- Email: [email protected]
Mutational analysis of BMP15 and GDF9 as candidate genes for premature ovarian failure
Mutational analysis of BMP15 and GDF9 as candidate genes for premature ovarian failure Ashwini L. Chand, M.Sc.,a Anna P. Ponnampalam, B.Sc.,a Sarah E. Harris, Ph.D.,a Ingrid M. Winship, M.D.,b and Andrew N. Shelling, Ph.D.a a
Department of Obstetrics and Gynaecology, Faculty of Medical and Health Sciences, and b Department of Molecular Medicine and Pathology, Faculty of Medical and Health Sciences, University of Auckland, Auckland, New Zealand
Mutational screening of the bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) genes in a population with premature ovarian failure (POF) identified no new mutations. However, three single nucleotide polymorphisms in the BMP15 gene, two in the 5= untranslated region (31T⬎G and 71C⬎G) and another in exon 1 (387G⬎A), were found to be common in both POF and control groups. (Fertil Steril威 2006; 86:1009 –12. ©2006 by American Society for Reproductive Medicine.)
Premature ovarian failure (POF) is a heterogeneous condition, defined as ovarian failure occurring before the age of 40 years. It is a common condition because it affects 1% of all women (1). Two significant consequences of POF are the early loss of fertility and the clinical effects of low estrogen. Low levels of estrogen from a young age are thought to increase the risk of osteoporosis (2). It is thought that POF occurs in instances where the ovary has lost its oocyte pool prematurely or when ovulation does not occur despite the presence of follicles (3). This may mean that either the cohort of developing follicles undergoes atresia at accelerated rates or that the follicles become unresponsive to gonadotropin stimulation. The regulation of ovarian function is achieved by the concerted interaction of gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), and local ovarian factors such as inhibins, activins, bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9), which are all members of the transforming growth factor  (TGF) superfamily (4 –10). The biological role of BMP15 involves the initiation of primary follicular growth from senescence (11–15), whereas GDF9 is crucial for folliculogenesis from the primary follicular stage onward (16). The GDF9 stimulates cumulus expansion, with the induction of hyaluronan synthase 2 (HAS2), cyclooxygenase 2 (COX2), and steroidogenic acute regulator protein (StAR) (17). A recent study has demonstrated inhibition of cumulus expansion following the inhibition of GDF9 expression by RNA interference (RNAi) in oocytes. Interestingly, the down-regulation of BMP15 in this
Received December 2, 2005; revised and accepted February 27, 2006. Funding was provided by the University of Auckland Research Committee, Health Research Council of New Zealand, and the Auckland Medical Research Foundation. Reprint requests: Andrew N. Shelling, Ph.D., Department of Obstetrics and Gynaecology, Faculty of Medical and Health Sciences, Private Bag 92019, University of Auckland, Auckland, New Zealand (FAX: ⫹64 9 373 7677; E-mail: [email protected]).
0015-0282/06/$32.00 doi:10.1016/j.fertnstert.2006.02.107
in vitro system did not appear to have any effect on cumulus expansion (18). Nevertheless, the importance of BMP15 as a fertility regulator is evident in Inverdale and Hanna female sheep, where the disruption in BMP15 gene expression affects ovulation rates in a dosage-sensitive manner (19). In both strains, the heterozygous (FecXI/FecX⫹) sheep have increased ovulation rates and multiple births, whereas the homozygous (FecXI/FecXI) mutant females have primary ovarian failure due to an arrest in follicle growth at the primary preantral stage (19). Similarly, naturally occurring mutations in the GDF9 gene in Belclare and Cambridge ewes exhibit differential ovulation rates in a dose-dependent manner (20). The current study is a mutational analysis of the BMP15 and GDF9 genes in a cohort of women who have a clinical diagnosis of POF, with the specific aim of determining whether these are contributing factors in the pathogenesis of POF. For the purpose of this study, POF was defined as cessation of menses for a duration of ⱖ6 months before the age of 40 years, and an FSH concentration of ⬎40 IU/L. Thirtyeight women with POF, who were karyotypically normal, were recruited for study in the Department of Obstetrics and Gynaecology, University of Auckland, Auckland, New Zealand. Procedures for genomic DNA extraction, polymerase chain reaction (PCR), single-strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP), and DNA sequencing were conducted as described previously (21). The PCR primer sequences for GDF9 and BMP15 exons 1 and 2 were kindly provided by Dr. Ritvos, Ph.D. (University of Helsinki, Helsinki, Finland). Primer sequences for BMP15 exons 1 and 2 were derived from GenBank Sequence Reference AJ132405. For the screening of the 5= untranslated region, GenBank Sequence AL359914 was used for reference. Primer sequences for Exon 1:
Fertility and Sterility姞 Vol. 86, No. 4, October 2006 Copyright ©2006 American Society for Reproductive Medicine, Published by Elsevier Inc.
1009
TABLE 1 Genotype frequency of common single nucleotide substitutions in the BMP15 gene in POF and control women. Position
Control (n ⴝ 51)
POF (n ⴝ 38)
33 (64.7%) 15 (29.4%) 3 (5.9%)
23 (60.5%) 9 (23.7%) 6 (15.8%)
34 (66.6%) 14 (27.5%) 3 (5.9%)
24 (63.2%) 13 (34.2%) 1 (2.6%)
47 (92.2%) 1 (2.0%) 3 (5.9%)
36 (94.7%) 1 (2.6%) 1 (2.6%)
BMP15 31 T⬎G TT TG GG BMP15 71 C⬎G CC CG GG BMP15 387 G⬎A GG GA AA
Gene 5=-flanking
5=-flanking
Exon 1
Note: GenBank Sequence AJ132405 was used as the reference for SNP location. BMP ⫽ bone morphogenetic protein; POF ⫽ premature ovarian failure; SNP ⫽ single nucleotide polymorphism. Chand. SNPs in BMP15 and GDF9 genes and POF. Fertil Steril 2006.
