Polymorphism of fecundity genes (BMPR1B, BMP15 and GDF9) in the Indian prolific Black Bengal goat

Small Ruminant Research 85 (2009) 122–129

Contents lists available at ScienceDirect

Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres

Polymorphism of fecundity genes (BMPR1B, BMP15 and GDF9) in the Indian prolific Black Bengal goat Shamik Polley a , Sachinandan De a,∗ , Subhasis Batabyal b , Ramakant Kaushik a , Paras Yadav a , Jaspreet Singh Arora a , Saibal Chattopadhyay b , Subhransu Pan c , Biswajit Brahma d , Tirtha Kumar Datta a , Surender Lal Goswami a a

Animal Biotechnology Centre, National Dairy Research Institute, Karnal, Haryana 132001, India Department of Veterinary Biochemistry, West Bengal University of Animal and Fishery Sciences, 68, Kshudiram Bose Sarani, Belgachia, Kolkata, West Bengal 700 037, India c Department of Animal Production and Management, West Bengal University of Animal and Fishery Sciences, 68, Kshudiram Bose Sarani, Belgachia, Kolkata, West Bengal 700 037, India d KVK, SKUAST-J, Bhaderwah, Jammu and Kashmir 182221, India b

a r t i c l e

i n f o

Article history: Received 19 February 2009 Received in revised form 8 July 2009 Accepted 20 August 2009 Available online 18 September 2009 Keywords: Black Bengal goat Prolificacy BMPR1B GDF9 BMP15

a b s t r a c t The Black Bengal is a prolific goat breed in India. Natural mutations in prolific sheep breeds have shown that the transforming growth factor beta (TGF-␤) super family ligands such as growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15) and their type I receptor (bone morphogenetic protein receptor, BMPR1B) are crucial for ovulation and as well as for increasing litter size. Mutations in any of these genes increased prolificacy in sheep. Based on the known mutation information in sheep PCR primers were designed to screen known polymorphism in 88 random Black Bengal goats. Only the BMPR1B gene was polymorphic. Three genotypes of animals were detected in tested animals with mutant (FecBB ) and wild type (FecB+ ) alleles were 0.57 and 0.43, respectively. Non-carrier, heterozygous carrier and homozygous carrier Black Bengal does had 2.7, 3.04 and 3.11 kids, respectively. All known point mutations of BMP15 and GDF9 genes were monomorphic in the animals tested. These results preliminarily showed that the BMPR1B gene might be a major gene that influences prolificacy of Black Bengal goats. © 2009 Elsevier B.V. All rights reserved.

1. Introduction In mammals the ovulation rate and the litter size is a result of well regulated interactions of endocrine and paracrine mediators. How precisely the litter size is controlled remains a critical and important question in reproductive biology. The tendency of twining and triplicate is common in both sheep and goat. Extensive research has been carried out on different prolific sheep breeds to identify the genes involved in controlling ovulation rate

∗ Corresponding author. Tel.: +91 184 2259503; fax: +91 184 2250042. E-mail addresses: [email protected], [email protected] (S. De). 0921-4488/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2009.08.004

and prolificacy. Three fecundity genes have been identified in sheep, namely bone morphogenetic protein receptor type 1B (BMPR1B; or activin-like kinase 6, ALK6), known as FecB on chromosome 6 (Souza et al., 2001); growth differentiation factor 9 (GDF9), known as FecG on chromosome 5 (Hanrahan et al., 2004); and bone morphogenetic protein 15 (BMP15) known as FecX on chromosome X (Hanrahan et al., 2004; Galloway et al., 2000). Some specific mutations found on these genes have been shown to be associated with different phenotypic effects: the FecB (Booroola) mutated allele was associated with an additive effect on ovulation rate (Souza et al., 2001), the FecGH mutation in GDF9 gene and FecX (five specific point) mutations led to increased ovulation rates in heterozygous animals and sterility in homozygous mutant animals (Hanrahan et

