRET. In Fig. 11, the fluorescence spectra of mixtures containing the pairs Alexa Fluor® 430 probe/Alexa Fluor® 568 target and Alexa Fluor® 514 probe/Alexa Fluor® 546 target, in different proportions, are shown. The coefficients retrieved from the fitting of the mixture spectra in Fig. 11 with a linear combination of the spectral responses of the blank-target hybridized donors and blank-probe hybridized acceptors (Fig. 5A and B), are summarized in Fig. 12. It can clearly be seen that a five times excess of the pair Alexa Fluor® 514 probe/Alexa Fluor® 546 target relatively to the pair Alexa Fluor® 430 probe/Alexa Fluor® 568 target (Fig. 11, Sample 3), yields for excitation at 430 nm a coefficient for Alexa Fluor® 546 acceptor that is the double of the one retrieved for Alexa Fluor® 568. In fact, at this excess, we are no longer exciting preferentially Alexa Fluor® 430. Also in the case of a five times excess of non hybridized Alexa Fluor® 514 (Fig. 10, Sample 5), Alexa Fluor® 430 was not being preferentially excited with excitation at = 430 nm, but in this case the discrimination effect of the FRET within the pair was sufficient to clearly indicate the correct acceptor target. 4. Conclusions
Fig. 12. Weighting coefficients retrieved from the fitting of the spectral responses of mixtures Alexa Fluor® 430/Alexa Fluor® 568 and Alexa Fluor® 514/Alexa Fluor® 546 containing excess of the one of the pairs at (A) 430 nm and (B) 500 nm excitation. The coefficients retrieved for the donor are presented in dark grey while the ones retrieved for the acceptors are in light grey. Sample 1: Five times excess of the pair Alexa Fluor® 430/Alexa Fluor® 568; Sample 2: 10 times excess of the pair Alexa Fluor® 430/Alexa Fluor® 568; Sample 3: five times excess of the Alexa Fluor® 514/Alexa Fluor® 546; Sample 4: 10 times excess of the Alexa Fluor® 514/Alexa Fluor® 546.
% is being excited preferentially. For the acceptor that is paired to the donor that is preferentially excited, which is always the acceptor with the highest coefficient (Fig. 10), the variation is always below 25% even in the case of a 10 times excess of one of the donors. In the concentration range studied, there is no error associated to the discrimination of the hybridized pair in these conditions. 3.3.2. Relative concentration of each pair Despite the fact that an excess of non-hybridized donor does not compromise the identification of the hybridized pairs, within the concentration range tested, we must take into account that this results exclusively from the fact that the non-negligible excitation of non-hybridized Alexa Fluor® 514 at 430 nm or non-hybridized
The use of organic chromophores poses important difficulties to the discrimination of signals due to the usually broad absorption and emission bands and the difficulty to specifically excite the different molecules. Even with only two labels (donors), the amount of cross-talk is non-negligible, which makes the discrimination nontrivial, especially when the concentration of the fluorophores is very different. Nevertheless, we have shown that a set of spectra obtained for the fluorophores can be used to fit the experimental spectra of the mixtures containing two donors hybridized with different acceptors, in such a way that the undesirable contribution of direct excitation of the second donor and of the acceptors is filtered, and FRET contribution is unequivocally evidenced. We have also shown that FRET itself acts as a filter towards distorting influences such as the presence of excess of non-hybridized donor. Under these conditions, the specific excitation of the donor in lower concentration is not possible. Despite that, the interference of the excess of non-hybridized donor absorbing at the excitation wavelength can be eliminated within a given limit. This occurs because the established coding principle implies the identification of the event looking at the acceptors emission, and only hybridized donors signal the event occurrence. However, as a result of the spectral overlap in the absorption of the two donors selected, if one of the donor/acceptor pairs is in sufficient excess, then it would produce a FRET response of the pair that is in excess even at the “specific” excitation of the other pair (present in lower concentration). This fact sets an important limitation to the application of the coding principle presented with these fluorophores. As such, in a real application it is desirable that the amount of donor probes used for the different event probing be at equivalent concentrations. Acknowledgements The authors thank Prof. Frank Quina and Dr. Melinda Noronha for valuable suggestions. The authors are also grateful to the
L. Giestas et al. / Sensors and Actuators B 134 (2008) 146–157
Fundac¸˜ ao para a Ciˆencia e Tecnologia (Portugal) for financial support (PROJECTS). L.G. thanks the Fundac¸˜ ao para a Ciˆencia e Tecnologia for a Ph.D. fellowship POSI/SFRH/BD/13783/2003.