F1 TTGTGTTGGGGCCTGTTGTT, R1 GGTACAACTCCAGCATGTACC; F2 GCTGCTAGAAGAATCCCCTG, R2 AACCCACCAATTCCCTTTT; Exon 2: F1 AATATTCATGTTAAGAGGTAAGA, R1 AGGAAGGGAAGTGGTTGGTT; F2 TCAATCTCTCCTGCCATGTGG, R2 TGTCCAAGGATGAAGAGCC; F3 TGGTCTTGAGCTCTGGCATG, R3 CTGATTTGGAAAGGGTGGAG; F4 CTCCGGAGAACCGAAAATAA, R4 CTCCCATTTGCCTCAATCA; RFLP Primers: F TATGAGGCAACTTTGGTCCAGGAGA, R TAAGAATACTGAGGAGGACCATCTTGAAAA; Mature peptide sequence primers: F TTGCCTTCTTGTTACTCTATTTCA, R GATTACTTGCAGCTTTAACACTGA; 5= untranslated region: F1 AAGCTCCCCAGATGATTCCTATC, R1 CCATCCTACTTCCATGCCTCTAAT; F2 ATGGAAGTAGGATGGGAACAGG, R2 CCTCATAACTTGGCCTCTTTG; F3 ATGCTGCCTTGTCCCACCTTC, R3 GTGTTCCATGAAAAGCACGAGTTC. Primer sequences for GDF9 were derived from GenBank Sequence Reference AC004500 and are as follows: Exon 1: F1 TAGTCCACCCACACACCTGA, R1 CCAGAAGCCTGAGAACCAAG; 1010
Chand et al.
Correspondence
F2 TTCCTCCTTTGGTTTTGCTG, R2 AAAGCTCTGGAGTCTGGCTG; F3 TTCTATCTGTTGGGCGAGGT, R3 CATCTTCCCTCCACCCAGT; Exon 2: F1 CTGCCTGTTGTGTTGACTGA, R1 TCTGAATCCATTTGTGTTTCTTTC; F2 CTCTCGGCAGAGCTCCATAC, R2 GGGGACACCAGAGTCATGTT; F3 TGAAAGACCAGCTGGAGCA, R3 TCAGATTGAAGGAAGCTGGG; F4 CGCAGAGGTCAGGAAACTGT, R4 GGTCTTGGCACTGAGGAGTC; F5 TCGGTATGGCTCTCCAGTTC, R5 AATATATCAAGCTTTCTCTTGAAG Screening for mutations in the two genes of interest was undertaken with a combination of SSCP and DNA sequencing techniques. Although SSCP does not detect every mutation, the fragments used were of optimal size and were run under different conditions, thereby maximizing the likelihood of finding variants. Once variants were identified, they were tested in the patient and control populations using RFLP (details from authors upon request). Calculation of allele and genotype frequencies and 2 analysis were performed using the SHEsis software (22). No sequence variation was observed in exons 1 and 2 of the GDF9 gene in either POF subjects or the control cohort (data not shown). Mutational analysis of the DNA sequences encoding the BMP15 protein and 800 bp of the 5= untranslated region identified three single nucleotide polymorphisms (SNPs) (Table 1). The 387G⬎A variant (exon 1) did not result in a change in amino acid sequence, and was identified in the POF and control populations. Although a Vol. 86, No. 4, October 2006
there was a higher incidence of the SNP in the controls compared with the POF population, the difference was not statistically significant. Two nucleotide substitutions were identified in the 5= untranslated region, 49 nucleotides from the translation start site (31T⬎G), and 9 nucleotides from the translation start site (71C⬎G) (NCBI GenBank Sequence Reference: AJ132405). The comparison of genotype and allelic frequencies in the two populations did not indicate a statistical significance. Search of the NCBI Nucleotide Sequence Database revealed the presence of both sequence variants (AF082349:715G and AJ132405:71C). Both 31T⬎G and 71C⬎G nucleotide variants were found to occur as heterozygotes and homozygotes; however, genotype frequencies were not significantly different both patient and control groups. Although the findings of the current study are similar to that of the observations of an earlier report demonstrating a lack of sequence variation in the GDF9 and BMP15 genes in 15 POF subjects studied from a Japanese population (23), the current study was conducted with a larger and predominantly Caucasian population (n ⫽ 38). Recently, a heterozygous nonconservative missense mutation (BMP15 Y235C) in the region encoding the BMP15 propeptide region was reported (24). The carrier had prepubertal onset of hypergonadotropic ovarian failure characterized by primary amenorrhea and ovarian hypoplasia. In contrast, the mutational analysis of this region in our study did not demonstrate any sequence variation in this region. The phenotype of primary amenorrhoea and dysgenesis of the ovaries, which was exhibited by the carrier of the Y235C mutation, is far more severe than the extent of ovarian failure exhibited in the New Zealand patient group. It was concluded that DNA variations in the GDF9 and BMP15 genes are rare in the New Zealand population. Premature ovarian failure is a highly heterogeneous condition caused by autoimmune (25) or genetic (26) disorders, permanent damage to the ovaries (following chemotherapy, irradiation, or surgery), and exposure to environmental toxicants (27). However, for the majority of cases, the causes remain unknown. Disorders linked to the X chromosome, such as Fragile X and Turner’s syndrome, are associated with POF (28). Furthermore, specific regions are deemed important for ovarian function and are located on long arm of the X chromosome (Xq): proximally Xq13.3-q21.3 (termed POF2) (29) (30) or distally on Xq26-q28 (termed POF1) (31, 32). Other X chromosomal genes that may cause POF include DIAPH2, which is thought to affect cell divisions required for ovarian follicle formation (33); the FSH primary response homolog 1 (FSHPRH1) gene at Xq22, which is potentially involved in the response of gonadal tissues to FSH (34); and the ZFX gene encoding a zinc-finger protein, DFFRX, which possibly has a role oocyte proliferation and gonadal degeneration in Turner’s syndrome (35). Fertility and Sterility姞