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

al., 2004; Bodin et al., 2007). All these Fec genes belong to the transforming growth factor beta (TGF-␤) superfamily (Fabre et al., 2006). The FecB locus is situated in the region of ovine chromosome 6 corresponding to the human chromosome 4q22-23 (Montgomery et al., 1993) that contains the bone morphogenetic protein receptor 1B (BMPR1B) gene. The A to G transition at nucleotide position 746 of the cDNA sequence induces a nonsynonymous substitution of glutamine with an arginine corresponding to position 249 of the mature protein (Q249R, Souza et al., 2001; Wilson et al., 2001; Mulsant et al., 2001). Based on the segregation of the ovulation rate in Merino and Romney flocks, the genotypes in the ewes have been classified as homozygous noncarrier (FecB+ /FecB+ ) with an ovulation rate of 2 or less, heterozygous carriers (FecBB /FecB+ ) with ovulation rate of 3–4 and homozygous carriers (FecBB /FecBB ) with more than five ovulations per estrous cycle (Davis et al., 1982). This increased ovulation rate of FecBB carriers associated with a precocious maturation of a large number of antral follicles that ovulate at a smaller size than non-carrier follicles (McNatty et al., 1986). GDF9 was the first identified to be an oocyte-derived growth factor required for ovarian somatic cell function. Changing concentrations of GDF9 in vivo leads to incremental changes in ovulation rate in sheep (Galloway et al., 2000; Juengel et al., 2004; Hanrahan et al., 2004). The FecGH mutation leads to the substitution of a serine with a phenylalanine at position 77 of the mature GDF9 peptide (S77F, Hanrahan et al., 2004). A close homolog of GDF9 was discovered 5 years after the discovery of GDF9 subsequently by two research groups. This growth factor was named GDF9B (or BMP15), and it is also expressed in the oocyte from the primary follicle stage continuing through ovulation (Dube et al., 1998). Heterozygous ewe carriers of the FecGH (high fertility), FecXI (Inverdale), FecXH (Hanna), FecXB (Belclare), FecXL (Lacaune) or FecXG (Galway) alleles exhibit one to two additional ovulations, compared with non-carriers, whereas homozygous mutant ewes are sterile, and have small, flattened streak ovaries containing only follicles that do not develop up to the primary (type 2) stage (Hanrahan et al., 2004; Galloway et al., 2000; McNatty et al., 2005; Bodin et al., 2007). The genetic basis of caprine prolificacy remains to be explored. Recent studies on prolific goat breeds like Boer, Haimen, Huanghuai, Nubi, Matou and Jining Grey, suggested that higher prolificacy in goat is not like that of sheep (Chu et al., 2007; Hua et al., 2008). The known point mutations of BMPR1B (FecB) and BMP15 (Fec XH , Fec XI , Fec XG and Fec XB ) genes are monomorphic in the prolific goat breeds (Hua et al., 2008). Two new point mutations in the BMP15 gene either linked with higher prolificacy in the Jining Grey goat or BMP15 gene is a major gene that influences prolificacy in this breed (Chu et al., 2007). The Black Bengal goat is the heritage and pride of eastern India and Bangladesh. It is a prolific and major meat producing animal in West Bengal along with the adjoining part of the Jharkhand, Orissa, Bihar, Tripura states of India (Zeshmarani et al., 2007). This breed is also available in almost all villages of Bangladesh (Rahman et al., 2006). They kid twice a year

123

Fig. 1. Diagrammatic representation of SNP identification using tetraprimer ARMS–PCR. Four primers are used: the two outer primers amplify a fragment of the gene that contains an SNP (white dot). The inner primers are allele-specific. One inner primer will amplify the X allele and the other the Y allele. By positioning the two outer primers at different distances from the polymorphic point, the allele-specific amplicons differ in length, allowing them to be discriminated by agarose gel electrophoresis.

or more commonly thrice in 2 years (Zeshmarani et al., 2007) and the number of kids at one time varies from single to quadruplet. Twinning is more frequent (56.32%) and quadruplet is the least frequent (2.11%) litter size (Hassan et al., 2007). The natural breeding tract of the Black Bengal goat and well known prolific Garole sheep is located in this region. Therefore, the present investigation was designed to study the known polymorphic points of three important fecundity genes in Black Bengal goats. 2. Materials and methods 2.1. Experimental animals and DNA isolation A total of 88 Black Bengal goats were genotyped in this study. Goats were obtained from different villages of West Bengal, India. About 10 ml of blood sample was collected from the jugular vein. The collected samples were transported to the laboratory at 4 ◦ C before DNA isolation. The DNA was isolated as per the procedure described by Sambrook and Russell (2001). 2.2. Primer designing A simple tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) for screening of polymorphism of two ovine fecundity genes, GDF9 and BMP15 was designed following methodology described by Ye et al. (2001) (Table 1). This technique adopts certain principles of the tetra-primer PCR method and the amplification refractory mutation system (ARMS, Newton et al., 1989). T-ARMS-PCR amplifies both wild type and mutant alleles, together with a control fragment, in a single tube PCR reaction. The region flanking the mutation is amplified by two common (outer) primers, producing a non-allele specific control amplicon. Two allele-specific (inner) primers are designed in opposite orientation and in combination with the common (outer) primers they can simultaneously amplify both the wild type and the mutant amplicons (Fig. 1). Both inner primers provided with a deliberate mismatch at position −2 from the 3 terminus to increase the specificity of classical T-ARMS-PCR (Newton et al., 1989; Little, 1997). Allele specific amplicons have different product lengths and can be easily separated by standard agarose gel electrophoresis because the mutation point is asymmetrically located with respect to the common (outer) primers. Two sets of allele specific primers were designed to detect FecB point mutations based on ovine BMPR1B gene (Table 2). 2.3. PCR amplification and gel electrophoresis PCR reaction was performed in a 25 ␮l reaction volume containing 2.5 ␮l of Thermophilic DNA polymerase 10× buffer (10 mM Tris–HCl (pH 9.0 at 25 ◦ C), 50 mM KCl and 0.1% Triton X-100), 200 ␮M of dNTPs, 25 mM MgCl2 , 10 pmol of each primer and 0.5 units of Taq DNA polymerase (Promega Corporation, Madison, WI, USA). About 50–100 ng