157
[14] R.M. Clegg, Fluorescence resonance energy transfer, Curr. Opin. Biotechnol. 6 (1995) 103–110.
Biographies References [1] A.R. Clapp, L. Medintz, M. Mauro, B.R. Fisher, M.G. Bawendi, H. Mattoussi, Fluorescence resonance energy transfer between quantum dot donors and dyelabeled protein acceptors, J. Am. Chem. Soc. 126 (2003) 301–310. [2] R.J. Fulton, R.L. McDade, P.L. Smith, L.J. Kienker, J.R. Kettman Jr., Advanced multiplexed analysis with the FlowMetrix (TM) system, Clin. Chem. 43 (1997) 1749–1756. [3] J. Ju, et al., Design and synthesis of fluorescence energy transfer dye-labeled primers and their application for DNA sequencing and analysis, Anal. Biochem. 231 (1995) 131–140. [4] J. Liu, Y. Lu, Multi-fluorophore fluorescence resonance energy transfer for probing nucleic acids structure and folding, Methods Mol. Biol. 335 (2006) 257– 271. [5] R.M. Clegg, A.I.H. Murchie, A. Zechel, D.M.J. Lilley, Observing the helical geometry of double-stranded DNA in solution by fluorescence resonance energy transfer, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 2994–2998. [6] F.J. Steemers, J.A. Ferguson, D.R. Walt, Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays, Nat. Biotechnol. 18 (2000) 91–94. [7] M. Han, X. Gao, J.Z. Su, S. Nie, Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules, Nat. Biotechnol. 19 (2001) 631–635. [8] L. Melton, On the trail of SNPs, Nature 422 (2003) 917–923. [9] S. Tyagi, F.R. Kramer, Molecular beacons: probes that fluoresce upon hybridization, Nat. Biotechnol. 14 (1996) 303–308. [10] L.G. Kostrikis, S. Tyagi, M.M. Mhlanga, D.D. Ho, F.R. Kramer, Spectral genotyping of human alleles, Science 279 (1998) 1228–1229. [11] J.R. Lakowicz, Principles of Fluorescence Spectroscopy, second ed., Kluwer Academic/Plenum, New York, USA, 1999. [12] B.W. Van Der Meer, G.I. Coker, S.-Y. Simon Chen, Resonance Energy Transfer: Theory and Data, VCH, New York, USA, 1994. [13] P. Wu, L. Brand, Resonance energy transfer: methods and applications, Anal. Biochem. 218 (1994) 1–13.
Let´ıcia Giestas has graduated in Biochemistry at the Faculdade de Ciˆencias da Universidade de Lisboa in 2000 and currently is doing her PhD at the Department of Chemistry of Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa (FCT/UNL). Guilherme N.M. Ferreira has graduated in Chemical Engineering (1995), at Instituto ´ Superior Tecnico, Portugal, where he also obtained is PhD in Biotechnology (2000). He was appointed assistant professor at the Universidade do Algarve in 2007 where he also obtained his habilitation (2007). His research interests are focused in the development of novel technologies for sensing and detecting biological recognition reactions, sensors and devices incorporating detection systems based on microelectronic, optical and microelectromecanical detection. Pedro Viana Baptista holds a degree in Pharmaceutical Sciences (1996) from the Universidade de Lisboa and a PhD in Human Molecular Genetics by The Faculty of Medicine, University of London. Currently, he is assistant professor of Molecular Genetics at Faculdade de Ciˆencias e Tecnologia, Universidade Nova de Lisboa (FCT/UNL) and group leader in Nanotechnology at the Human Molecular Genetics Research Centre (Department of Life Sciences – FCT/UNL). His research interests include the molecular epidemiology of genetic diseases, bionanotechnology based systems for DNA and RNA detection and characterization. J.C. Lima received his PhD in chemistry from the Technical University of Lisbon, IST in 1996. He was appointed assistant professor in the New University of Lisbon in 2000, teaching inorganic chemistry, photochemistry, chemistry structure and bonding, and physical chemistry at the Department of Chemistry of the New University of Lisbon. He is a member of the Portuguese Chemical Society. His research interests concern fluorescence of proteins, flavylium salts with different substitution patterns and fluorescent chemosensors. He is a member (researcher) of REQUIMTE (a national associated laboratory denoted to research in green chemistry).