Several autosomal genetic mutations reportedly have a significant correlation with POF. These include mutations in the inhibin ␣ subunit (21, 36, 37), the FSH receptor (38 – 40), LH receptor (42– 44), and the Forkhead transcription factor FOXL2 (45). On the basis of current knowledge on genes with proven roles in female reproductive system, it has been suggested that up to 30% of all POF cases may be attributed to a genetic cause (46). The current study did not demonstrate a contribution of BMP15 and GDF9 genes in the pathogenesis of POF in the New Zealand population. The identification of the BMP15 Y235C in a patient with hypergonadotropic ovarian failure in the Italian population, but not in the New Zealand or the Japanese population, suggests that it is a rare event. We suggest the POF may be due to defects in several genes, with each mutation affecting only a small number of patients. However, the ultimate understanding of the contribution of ovary-specific genes and pathways will eventually enable early detection or prediction of those at risk for developing POF. REFERENCES 1. Coulam, CB, Adamson, SC, Annegers, JF. Incidence of premature ovarian failure. Obstet Gynecol 1986;67(4):604 – 6. 2. Luborsky, JL, Meyer, P, Sowers, MF, Gold, EB, Santoro, N. Premature menopause in a multi-ethnic population study of the menopause transition. Hum Reprod 2003;18(1):199 –206. 3. Welt, CK, Hall, JE, Adams, JM, Taylor, AE. Relationship of estradiol and inhibin to the follicle-stimulating hormone variability in hypergonadotropic hypogonadism or premature ovarian failure. J Clin Endocrinol Metab 2005;90(2):826 –30. 4. Gougeon, A. Inhibin, activin, follistatin, and transforming growth factor beta (TGF-beta): presence in the ovary and possible role in the regulation of folliculogenesis in primates. Contracept Fertil Sex 1994;22(9): 571– 6. 5. Findlay, JK. An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis. Biol Reprod 1993;48(1):15–23. 6. Tong, S, Wallace, EM, Burger, HG. Inhibins and activins: clinical advances in reproductive medicine. Clin Endocrinol (Oxf) 2003;58(2): 115–27. 7. Mather, JP, Moore, A, Li, RH. Activins, inhibins, and follistatins: further thoughts on a growing family of regulators. Proc Soc Exp Biol Med 1997;215(3):209 –22. 8. Knight, PG, Glister, C. Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reproduction 2001;121(4):503–12. 9. Findlay, JK, Drummond, AE, Dyson, ML, Baillie, AJ, Robertson, DM, Ethier, JF. Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily. Mol Cell Endocrinol 2002;191(1):35– 43. 10. Richards, JS, Russell, DL, Ochsner, S, Hsieh, M, Doyle, KH, Falender, AE, et al. Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 2002;57:195–220. 11. Laitinen, M, Vuojolainen, K, Jaatinen, R, Ketola, I, Aaltonen, J, Lehtonen, E, et al. A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis. Mech Dev 1998;78(1–2):135– 40. 12. Aaltonen, J, Laitinen, MP, Vuojolainen, K, Jaatinen, R, HorelliKuitunen, N, Seppa, L, et al. Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. J Clin Endocrinol Metab 1999;84(8): 2744 –50.
1011
13. Dube, JY, Frenette, G, Paquin, R, Chapdelaine, P, Tremblay, J, Tremblay, RR, et al. Isolation from human seminal plasma of an abundant 16-kDa protein originating from the prostate, its identification with a 94-residue peptide originally described as beta-inhibin. J Androl 1987; 8(3):182–9. 14. Jaatinen, R, Laitinen, MP, Vuojolainen, K, Aaltonen, J, Louhio, H, Heikinheimo, K, et al. Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B. Mol Cell Endocrinol 1999; 156(1–2):189 –93. 15. Otsuka, F, Yao, Z, Lee, T, Yamamoto, S, Erickson, GF, Shimasaki, S. Bone morphogenetic protein-15. Identification of target cells and biological functions. J Biol Chem 2000;275(50):39523– 8. 16. Dong, J, Albertini, DF, Nishimori, K, Kumar, TR, Lu, N, Matzuk, MM. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996;383(6600):531–5. 17. Elvin, JA, Clark, AT, Wang, P, Wolfman, NM, Matzuk, MM. Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 1999;13(6):1035– 48. 18. Gui, LM, Joyce, IM. RNA interference evidence that growth differentiation factor-9 mediates oocyte regulation of cumulus expansion in mice. Biol Reprod 2005;72(1):195–9. 19. Galloway, SM, McNatty, KP, Cambridge, LM, Laitinen, MP, Juengel, JL, Jokiranta, TS, et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat Genet 2000;25(3):279 – 83. 20. Hanrahan, JP, Gregan, SM, Mulsant, P, Mullen, M, Davis, GH, Powell, R, et al. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol Reprod 2004;70(4):900 –9. 21. Shelling, AN, Burton, KA, Chand, AL, van Ee, CC, France, JT, Farquhar, CM, et al. Inhibin: a candidate gene for premature ovarian failure. Hum Reprod 2000;15(12):2644 –9. 22. Shi, YY, He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15(2):97– 8. 