124

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

Table 1 Primer sequences for T-ARMS-PCR based amplification of GDF9 and BMP15 gene mutation points. The primer pairs, expected product size and PCR parameters used for amplification of GDF9 and BMP15 gene mutation points. Primers are designed based on ovine GDF9 (AF078545 ) and BMP15 (AH009593) gene with respective positions mentioned before and after the oligonucleotide sequences. Gene

Mut

Primera

Primers sequence (5 → 3 )

Product sizeb (bp)

Annealing conditionc

GDF9 (AF078545)

G1

IF(A) IR(G) OF OR IF(G) IR(A) OF OR IF(A) IR(G) OF OR IF(G) IR(A) OF OR IF (T) IR(C) OF OR

334 CTGCAGCCAGATGACAGAGCTTTTCA 359 388 CGTATGCCTTATAGAGCCTCTTCATGTCGC 359 168 GCCTGGCTCTGTTTTCCTATTAGCCTTG 188 537 TCTTCTTCCCTCCACCCATTAACCAATC 510 296 TTCACATGTCTGTAAATTTTACATGTGAGG 325 350 GCTGAAGGATGCTGCAGCTGGTCGTT 325 90 CAACAACTCCATTTCTTTTCCCTTTCCTG 118 506 TAGGCAGATAGCCCTCTC TTCTGGTCAG 479 573 CAGCTCTGAATTGAAGAAGCCTCGGA 598 625 ATTCACTCAGATTGACTGAAGCTGGCAC 598 403 TATCTGAACGACACAAGTGCTCAGGCTT 430 764 CTGGGACAGTCCCCTTTACAGTATCGAG 737 688 AGTCAGCTGAAGTGGGACAACTGGAGTG 715 742 ATCGAGGGTTGTATTTGTGTGGGGCAAT 715 556 AGAGACCAGGAGAGTGCCAGCTCTGAAT 583 898 CGATGGCCAAAACACTCAAAGGGCTATA 871 763 AGGGCGGTCGGACATCGGTATGGATT 788 817 TGATGTTCTGCACCATGGTGTGAACCGTAG 788 710 GGATTGTGGCCCCACACAAATACAACCC 737 907 CATCAGGCTCGATGGCCAAAACACTCAA 880

Mut 205 WT 247 Co. 396

55 ◦ C(32 cycles for 30 s)

Mut 212 WT 261 Co. 417

50 ◦ C (32 cycles for 30 s)

Mut 193 WT 223 Co. 362

52 ◦ C (32 cycles for 30 s)

Mut 187 WT 212 Co. 343

50 ◦ C (32 cycles for 30 s)

Mut 146 WT 108 Co. 198

55 ◦ C (32 cycles for 30 s)

IF (C) IR(T) OF OR IF (C) IR(T) OF OR IF(A) IR(T) OF OR IF(A) IR(G) OF OR IF(G) IR(T) OF OR

363 CTTCTTGTTACTGTATTTCAATGACAATC 391 417 GAGAGGTTTGGTCTTCTGAACACTATA 391 306 AAGAGGTAGTGAGGTTCTTGAGTTCT 331 463 AGAGAAGAGAAGGGTCTTTTTCTGTA 438 519 GGAGCATGATGGGCCTGAAAGTACCC 544 573 GCTGACTTGAAAAGGGTGGAGGGAACAATA 544 326 AGTTCTGGTGGCATGGCACTTCATCATT 353 720 CACCAGCTCACTGACAAGGTTCTGGATG 693 541 AACCAGTGTTCCCTCCACCCTTTTCATGA 569 594 ATCCCAGCCCAGCTGCTGGAAGCAGA 569 334 TGGCATGGCACTTCATCATTGGACACTG 361 751 GGACACAGGAAGGCTGAGGGACATTCTGA 723 606 TGCTCCCCATCTCTATACCCCAAACTAATA 635 662 TGTAGTACCCGAGGACATACTCCCTGAC 635 411 ACCTCTCCCTAAAGGCCTGAAAGAGTTT 438 808 ACAAGATACTCCCATTTGCCTCAATCAG 781 743 CCTTATAAGTATGTTCCCATGAG 773 800 CTCCCATTTGCCTCAATCAGAAGGACGA 773 561 TTTTCAAGTCAGCTTCCAGCAGCTGGGC 588 868 TGCACCTTTGCCGTCACCTGCATGTG 843

Mut 112 WT 102 Co. 158

48 ◦ C (32 cycles for 30 s)

Mut 248 WT 203 Co. 395

56 ◦ C (32 cycles for 40 s)

