- Email: [email protected]
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco
The Journal of Basic & Applied Zoology (2013) 66, 164–168
The Egyptian German Society for Zoology
The Journal of Basic & Applied Zoology www.egsz.org www.sciencedirect.com
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco M. Boukharta a, F. Zakham a, N. Touil b, M. Elharrak c, M.M. Ennaji a b c
a,*
Laboratory of Virology, Microbiology and Quality/ETB, FSTM University Hassan II Mohammedia Casablanca, Morocco De´partement de Biologie, Hoˆpital Militaire d’Instruction Med V de Rabat, Universite´ Mohammed V, Souissi, Rabat, Morocco Socie´te´ de Produits biologiques et pharmaceutiques ve´te´rinaires (Biopharma), Rabat, Morocco
Received 25 May 2013; revised 19 June 2013; accepted 19 July 2013 Available online 17 September 2013
KEYWORDS Equine influenza; Nucleoprotein; Equine leucocyte antigen
Abstract The equine influenza (EI) is a highly contagious respiratory viral disease of equines. The aim of the present study was to determine the amino acid mutation sequences of the partial nucleoprotein (NP), which includes four epitopes of the equine leucocyte antigen (ELA) of A/equine/ Nador/1/1997 (H3N8). These epitopes are critical for their binding to major histocompatibility molecule complex (MHC) class I and recognition by specific Cytotoxic T Lymphocytes (CTLs). The isolate was subjected to RT-PCR amplifications followed by sequencing analysis. Phylogenetic analysis showed that Moroccan isolate belongs to equine host-specific lineage and more closely related to Italian strains A/equine/Rome/5/1991 and A/equine/Italy/1062/1991. Amino acid sequence comparison of the NP showed that the strain A/equine/Nador/1/1997 has twelve substitutions at the residues T/284/A, A/286/T, R/293/K, I/299/V, V/312/I, N/319/K, S/344/L, V/353/ I, M/374/I, C/377/N, N/397/S and R/452/K. All substitutions concerned both the interaction domains NP–NP and NP–PB2. However, the mutation N319 K enhances the NP–PB2 interaction and polymerase activity in mammalian infected cells. S/344/L mutation was located on the FEDLRVSNFI epitope (aa 338–347), this substitution is likely to help the virus to overcome the barrier of cell-mediated immunity of the host. The identified mutations were grouped into two groups, one included residues that facilitate the adaptation and evolution of influenza viruses within the equine lineage such as A/286/T, R/293/K, S/344/L, V/353/I and R/452/K, while the second contained the substitutions which enhance the virulence as polymerase activity (N319 K) and muta-
* Corresponding author. Address: Laboratory of Virology, Microbiology and Quality/Eco-toxicology and Biodiversity, University of Hassan II, Mohammedia-Casablanca, Faculty of Science and Techniques, BP 146, Mohammedia 20650, Morocco. Tel.: +212 6 61 74 88 62/212 6 62 01 37 72; fax: +212 5 23 31 53 53. E-mail address: [email protected] (M.M. Ennaji). Peer review under responsibility of The Egyptian German Society for Zoology.
Production and hosting by Elsevier 2090-9896 ª 2013 Production and hosting by Elsevier B.V. on behalf of The Egyptian German Society for Zoology. http://dx.doi.org/10.1016/j.jobaz.2013.07.007
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco
165
tions that affect CTL epitopes, resulting in an escape from immune surveillance by specific CTLs (S/344/L). ª 2013 Production and hosting by Elsevier B.V. on behalf of The Egyptian German Society for Zoology.
Background Equine influenza is an infectious and contagious disease of the upper respiratory tract of horses, donkeys and their cross products (Barquero et al., 2007; Gurkirpal, 1997). Two distinct subtypes of equine influenza viruses were identified: A/equine/ Prague/1/56 prototypes (H7N7) and A/equine/Miami/1/63 (H3N8) (Sovinova et al., 1958; Waddell et al., 1963). These viruses are a member of the family Orthomyxovirus (Orthomyxoviridae), which consists of eight single-stranded viral RNA segments of negative polarity encoding a total of 11 proteins (Zhirnov et al., 2009). Among these genes, the NP gene (segment 5) plays a critical role in the species barrier and host adaptation of influenza A viruses (Bean, 1984; Gorman et al., 1990; Xu et al., 2011). These genomic RNAs are incorporated into virions as ribonucleoprotein (RNP) complexes, which consist of the viral RNA (vRNA) associated with three viral polymerase subunit proteins (PA, PB1, and PB2) and nucleoprotein (NP) (Li et al., 2009). The ribonucleoprotein complex (RNP) is essential for the transcription and replication of the genome in the cellular nucleus (Klumpp et al., 1997; Voeten et al., 2000). Comma Nucleoprotein, comprises a sequence of 498 amino acids, in which the oligomerization is mediated by the insertion of the structurally conserved tail loop (aa 402–428) of one NP molecule to a groove of another NP (Ng et al., 2012). The NP sequence is highly conserved among influenza virus types and subtypes (Tarus et al., 2012). It contains a binding region of the viral RNA to its N-terminus (residues 1–181), two areas are responsible for auto-interaction NP–NP (residues 189–358 and 371–465) (Kobayashi et al., 1994; Albo et al., 1995; Elton et al., 1999) and three regions of NP (aa 1–161, aa 255–340 and aa 340–465) were found to interact independently with PB2 (Li et al., 2009; Ng et al., 