23. Takebayashi, K, Takakura, K, Wang, H, Kimura, F, Kasahara, K, Noda, Y. Mutation analysis of the growth differentiation factor-9 and -9B genes in patients with premature ovarian failure and polycystic ovary syndrome. Fertil Steril 2000;74(5):976 –9. 24. Di Pasquale, E, Beck-Peccoz, P, Persani, L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene. Am J Hum Genet 2004;75(1): 106 –11. 25. Luborsky, J, Llanes, B, Roussev, R, Coulam, C. Ovarian antibodies, FSH and inhibin B: independent markers associated with unexplained infertility. Hum Reprod 2000;15(5):1046 –51. 26. Mattison, DR, Evans, MI, Schwimmer, WB, White, BJ, Jensen, B, Schulman, JD. Familial premature ovarian failure. Am J Hum Genet 1984;36(6):1341– 8. 27. Matikainen, T, Perez, GI, Jurisicova, A, Pru, JK, Schlezinger, JJ, Ryu, HY, et al. Aromatic hydrocarbon receptor-driven Bax gene expression is required for premature ovarian failure caused by biohazardous environmental chemicals. Nat Genet 2001;28(4):355– 60. 28. Conway, GS, Hettiarachchi, S, Murray, A, Jacobs, PA. Fragile X premutations in familial premature ovarian failure. Lancet 1995; 346(8970):309 –10. 29. Sala, C, Arrigo, G, Torri, G, Martinazzi, F, Riva, P, Larizza, L, et al. Eleven X chromosome breakpoints associated with premature ovarian failure (POF) map to a 15-Mb YAC contig spanning Xq21. Genomics 1997;40(1):123–31. 30. Powell, CM, Taggart, RT, Drumheller, TC, Wangsa, D, Qian, C, Nelson, LM, et al. Molecular and cytogenetic studies of an X autosome
1012
Chand et al.
Correspondence
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
translocation in a patient with premature ovarian failure and review of the literature. Am J Med Genet 1994;52(1):19 –26. Tharapel, AT, Anderson, KP, Simpson, JL, Martens, PR, Wilroy, RS Jr, Llerena, JC Jr, et al. Deletion (X)(q26.1-q28) in a proband and her mother: molecular characterization and phenotypic-karyotypic deductions. Am J Hum Genet 1993;52(3):463–71. Marozzi, A, Manfredini, E, Tibiletti, MG, Furlan, D, Villa, N, Vegetti, W, et al. Molecular definition of Xq common-deleted region in patients affected by premature ovarian failure. Human Genetics 2000;107(4): 304 –11. Bione, S, Sala, C, Manzini, C, Arrigo, G, Zuffardi, O, Banfi, S, et al. A human homologue of the Drosophila melanogaster diaphanous gene is disrupted in a patient with premature ovarian failure: evidence for conserved function in oogenesis and implications for human sterility. Am J Hum Genet 1998;62(3):533– 41. Roberts, RG, Kendall, E, Vetrie, D, Bobrow, M. Sequence and chromosomal location of a human homologue of LRPR1, an FSH primary response gene. Genomics 1996;37(1):122– 4. Jones, MH, Furlong, RA, Burkin, H, Chalmers, IJ, Brown, GM, Khwaja, O, et al. The Drosophila developmental gene fat facets has a human homologue in Xp11.4 which escapes X-inactivation and has related sequences on Yq11.2. Hum Mol Genet 1996;5(11):1695–701. Marozzi, A, Porta, C, Vegetti, W, Crosignani, PG, Tibiletti, MG, Dalpra, L, et al. Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure. Hum Reprod 2002;17(7): 1741–5. Dixit, H, Deendayal, M, Singh, L. Mutational analysis of the mature peptide region of inhibin genes in Indian women with ovarian failure. Hum Reprod 2004;19(8):1760 – 4. Aittomaki, K, Lucena, JL, Pakarinen, P, Sistonen, P, Tapanainen, J, Gromoll, J, et al. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 1995; 82(6):959 – 68. Beau, I, Touraine, P, Meduri, G, Gougeon, A, Desroches, A, Matuchansky, C, et al. A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. J Clin Invest 1998;102(7):1352–9. Touraine, P, Beau, I, Gougeon, A, Meduri, G, Desroches, A, Pichard, C, et al. New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype. Mol Endocrinol 1999;13(11):1844 –54. Takahashi, K, Ozaki, T, Kanasaki, H, Miyazaki, K. Successful pregnancy in a woman with ovarian failure associated with mutation in the beta-subunit of luteinizing hormone. Horm Res 2001;55(5):258 – 63. Latronico, AC, Anasti, J, Arnhold, IJ, Mendonca, BB, Domenice, S, Albano, MC, et al. A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty. J Clin Endocrinol Metab 1995;80(8):2490 – 4. Misrahi, M, Meduri, G, Pissard, S, Bouvattier, C, Beau, I, Loosfelt, H, et al. Comparison of immunocytochemical and molecular features with the phenotype in a case of incomplete male pseudohermaphroditism associated with a mutation of the luteinizing hormone receptor. J Clin Endocrinol Metab 1997;82(7):2159 – 65. Toledo, SP, Brunner, HG, Kraaij, R, Post, M, Dahia, PL, Hayashida, CY, et al. An inactivating mutation of the luteinizing hormone receptor causes amenorrhea in a 46,XX female. J Clin Endocrinol Metab 1996; 81(11):3850 – 4. Harris, SE, Chand, AL, Winship, IM, Gersak, K, Aittomaki, K, Shelling, AN. Identification of novel mutations in FOXL2 associated with premature ovarian failure. Mol Hum Reprod 2002;8(8):729 –33. Vegetti, W, Grazia Tibiletti, M, Testa, G, de Lauretis, Y, Alagna, F, Castoldi, E, et al. Inheritance in idiopathic premature ovarian failure: analysis of 71 cases. Human Reproduction 1998;13(7):1796 – 800.