Mut 212 WT 261 Co. 418

55 ◦ C (32 cycles for 45 s)

Mut 204 WT 252 Co. 398

52 ◦ C (32 cycles for 35 s)

Mut 240 WT 126 Co. 308

52 ◦ C (32 cycles for 40 s)

G4

G6

G7

G8

BMP15 (AH009593)

Fec XG

Fec XH

Fec XI

Fec XL

Fec XB

a F, indicates forward; R, indicates reverse; O, indicates outer (common); I, indicates inner (allele specific). The nucleotide specificity is indicated in parentheses. b Mut, indicates size of mutant fragment; WT, indicates size of wild type fragment; Co., indicates size of control fragment. c Cycling conditions are 4 min at 94 ◦ C, followed by 32 cycles of 94 ◦ C for 30 s, annealing temperature (Ta ) as given above,72 ◦ C at 30 s, and a final cycle 72 ◦ C for 6 min.

of genomic DNA was used as template. The PCR cycling parameters were optimized separately for detecting each of the allele specific amplifications (Tables 1 and 2). The PCR products were separated by horizontal submarine agarose gel (2%, free from DNAse and RNAse) electrophoresis in 1× TAE buffer at 80 V. The gel was stained with ethidium bromide solution (0.5 ␮g/ml) and maintained for 10 min in darkness and photographed using a molecular imager (Gel Doc XR, BIORAD).

2.4. Sequencing PCR products of two different BMPR1B homozygous genotypes were sequenced. The PCR product was amplified from genomic DNA using FecB mutant forward and FecB+ reverse primer as described in Table 2. The PCR products were purified by Qiaquick PCR purification kit (Qiagen GmbH, Hilden, Germany) and were sequenced using FecB mutant forward primer (Nucleotide position 1–27 in “AF312016” GenBank nucleotide sequence

Table 2 Oligonucleotide sequences for allele specific amplification of BMPR1B gene by PCR. The primer pairs, expected size and touchdown PCR parameters used for amplification of BMPR1B gene. The primers were designed based on ovine genomic DNA sequence (AF312016 ) with respective positions mentioned before and after the oligonucleotide sequences. Gene

Mutation

Primers

Product size (bp)

PCR parameters

BMPR1B (AF312016)

FecB + FecB mutant

Forward 82 GCTGGTTCCGAGAGACAGAAATATATCA 109 Reverse 1178 CCCCGTCCCTTTGATATCTGCAGCAATG 1151 Forward 1 GTCGCTATGGGGAAGTTTGGATGGGAA 27 Reverse 136 ATGTTTTCATGCCTCATCAACACCGTCC 109

1110

Touchdown from 60 ◦ C to 52 ◦ C then at 52 ◦ C (30 cycles for 40 s) Touchdown from 70 ◦ C to 65 ◦ C then at 65 ◦ C (30 cycles for 45 s)

136

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

125

Fig. 2. (A) Agarose gel electrophoresis (2%) of allele specific FecB (BMPR1B) PCR product. Lanes 1–7: amplification of wild type (W = 1100 bp product), or mutant (M = 136 bp product) and both in Black Bengal goat genomic DNA. Lane L: DNA molecular weight marker (O’RangeRular 100 bp DNA Ladder, Fermentus, Lithuania). N: PCR without genomic DNA (Template negative control). Lanes 3–5: Heterozygous having both, W and M allele. (B) and (C) Nucleotide sequence chromatogram representing genotype of FecB+ (wild type, A nucleotide) and FecB (mutant, G nucleotide), respectively. The changed nucleotides are represented by vertical arrows. data) in an automated ABI 377 sequencer (PerkinElmer Applied Biosystem, Foster city, CA, USA) by Bangalore Genei Privet limited (Bangalore, India). Three different PCR products were sequenced in each genotype to validate our allele specific PCR results. The nucleotide sequence data was edited and analysed by BioEdit v7.0.9 (Hall, 1999).

that amplification fragment sizes were consistent with the expected size as determined from their gene sequence information. 3.1. BMPR1B gene

3. Results A total of eleven point mutations of three important candidate genes, five each in GDF9 and BMP15 and one point mutation in BMPR1B, were genotyped by tetraprimer and allele specific primer based PCR methodology. A touchdown programme (e.g. the annealing temperature decreases by 1 ◦ C per cycle for the first few cycles, and then remains fixed at a particular temperature for the remaining cycles) was found optimum for detecting the point mutation in the BMPR1B gene. The PCR products were analysed in 2% agarose gel electrophoresis. The results showed

The BMPR1B gene had two alleles, the ‘A’ wild type nucleotide (non-carrier) and the ‘G’ FecB mutant nucleotide (carrier). All three possible genotypes were observed (AA, AG and GG) in Black Bengal goats. Only the 1100 bp product was observed in homozygous ‘A’ (wild type noncarrier) goats and only the 136 bp amplification product was observed in homozygous ‘G’ or FecB (mutant carrier) goats. However, in heterozygous animals both the 1100 bp and 136 bp products were amplified (Fig. 2A). The presence of the ‘A’ nucleotide in wild type animals codes for glutamine amino acid but presence of ‘G’ replaces this amino acid with arginine. The genotypic and allelic frequencies at