Vol. 86, No. 4, October 2006
Department of Obstetrics and Gynaecology, Faculty of Medical and Health Sciences, and b Department of Molecular Medicine and Pathology, Faculty of Medical and Health Sciences, University of Auckland, Auckland, New Zealand
Mutational screening of the bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) genes in a population with premature ovarian failure (POF) identified no new mutations. However, three single nucleotide polymorphisms in the BMP15 gene, two in the 5= untranslated region (31T⬎G and 71C⬎G) and another in exon 1 (387G⬎A), were found to be common in both POF and control groups. (Fertil Steril威 2006; 86:1009 –12. ©2006 by American Society for Reproductive Medicine.)
Premature ovarian failure (POF) is a heterogeneous condition, defined as ovarian failure occurring before the age of 40 years. It is a common condition because it affects 1% of all women (1). Two significant consequences of POF are the early loss of fertility and the clinical effects of low estrogen. Low levels of estrogen from a young age are thought to increase the risk of osteoporosis (2). It is thought that POF occurs in instances where the ovary has lost its oocyte pool prematurely or when ovulation does not occur despite the presence of follicles (3). This may mean that either the cohort of developing follicles undergoes atresia at accelerated rates or that the follicles become unresponsive to gonadotropin stimulation. The regulation of ovarian function is achieved by the concerted interaction of gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), and local ovarian factors such as inhibins, activins, bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9), which are all members of the transforming growth factor  (TGF) superfamily (4 –10). The biological role of BMP15 involves the initiation of primary follicular growth from senescence (11–15), whereas GDF9 is crucial for folliculogenesis from the primary follicular stage onward (16). The GDF9 stimulates cumulus expansion, with the induction of hyaluronan synthase 2 (HAS2), cyclooxygenase 2 (COX2), and steroidogenic acute regulator protein (StAR) (17). A recent study has demonstrated inhibition of cumulus expansion following the inhibition of GDF9 expression by RNA interference (RNAi) in oocytes. Interestingly, the down-regulation of BMP15 in this
Received December 2, 2005; revised and accepted February 27, 2006. Funding was provided by the University of Auckland Research Committee, Health Research Council of New Zealand, and the Auckland Medical Research Foundation. Reprint requests: Andrew N. Shelling, Ph.D., Department of Obstetrics and Gynaecology, Faculty of Medical and Health Sciences, Private Bag 92019, University of Auckland, Auckland, New Zealand (FAX: ⫹64 9 373 7677; E-mail: [email protected]).
0015-0282/06/$32.00 doi:10.1016/j.fertnstert.2006.02.107
in vitro system did not appear to have any effect on cumulus expansion (18). Nevertheless, the importance of BMP15 as a fertility regulator is evident in Inverdale and Hanna female sheep, where the disruption in BMP15 gene expression affects ovulation rates in a dosage-sensitive manner (19). In both strains, the heterozygous (FecXI/FecX⫹) sheep have increased ovulation rates and multiple births, whereas the homozygous (FecXI/FecXI) mutant females have primary ovarian failure due to an arrest in follicle growth at the primary preantral stage (19). Similarly, naturally occurring mutations in the GDF9 gene in Belclare and Cambridge ewes exhibit differential ovulation rates in a dose-dependent manner (20). The current study is a mutational analysis of the BMP15 and GDF9 genes in a cohort of women who have a clinical diagnosis of POF, with the specific aim of determining whether these are contributing factors in the pathogenesis of POF. For the purpose of this study, POF was defined as cessation of menses for a duration of ⱖ6 months before the age of 40 years, and an FSH concentration of ⬎40 IU/L. Thirtyeight women with POF, who were karyotypically normal, were recruited for study in the Department of Obstetrics and Gynaecology, University of Auckland, Auckland, New Zealand. Procedures for genomic DNA extraction, polymerase chain reaction (PCR), single-strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP), and DNA sequencing were conducted as described previously (21). The PCR primer sequences for GDF9 and BMP15 exons 1 and 2 were kindly provided by Dr. Ritvos, Ph.D. (University of Helsinki, Helsinki, Finland). Primer sequences for BMP15 exons 1 and 2 were derived from GenBank Sequence Reference AJ132405. For the screening of the 5= untranslated region, GenBank Sequence AL359914 was used for reference. Primer sequences for Exon 1:
Fertility and Sterility姞 Vol. 86, No. 4, October 2006 Copyright ©2006 American Society for Reproductive Medicine, Published by Elsevier Inc.
1009
TABLE 1 Genotype frequency of common single nucleotide substitutions in the BMP15 gene in POF and control women. Position
Control (n ⴝ 51)
POF (n ⴝ 38)
33 (64.7%) 15 (29.4%) 3 (5.9%)
23 (60.5%) 9 (23.7%) 6 (15.8%)
34 (66.6%) 14 (27.5%) 3 (5.9%)
24 (63.2%) 13 (34.2%) 1 (2.6%)
47 (92.2%) 1 (2.0%) 3 (5.9%)
36 (94.7%) 1 (2.6%) 1 (2.6%)
BMP15 31 T⬎G TT TG GG BMP15 71 C⬎G CC CG GG BMP15 387 G⬎A GG GA AA
Gene 5=-flanking
5=-flanking
Exon 1
Note: GenBank Sequence AJ132405 was used as the reference for SNP location. BMP ⫽ bone morphogenetic protein; POF ⫽ premature ovarian failure; SNP ⫽ single nucleotide polymorphism. Chand. SNPs in BMP15 and GDF9 genes and POF. Fertil Steril 2006.
F1 TTGTGTTGGGGCCTGTTGTT, R1 GGTACAACTCCAGCATGTACC; F2 GCTGCTAGAAGAATCCCCTG, R2 AACCCACCAATTCCCTTTT; Exon 2: F1 AATATTCATGTTAAGAGGTAAGA, R1 AGGAAGGGAAGTGGTTGGTT; F2 TCAATCTCTCCTGCCATGTGG, R2 TGTCCAAGGATGAAGAGCC; F3 TGGTCTTGAGCTCTGGCATG, R3 CTGATTTGGAAAGGGTGGAG; F4 CTCCGGAGAACCGAAAATAA, R4 CTCCCATTTGCCTCAATCA; RFLP Primers: F TATGAGGCAACTTTGGTCCAGGAGA, R TAAGAATACTGAGGAGGACCATCTTGAAAA; Mature peptide sequence primers: F TTGCCTTCTTGTTACTCTATTTCA, R GATTACTTGCAGCTTTAACACTGA; 5= untranslated region: F1 AAGCTCCCCAGATGATTCCTATC, R1 CCATCCTACTTCCATGCCTCTAAT; F2 ATGGAAGTAGGATGGGAACAGG, R2 CCTCATAACTTGGCCTCTTTG; F3 ATGCTGCCTTGTCCCACCTTC, R3 GTGTTCCATGAAAAGCACGAGTTC. Primer sequences for GDF9 were derived from GenBank Sequence Reference AC004500 and are as follows: Exon 1: F1 TAGTCCACCCACACACCTGA, R1 CCAGAAGCCTGAGAACCAAG; 1010
Chand et al.
Correspondence
F2 TTCCTCCTTTGGTTTTGCTG, R2 AAAGCTCTGGAGTCTGGCTG; F3 TTCTATCTGTTGGGCGAGGT, R3 CATCTTCCCTCCACCCAGT; Exon 2: F1 CTGCCTGTTGTGTTGACTGA, R1 TCTGAATCCATTTGTGTTTCTTTC; F2 CTCTCGGCAGAGCTCCATAC, R2 GGGGACACCAGAGTCATGTT; F3 TGAAAGACCAGCTGGAGCA, R3 TCAGATTGAAGGAAGCTGGG; F4 CGCAGAGGTCAGGAAACTGT, R4 GGTCTTGGCACTGAGGAGTC; F5 TCGGTATGGCTCTCCAGTTC, R5 AATATATCAAGCTTTCTCTTGAAG Screening for mutations in the two genes of interest was undertaken with a combination of SSCP and DNA sequencing techniques. Although SSCP does not detect every mutation, the fragments used were of optimal size and were run under different conditions, thereby maximizing the likelihood of finding variants. Once variants were identified, they were tested in the patient and control populations using RFLP (details from authors upon request). Calculation of allele and genotype frequencies and 2 analysis were performed using the SHEsis software (22). No sequence variation was observed in exons 1 and 2 of the GDF9 gene in either POF subjects or the control cohort (data not shown). Mutational analysis of the DNA sequences encoding the BMP15 protein and 800 bp of the 5= untranslated region identified three single nucleotide polymorphisms (SNPs) (Table 1). The 387G⬎A variant (exon 1) did not result in a change in amino acid sequence, and was identified in the POF and control populations. Although a Vol. 86, No. 4, October 2006
there was a higher incidence of the SNP in the controls compared with the POF population, the difference was not statistically significant. Two nucleotide substitutions were identified in the 5= untranslated region, 49 nucleotides from the translation start site (31T⬎G), and 9 nucleotides from the translation start site (71C⬎G) (NCBI GenBank Sequence Reference: AJ132405). The comparison of genotype and allelic frequencies in the two populations did not indicate a statistical significance. Search of the NCBI Nucleotide Sequence Database revealed the presence of both sequence variants (AF082349:715G and AJ132405:71C). Both 31T⬎G and 71C⬎G nucleotide variants were found to occur as heterozygotes and homozygotes; however, genotype frequencies were not significantly different both patient and control groups. Although the findings of the current study are similar to that of the observations of an earlier report demonstrating a lack of sequence variation in the GDF9 and BMP15 genes in 15 POF subjects studied from a Japanese population (23), the current study was conducted with a larger and predominantly Caucasian population (n ⫽ 38). Recently, a heterozygous nonconservative missense mutation (BMP15 Y235C) in the region encoding the BMP15 propeptide region was reported (24). The carrier had prepubertal onset of hypergonadotropic ovarian failure characterized by primary amenorrhea and ovarian hypoplasia. In contrast, the mutational analysis of this region in our study did not demonstrate any sequence variation in this region. The phenotype of primary amenorrhoea and dysgenesis of the ovaries, which was exhibited by the carrier of the Y235C mutation, is far more severe than the extent of ovarian failure exhibited in the New Zealand patient group. It was concluded that DNA variations in the GDF9 and BMP15 genes are rare in the New Zealand population. Premature ovarian failure is a highly heterogeneous condition caused by autoimmune (25) or genetic (26) disorders, permanent damage to the ovaries (following chemotherapy, irradiation, or surgery), and exposure to environmental toxicants (27). However, for the majority of cases, the causes remain unknown. Disorders linked to the X chromosome, such as Fragile X and Turner’s syndrome, are associated with POF (28). Furthermore, specific regions are deemed important for ovarian function and are located on long arm of the X chromosome (Xq): proximally Xq13.3-q21.3 (termed POF2) (29) (30) or distally on Xq26-q28 (termed POF1) (31, 32). Other X chromosomal genes that may cause POF include DIAPH2, which is thought to affect cell divisions required for ovarian follicle formation (33); the FSH primary response homolog 1 (FSHPRH1) gene at Xq22, which is potentially involved in the response of gonadal tissues to FSH (34); and the ZFX gene encoding a zinc-finger protein, DFFRX, which possibly has a role oocyte proliferation and gonadal degeneration in Turner’s syndrome (35). Fertility and Sterility姞