126

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

Table 3 (A) Allelic and genotype frequencies of Black Bengal goat for BMPR1B locus (FecB). (B) Average litter size of different BMPR1B genotypes in Black Bengal doe. A Gene

BMPR1B

B No of animal

88

Allele frequency

Genotype frequency

A

G

AA

AG

GG

0.43

0.57

0.11 (10)

0.64 (56)

0.25 (22)

BMPR1B locus in Black Bengal goats were calculated and presented in Table 3A. The heterozygous genotype AG was found to be the predominant genotype in the Black Bengal goats tested. Frequencies of AA, AG and GG genotypes were 0.11, 0.64 and 0.25, respectively. The allelic frequencies for A and G alleles were 0.43 and 0.57, respectively. It indicated the abundance of mutant type (G) nucleotide in Black Bengal goats in which non-carriers, heterozygous carrier and homozygous carrier does had 2.7, 3.04 and 3.11 kids, respectively (Table 3B).

3.2. BMP15 Five point mutations (Q239Pro Ter, Q23Ter, V31D, C53Y and S99I, as mentioned in Fig. 1, supplementary) in BMP15 were typed by tetra-primer ARMS-PCR. All these polymorphic points were found to have the wild type pattern (Fig. 3A–E). A similar pattern was observed in case of 50 random cattle and sheep (Garole) genomic DNA (data not included). These wild type alleles differ in the C, C, T, G and G

Genotype

No of does

Average litter size

GG AG AA

17 44 7

3.11 3.04 2.7

nucleotides representing the glutamine, glutamine, valine, cysteine and serine amino acids, respectively (Table 4). 3.3. GDF9 gene Five point mutations viz, G1, G4, G6, G7 and G8 (as mentioned in supplementary material Fig. 2) have been analysed by a similar tetra-primer based ARMS-PCR. All Black Bengal goats tested had only the wild type genotype as indicated in Fig. 3(F–J). GDF9 wild type alleles had G, A, G, G and C nucleotides at the G1, G4, G6, G7 and G8 locations corresponding to the arginine, glutamic acid, valine, valine and serine amino acids, respectively (Table 4). All 88 animals had the wild type homozygote for GDF9 and BMP15 gene. These Black Bengal goats were polymorphic only for the BMPR1B gene (FecB locus). 4. Discussion In small ruminant species, particularly in sheep, the genetics of litter size is well documented. In sheep the

Fig. 3. Agarose gel electrophoresis (2%) of PCR product of tetra-primer ARMS-PCR. Lanes 1–6: amplification of common outer product and allele specific inner product. The size of common outer product and allele specific inner product are indicated by the arrow on the right side of the respective gel photograph. Lane M: DNA molecular weight marker (O’RangeRular 100 bp DNA Ladder, Fermentus, Lithuania). Lane N: PCR without genomic DNA (Template negative control). A–E are gel photographs of PCR products for Fec XG , Fec XH , Fec XI , Fec XL , Fec XB mutation points of BMP15 gene, respectively. F–J are gel photographs of PCR products for G1, G4, G6, G7 and G8 mutation points of GDF9 gene, respectively.

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

127

Table 4 Identified major genes affecting ovulation rate in sheep. Allele (name)

Mutation DNA

Mutations

Founder breed

Reference

BMPR1B (6)

FecBB (Booroola)

A746G

Q249R

Merino, Garole, Javanese, Hu, Han

Wilson et al. (2001); Davis et al. (2002)

BMP15 (X)

FecXG (Galway) FecXH (Hanna) FecXI (Inverdale) FecXL (Lacaune) FecXB (Belclare)

C391T C544T T579A G635A G773T

Q239Ter Q23stop V31D C53Y S99I

Belclare, Cambridge Romney Romney Lacaune Belclare

Hanrahan et al. (2004) Galloway et al. (2000) Galloway et al. (2000) Bodin et al. (2007) Hanrahan et al. (2004)

GDF9 (5)

G1 G4 G6 G7 G8 (FecGH ) (high fertility)