Several autosomal genetic mutations reportedly have a significant correlation with POF. These include mutations in the inhibin ␣ subunit (21, 36, 37), the FSH receptor (38 – 40), LH receptor (42– 44), and the Forkhead transcription factor FOXL2 (45). On the basis of current knowledge on genes with proven roles in female reproductive system, it has been suggested that up to 30% of all POF cases may be attributed to a genetic cause (46). The current study did not demonstrate a contribution of BMP15 and GDF9 genes in the pathogenesis of POF in the New Zealand population. The identification of the BMP15 Y235C in a patient with hypergonadotropic ovarian failure in the Italian population, but not in the New Zealand or the Japanese population, suggests that it is a rare event. We suggest the POF may be due to defects in several genes, with each mutation affecting only a small number of patients. However, the ultimate understanding of the contribution of ovary-specific genes and pathways will eventually enable early detection or prediction of those at risk for developing POF. REFERENCES 1. Coulam, CB, Adamson, SC, Annegers, JF. Incidence of premature ovarian failure. Obstet Gynecol 1986;67(4):604 – 6. 2. Luborsky, JL, Meyer, P, Sowers, MF, Gold, EB, Santoro, N. Premature menopause in a multi-ethnic population study of the menopause transition. Hum Reprod 2003;18(1):199 –206. 3. Welt, CK, Hall, JE, Adams, JM, Taylor, AE. Relationship of estradiol and inhibin to the follicle-stimulating hormone variability in hypergonadotropic hypogonadism or premature ovarian failure. J Clin Endocrinol Metab 2005;90(2):826 –30. 4. Gougeon, A. Inhibin, activin, follistatin, and transforming growth factor beta (TGF-beta): presence in the ovary and possible role in the regulation of folliculogenesis in primates. Contracept Fertil Sex 1994;22(9): 571– 6. 5. Findlay, JK. An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis. Biol Reprod 1993;48(1):15–23. 6. Tong, S, Wallace, EM, Burger, HG. Inhibins and activins: clinical advances in reproductive medicine. Clin Endocrinol (Oxf) 2003;58(2): 115–27. 7. Mather, JP, Moore, A, Li, RH. Activins, inhibins, and follistatins: further thoughts on a growing family of regulators. Proc Soc Exp Biol Med 1997;215(3):209 –22. 8. Knight, PG, Glister, C. Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reproduction 2001;121(4):503–12. 9. Findlay, JK, Drummond, AE, Dyson, ML, Baillie, AJ, Robertson, DM, Ethier, JF. Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily. Mol Cell Endocrinol 2002;191(1):35– 43. 10. Richards, JS, Russell, DL, Ochsner, S, Hsieh, M, Doyle, KH, Falender, AE, et al. Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 2002;57:195–220. 11. Laitinen, M, Vuojolainen, K, Jaatinen, R, Ketola, I, Aaltonen, J, Lehtonen, E, et al. A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis. Mech Dev 1998;78(1–2):135– 40. 12. Aaltonen, J, Laitinen, MP, Vuojolainen, K, Jaatinen, R, HorelliKuitunen, N, Seppa, L, et al. Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. J Clin Endocrinol Metab 1999;84(8): 2744 –50.
1011
13. Dube, JY, Frenette, G, Paquin, R, Chapdelaine, P, Tremblay, J, Tremblay, RR, et al. Isolation from human seminal plasma of an abundant 16-kDa protein originating from the prostate, its identification with a 94-residue peptide originally described as beta-inhibin. J Androl 1987; 8(3):182–9. 14. Jaatinen, R, Laitinen, MP, Vuojolainen, K, Aaltonen, J, Louhio, H, Heikinheimo, K, et al. Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B. Mol Cell Endocrinol 1999; 156(1–2):189 –93. 15. Otsuka, F, Yao, Z, Lee, T, Yamamoto, S, Erickson, GF, Shimasaki, S. Bone morphogenetic protein-15. Identification of target cells and biological functions. J Biol Chem 2000;275(50):39523– 8. 16. Dong, J, Albertini, DF, Nishimori, K, Kumar, TR, Lu, N, Matzuk, MM. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996;383(6600):531–5. 17. Elvin, JA, Clark, AT, Wang, P, Wolfman, NM, Matzuk, MM. Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 1999;13(6):1035– 48. 18. Gui, LM, Joyce, IM. RNA interference evidence that growth differentiation factor-9 mediates oocyte regulation of cumulus expansion in mice. Biol Reprod 2005;72(1):195–9. 19. Galloway, SM, McNatty, KP, Cambridge, LM, Laitinen, MP, Juengel, JL, Jokiranta, TS, et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat Genet 2000;25(3):279 – 83. 20. Hanrahan, JP, Gregan, SM, Mulsant, P, Mullen, M, Davis, GH, Powell, R, et al. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol Reprod 2004;70(4):900 –9. 21. Shelling, AN, Burton, KA, Chand, AL, van Ee, CC, France, JT, Farquhar, CM, et al. Inhibin: a candidate gene for premature ovarian failure. Hum Reprod 2000;15(12):2644 –9. 22. Shi, YY, He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005;15(2):97– 8. 23. Takebayashi, K, Takakura, K, Wang, H, Kimura, F, Kasahara, K, Noda, Y. Mutation analysis of the growth differentiation factor-9 and -9B genes in patients with premature ovarian failure and polycystic ovary syndrome. Fertil Steril 2000;74(5):976 –9. 24. Di Pasquale, E, Beck-Peccoz, P, Persani, L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene. Am J Hum Genet 2004;75(1): 106 –11. 25. Luborsky, J, Llanes, B, Roussev, R, Coulam, C. Ovarian antibodies, FSH and inhibin B: independent markers associated with unexplained infertility. Hum Reprod 2000;15(5):1046 –51. 26. Mattison, DR, Evans, MI, Schwimmer, WB, White, BJ, Jensen, B, Schulman, JD. Familial premature ovarian failure. Am J Hum Genet 1984;36(6):1341– 8. 27. Matikainen, T, Perez, GI, Jurisicova, A, Pru, JK, Schlezinger, JJ, Ryu, HY, et al. Aromatic hydrocarbon receptor-driven Bax gene expression is required for premature ovarian failure caused by biohazardous environmental chemicals. Nat Genet 2001;28(4):355– 60. 28. Conway, GS, Hettiarachchi, S, Murray, A, Jacobs, PA. Fragile X premutations in familial premature ovarian failure. Lancet 1995; 346(8970):309 –10. 29. Sala, C, Arrigo, G, Torri, G, Martinazzi, F, Riva, P, Larizza, L, et al. Eleven X chromosome breakpoints associated with premature ovarian failure (POF) map to a 15-Mb YAC contig spanning Xq21. Genomics 1997;40(1):123–31. 30. Powell, CM, Taggart, RT, Drumheller, TC, Wangsa, D, Qian, C, Nelson, LM, et al. Molecular and cytogenetic studies of an X autosome
1012
Chand et al.
Correspondence
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
translocation in a patient with premature ovarian failure and review of the literature. Am J Med Genet 1994;52(1):19 –26. Tharapel, AT, Anderson, KP, Simpson, JL, Martens, PR, Wilroy, RS Jr, Llerena, JC Jr, et al. Deletion (X)(q26.1-q28) in a proband and her mother: molecular characterization and phenotypic-karyotypic deductions. Am J Hum Genet 1993;52(3):463–71. Marozzi, A, Manfredini, E, Tibiletti, MG, Furlan, D, Villa, N, Vegetti, W, et al. Molecular definition of Xq common-deleted region in patients affected by premature ovarian failure. Human Genetics 2000;107(4): 304 –11. Bione, S, Sala, C, Manzini, C, Arrigo, G, Zuffardi, O, Banfi, S, et al. A human homologue of the Drosophila melanogaster diaphanous gene is disrupted in a patient with premature ovarian failure: evidence for conserved function in oogenesis and implications for human sterility. Am J Hum Genet 1998;62(3):533– 41. Roberts, RG, Kendall, E, Vetrie, D, Bobrow, M. Sequence and chromosomal location of a human homologue of LRPR1, an FSH primary response gene. Genomics 1996;37(1):122– 4. Jones, MH, Furlong, RA, Burkin, H, Chalmers, IJ, Brown, GM, Khwaja, O, et al. The Drosophila developmental gene fat facets has a human homologue in Xp11.4 which escapes X-inactivation and has related sequences on Yq11.2. Hum Mol Genet 1996;5(11):1695–701. Marozzi, A, Porta, C, Vegetti, W, Crosignani, PG, Tibiletti, MG, Dalpra, L, et al. Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure. Hum Reprod 2002;17(7): 1741–5. Dixit, H, Deendayal, M, Singh, L. Mutational analysis of the mature peptide region of inhibin genes in Indian women with ovarian failure. Hum Reprod 2004;19(8):1760 – 4. Aittomaki, K, Lucena, JL, Pakarinen, P, Sistonen, P, Tapanainen, J, Gromoll, J, et al. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 1995; 82(6):959 – 68. Beau, I, Touraine, P, Meduri, G, Gougeon, A, Desroches, A, Matuchansky, C, et al. A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. J Clin Invest 1998;102(7):1352–9. Touraine, P, Beau, I, Gougeon, A, Meduri, G, Desroches, A, Pichard, C, et al. New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype. Mol Endocrinol 1999;13(11):1844 –54. Takahashi, K, Ozaki, T, Kanasaki, H, Miyazaki, K. Successful pregnancy in a woman with ovarian failure associated with mutation in the beta-subunit of luteinizing hormone. Horm Res 2001;55(5):258 – 63. Latronico, AC, Anasti, J, Arnhold, IJ, Mendonca, BB, Domenice, S, Albano, MC, et al. A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty. J Clin Endocrinol Metab 1995;80(8):2490 – 4. Misrahi, M, Meduri, G, Pissard, S, Bouvattier, C, Beau, I, Loosfelt, H, et al. Comparison of immunocytochemical and molecular features with the phenotype in a case of incomplete male pseudohermaphroditism associated with a mutation of the luteinizing hormone receptor. J Clin Endocrinol Metab 1997;82(7):2159 – 65. Toledo, SP, Brunner, HG, Kraaij, R, Post, M, Dahia, PL, Hayashida, CY, et al. An inactivating mutation of the luteinizing hormone receptor causes amenorrhea in a 46,XX female. J Clin Endocrinol Metab 1996; 81(11):3850 – 4. Harris, SE, Chand, AL, Winship, IM, Gersak, K, Aittomaki, K, Shelling, AN. Identification of novel mutations in FOXL2 associated with premature ovarian failure. Mol Hum Reprod 2002;8(8):729 –33. Vegetti, W, Grazia Tibiletti, M, Testa, G, de Lauretis, Y, Alagna, F, Castoldi, E, et al. Inheritance in idiopathic premature ovarian failure: analysis of 71 cases. Human Reproduction 1998;13(7):1796 – 800.
Vol. 86, No. 4, October 2006