G359A A325G G598A G715A C788T

R87H E241K V332I V371M S395F

Belclare, Cambridge

Hanrahan et al. (2004)

important prolificacy genes are BMPR1B, GDF9 and BMP15 (Table 4; Souza et al., 2001; Hanrahan et al., 2004; Galloway et al., 2000; Fabre et al., 2006; Bodin et al., 2002; Monteagudo et al., 2009). BMPR1B is located in chromosome 6 and a single nonsynonymous mutation (FecB, Q249R) increases the ovulation rate. The litter size and ovulation rate increase with number of copies of the mutation (Fabre et al., 2006). A mutated BMPR1B gene increases ovulation rate and litter size in sheep without increasing its expression level (Mulsant et al., 2001; Souza et al., 2001; Wilson et al., 2001; Yi et al., 2001). This hyperprolific phenotype was reported first time in Booroola sheep. Moreover, this FecB mutation was found to have no effect on circulating serum FSH (follicular stimulating hormone) concentration and FSH beta transcript number and size variation in pituitary messenger RNA preparations (Souza et al., 1997). In sheep, the mechanism of increased ovulation in either BMP15 or GDF9 mutant is likely to be similar. In heterozygous mutant ewes, the altered proteins result in increased sensitivity of granulosa cells to FSH, which would lead to accelerated follicular development and precocious ovulation of small follicles (Moore et al., 2004; Moore and Shimasaki, 2005). Ovulation rates in GDF9 and BMP15 mutants are high in the heterozygotes while the homozygous mutants show a primary ovarian failure resulting in complete sterility (Galloway et al., 2000; Hanrahan et al., 2004; Bodin et al., 2007; Monteagudo et al., 2009). In ewes with simultaneous mutations in GDF9 and BMP15 had higher ovulation rates than those with either mutation separately (Arnyasi et al., 2004). A specific point mutation in GDF9 gene (FecGH ) causes an amino acid substitution (S77F) and leads to increased prolificacy in Belclare and Cambridge sheep (Hanrahan et al., 2004). The BMP15 is located on the X chromosome and five point mutations and one deletion are known to increase the prolificacy in various sheep breeds. These mutations include nonsynonymous amino acid substitution (FecXI , FecXB and FecXL ), premature stop codons (FecXG , FecXH ) and a 17 bp deletion (Monteagudo et al., 2009) of the reading frame of the functional gene. The increased prolificacy in six goat breeds (Boer, Haimen, Huanghuai, Nubi, Matou and Jining Grey) were not associated with any known point mutations in either BMPR1B or BMP15 gene (Chu et al., 2007; Hua et al., 2008). On the other hand goat with low fecundity (Yun-

ling Black goat) was not related to any point mutations in these two genes (BMPR1B and BMP15; Cui et al., 2009). There is no report available on polymorphic status of GDF9 gene in goats. The Black Bengal goat, the only goat breed of India having high prolificacy (Mason, 1996), varies from twin to quadruplet offspring (Hassan et al., 2007). This breed is a major meat producing animal in eastern India, Bangladesh and other south East Asian countries (Acharya, 1982). In the present study the Black Bengal goats were genotyped for three well documented prolificacy genes namely, BMPR1B, BMP15 and GDF9, and were reported in all eleven SNPs (one in BMPR1B, five each in BMP15 and GDF9). Only the FecB (BMPR1B) gene was polymorphic. SNP genotyping techniques rely on amplification of the target DNA by PCR, but differ in the means of discriminating between the different alleles, involving significant post-PCR manipulations. For example the restriction fragment length polymorphism (RFLP) typing method involves restriction endonuclease digestion of PCR products. Allele specific oligonucleotide (ASO) melting, another widely used SNP typing technique, involves lengthy blotting and hybridisation procedures. The tetra-primer ARMS-PCR method described here circumvents much handling of PCR product. Primers were designed to amplify fragments of differing sizes for each allele band in order to resolve them in agarose gel electrophoresis. It is a simple, rapid and economical method for SNP scoring and very useful tool for large-scale SNP analysis (Ye et al., 2001). The FecB mutation is present in the Booroola Merino (Australia; Souza et al., 2001), Garole (India; Davis et al., 2002), Javanese (Indonesia; Davis et al., 2002), Small Tailed Han (China; Davis et al., 2006) and Hu sheep (China; Davis et al., 2006). There are no reports of FecB polymorphism in any goat breed until now. The Belclare/Cambridge sheep (GDF9 and BMP15; Hanrahan et al., 2004), the Lacaune sheep (FecL and BMP15; Bodin et al., 2002) and Small Tailed Han sheep (BMPR1B and BMP15; Chu et al., 2007) are the sheep breed where mutations in two different genes have been detected. Chu et al. (2007) reported that the BMP15 gene is either a major gene that influences the prolificacy of the Jining Grey goat or a molecular genetic marker in close linkage with such a gene. None of the known polymorphism of GDF9 gene (G1, G4, G6, G7 and G8 or FecGH ) and

128

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129

BMP15 gene (FecXG , FecXH , FecXI , FecXL and FecXB ) which are fecundity genes in sheep is found in the tested Black Bengal goats. These results preliminarily showed that the BMPR1B gene might be a major gene that influences prolificacy of Black Bengal goats. However, some new point mutations in these three genes or other candidate genes might control the litter size in the Black Bengal goats. 5. Conclusion In conclusion, we can state that in Black Bengal goats the BMP1B gene was polymorphic. None of the known polymorphism of ovine fecundity major genes in GDF9 and BMP15 was found in tested Black Bengal goats. However, our study tested only a small number of animals presenting this feature and further investigation is required to confirm the link with increased prolificacy in Black Bengal goats. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.smallrumres. 2009.08.004. References Acharya, R.M., 1982. Sheep and Goat Breed of India. FAO Animal Production and Health Paper 30. FAO, United Nations, Rome, pp. 1–190. Arnyasi, M., Zsolnai, A., Komlosi, I., Fesus, L., Javor, A., 2004. Case study of a Hungarian breeding program using imported Booroola rams. Arch. Tierz., Dummerstorf 47 (4), 359–366. Bodin, L., Di Pasquale, E., Fabre, S., Bontoux, M., Monget, P., Ersani, L., Mulsant, P., 2007. A novel mutation in the bone morphogenetic protein 15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology 148 (1), 393–400. Bodin, L., SanCristobal, M., Lecerf, F., Mulsant, P., Bibe, B., Lajous, D., Belloc, J.P., Eychenne, F., Amigues, Y., Elsen, J.M., 2002. Segregation of a major gene influencing ovulation in progeny of Lacaune meat sheep. Genet. Sel. Evol. 34, 447–464. Chu, M.X., Jiao, C.L., He, Y.Q., Wang, J.Y., Liu, Z.H., Chen, G.H., 2007. Association between PCR-SSCP of bone morphogenetic protein 15 gene and prolificacy in Jining Grey goats. Anim. Biotechnol. 18, 263–274. Cui, H.X., Zhao, S.M., Cheng, M.L., Guo, L., Ye, R.Q., Liu, W.Q., Gao, S.Z., 2009. Cloning and expression levels of genes relating to the ovulation rate of the Yunling black goat. Biol. Reprod. 80 (2), 219–226. Davis, G.H., Balkrishnan, L., Ross, I.K., Wilson, T., Galloway, S.M., Lumsden, B.M., Hanrahan, J.P., Mullen, M., Mao, X.Z., Wang, G.L., Zhao, Z.S., Zeng, Y.Q., Robinson, J.J., Mavrogenis, A.P., Papachristoforou, C., Peter, C., Baumung, R., Cardyn, Baujenane, I., Cockett, N.E., Eythorsdottir, E., Arranz, J.J., Notter, D.R., 2006. Investigation of the Booroola (Fec B) and Inverdale (Fec X I) mutation in 21 prolific breeds and strains of sheep samples in 13 countries. Anim. Reprod. Sci. 92, 87–96. Davis, G.H., Galloway, S.M., Ross, I.K., Gregan, S.M., Ward, J., Nimbkar, B.V., Ghalsasi, P.M., Nimbkar, C., Gray, G.D., Subandriyo, Inounu, I., Tiesnamurti, B., Martyniuk, E., Eythorsdottir, E., Mulsant, P., Lecerf, F., James, P., Hanrahan, Bradford, G.E., Wilson, T., 2002. DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation. Biol. Reprod. 66, 1869–1874. Davis, G.H., Montgomery, G.W., Allison, A.J., Kelly, R.W., Bray, A.R., 1982. Segregation of a major gene influencing fecundity in progeny of Booroola sheep. N. Z. J. Agric. Res. 25, 525–529. Dube, J.L., Wang, P., Elvin, J., Lyons, K.M., Celeste, A.J., Matzuk, M.M., 1998. The bone morphogenetic protein 15 gene is X-linked and expressed in oocytes. Mol. Endocrinol. 12, 1809–1817. Fabre, S., Pierre, A., Mulsant, P., Bodin, L., DiPasquale, E., Persani, L., Monget, P., Monniaux, D., 2006. Regulation of ovulation rate in mammals: contribution of sheep genetic models. Reprod. Biol. Endocrinol. 4, 20.

Galloway, S.M., McNatty, K.P., Cambridge, L.M., Laitinen, M.P., Jennifer, J.L., Jokiranta, S., McLaren, R.J., Luiro, K., Dodds, K.G., Montgomery, G.W., Beattie, A.E., Davis, G.H., Ritvos, O., 2000. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 25 (3), 279–283. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95–98. Hanrahan, P.J., Gregan, S.M., Mulsant, P., Mullen, M., Davis, G.H., Powell, R., Galloway, S.M., 2004. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in cambridge and belclare sheep (Ovis aries). Biol. Reprod. 70 (4), 900–909. Hassan, M.M., NiazMahmud, S.M., Azizul Islam, S.K.M., Faruk Miazi, O., 2007. A comparative study on reproductive performance and productivity of the Black Bengal and Crossbred goat at Atrai, Bangladesh. Univ. J. Zool. Rajshahi Univ. 26, 55–57. Hua, G.H., Chen, S.L., Ai, J.T., Yang, L.G., 2008. None of the polymorphism of ovine fecundity major genes FecB and FecX was tested in goat. Anim. Reprod. Sci. 108, 279–286. Juengel, J.L., Hudson, N.L., Whiting, L., McNatty, K.P., 2004. Effects of immunization against bone morphogenetic protein 15 and growth differentiation factor 9 on ovulation rate, fertilization, and pregnancy in ewes. Biol. Reprod. 70, 557–561. Little, S., 1997. ARMS analysis of point mutations. In: Taylor, G.R. (Ed.), Laboratory Methods for the Detection of Mutations and Polymorphisms in DNA. CRC Press, Boca Raton, FL, pp. 45–51. Mason, I.L., 1996. A World Dictionary of Livestock Breeds. Types and Varieties, fourth ed. C.A.B. International, 273 pp. McNatty, K.P., Juengel, J.L., Reader, K.L., Lun, S., Myllymaa, S., Lawrence, S.B., Western, A., Meerasahib, M.F., Mottershead, D.G., Groome, N.P., Ritvos, O., Laitinen, M.P., 2005. Bone morphogenetic protein 15 and growth differentiation factor 9 cooperate to regulate granulosa cell function. Reproduction 129 (4), 473–480. McNatty, K.P., Lun, S., Heath, D.A., Ball, K., Smith, P., Hudson, N.L., McDiarmid, J., Gibb, M., Henderson, K.M., 1986. Differences in ovarian activity between Booroola Merino ewes which were homozygous, heterozygous and non-carriers of a major gene influencing their ovulation rate. J. Reprod. Fertil. 77, 193–205. Monteagudo, L.V., Ponz, R., Tejedor, M.T., Lavina, A., Sierra, I., 2009. A 17 bp deletion in the Bone Morphogenetic Protein 15 (BMP15) gene is associated to increased prolificacy in the Rasa Aragonesa sheep breed. Anim. Reprod. Sci. 110, 139–146. Montgomery, G.W., Crawford, A.M., Penty, J.M., Dodds, K.G., Ede, A.J., Henry, H.M., Pierson, C.A., Lord, E.A., Galloway, S.M., Schmack, A.E., Sise, J.A., Swarbrick, P.A., Hanrahan, V., Buchanan, F.C., Hill, D.F., 1993. The ovine Booroola fecundity gene (FecB) is linked to markers from a region of human chromosome 4q. Nat. Genet. 4, 410–414. Moore, R.K., Erickson, G.F., Shimasaki, S., 2004. Are BMP-15 and GDF9 primary determinants of ovulation quota in mammals? Trends Endocrinol. Metab. 15 (8), 356–361. Moore, R.K., Shimasaki, S., 2005. Molecular biology and physiological role of the oocyte factor. BMP-15. Mol. Cell. Endocrinol. 234 (1–2), 67–73. Mulsant, P., Lecerf, F., Fabre, S., Schibler, L., Monget, P., Lanneluc, I., Pisselet, C., Riquet, J., Monniaux, D., Callebaut, I., Cribiu, E., Thimonier, J., Teyssier, J., Bodin, L., Cognie, Y., Elsen, J.M., 2001. Mutation in bone morphogenetic protein receptor-1B is associated with increased ovulation rate in Booroola Merino ewes. Proc. Natl. Acad. Sci. U.S.A. 98, 5104–5109. Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.G., Markham, A.F., 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503–2516. Rahman, M.A., Rahman, S.M.M., Jalil, M.A., Nasir Uddin, S., Rahman, M.M., 2006. Molecular characterization of black Bengal and jamuna pari goat breeds by RAPD markers. Am. J. Anim. Vet. Sci. 1 (2), 17–22. Sambrook, J., Russell, D., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Souza, C.J., Campbell, B.K., Webb, R., Baird, D.T., 1997. Secretion of inhibin A and follicular dynamics throughout the estrous cycle in the sheep with or without the Booroola gene (Fec B). Endocrinology 138, 5333–5340. Souza, C.J., MacDougall, C., Campbell, B.K., McNeilly, A.S., Baird, D.T., 2001. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endocrinol. 169, R1–R6. Wilson, T., Wu, X.Y., Juengel, J.L., Ross, I.K., Lumsden, J.M., Lord, E.A., Dodds, K.G., Walling, G.A., McEwan, J.C., O’Connell, A.R., McNatty, K.P., Mont-

S. Polley et al. / Small Ruminant Research 85 (2009) 122–129 gomery, G.W., 2001. Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol. Reprod. 64, 1225–1235. Ye, S., Dhillon, S., Ke, X., Collins, A.R., Day, I.N., 2001. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, e88–e98.

129

Yi, S.E., LaPolt, P.S., Yoon, B.S., Chen, J.Y., Lu, J.K., Lyons, K.M., 2001. The type I BMP receptor BmprIB is essential for female reproductive function. Proc. Natl. Acad. Sci. U.S.A. 98, 7994–7999. Zeshmarani, S., Dhara, K.C., Samanta, A.K., Samanta, R., Majumder, S.C., 2007. Reproductive performance of goats in Eastern and Northeastern India. Livest. Res. Rural Dev. 19 (8).