2012). Influenza viruses that cause severe infections are able to escape to neutralizing antibodies following the accumulation of mutations ‘‘antigenic drift’’ in their surface glycoproteins (HA) and also by the introduction of mutations in the conserved epitopes of viral proteins including NP and M1 (Epstein, 2003). The nucleoprotein includes the best preserved epitopes and appears to be the major target for the cytotoxic T lymphocytes response (CTL), which limits the replication of influenza virus and thus prevent the morbidity and mortality (Varich et al., 2009; Wahl et al., 2009). In humans, the antigenic peptides of viral nucleoprotein presented by infected cells are essential for binding to HLA (human leucocyte antigen) molecules class I of major histocompatibility complex (MHC) and specific CTL of the CD8+ phenotype cross-reactive for all type influenza A viruses (Taylor and Askonas, 1986; Voeten et al., 2000). Four NP epitopes of influenza A virus were analyzed and identified by several studies. They are in the form of short
sequences recognized by cytotoxic T lymphocytes: aa 265– 273, aa 338–347, aa 380–388 and aa 383–391 (Huet et al., 1990; DiBrino et al., 1993; Voeten et al., 2000) Phylogenetic analysis of the NP gene sequences of influenza A virus indicates that the NP gene is highly conserved within the host-specific lineages (Thippamom et al., 2010) and has been shown to be a major determinant of host specificity (Shu et al., 1993). Eight distinct lineages were identified, including the human lineage, porcine, avian and equine (Xu et al., 2011). In this paper, we studied the sequence of the nucleoprotein (NP) of the four previously described CTL epitopes (Equine Leucocyte Antigen (ELA)) of the equine influenza virus A/equine/Nador/1/1997, which was isolated on 31 December 1997 in a mule with severe respiratory signs (cough, nasal discharge, hyperthermia) in Nador in the north of Morocco. Materials and methods Viruses A/equine/Nador/1/97 was isolated in Nador from a mule using 11-day-old specific-pathogen-free chicken eggs as described by Kissi (Kissi et al., 1998). Viral RNA extraction and amplification Viral RNA was directly extracted from isolates using a Purelink viral RNA/DNA-Minikit (Life Technologies) following the manufacturer’s recommended protocol. cDNA was obtained by reverse transcription reactions by using the Superscript III Reverse transcriptase kit (Invitrogen, UK). PCR was performed by Platinum PCR SuperMix High Fidelity kit (Invitrogen, UK) on obtained cDNA using primer specific NPF (ATGGCGTCTCAAGGCACCAAA) and NPR (TTAACTGTCAAACTCCTCAGC) at a final concentration of 0.5 lM for primers. Primer design is detailed by Muller et al., 2005. The thermal cycler was programmed as: incubation at 95 C for 2 min, and then 35 cycles of denaturation at 95 C for 30 s, 52 C for 1 min for hybridization, 72 C for 30 s. Sequencing NP genes and phylogenetic analysis The amplified PCR products were sequenced. Briefly, the PCR products were purified using EXOSAP-IT (USB) and bidirectionally sequenced by using ABI BigDye1 Terminator v3.1 (Applied Biosystems) on an ABI 3130xl sequencer (Applied Biosystems). Analysis of the produced electrophrogram was carried out with the sequencing Analysis Software version 5.3.1 (Applied Biosystems). Phylogenetic analysis was performed on thirty virus influenza strains isolated from different animals (Human, Avian, equine, swine) (including Moroccan isolate) published in GenBank using the Neighbor Joining method (Saitou and Nei, 1987) in which the A/equine/Prague/1957 sequence was used
166 as the root. The tree was visualized using the MEGA5.1 software (Tamura et al., 2007). Results and discussion Partial sequencing of NP gene for influenza A (H3N8) viruses isolated in Nador in 1997 was performed. Partial NP nucleotide sequences of the Moroccan equine influenza isolate A/ equine/Nador/1/1997 was submitted to GenBank under accession number JQ955608. Phylogenetic analysis of the NP gene showed that Moroccan isolate is belonging to equine host-specific lineage ‘‘recent equine’’ (Xu et al., 2011). Within this lineage, the strain A/equine/Nador/1/1997 was more closely related to Italian strains A/equine/Rome/5/1991 and A/equine/Italy/1062/1991 (Fig. 1).
M. Boukharta et al. The amino acid sequences of the nucleoprotein of the strain A/equine/Nador/1/1997, compared to the reference strain A/equine/ Miami/1/1963 represent twelve mutations (12) in the residues T/284/A, A/286/T, R/293/K, I/299/V, V/312/I, N/319/K, S/344/L, V/353/I, M/374/I, C/377/N, N/397/S and R/452/K ( Fig. 2). All of these substitutions were carried on the interaction domains NP–NP and NP– PB2. The study of the evolution of the human influenza virus nucleoprotein gene from the earliest isolates to 1990 shows that substitutions such as A/286/T, R/293/K, S/344/ L, V/353/I and R/452/K were also affecting the human lineage (Shu et al., 1993). By analogy, these mutations are considered a kind of optimal adaptation of equine influenza viruses within the lineage «recent equine». Like human and swine lineage, the lineage
Fig. 1 Phylogenetic relationships of nucleoprotein genes from 30 influenza viruses. A/duck/Victoria/1992, ACZ46625; A/starling/ Victoria/1985, ABS89358; A/dunlin/Sweden/1/2005, ADQ20617; A/duck/Rugen/79-6/1981, AFJ12908; A/duck/Alberta/286/1978, ACZ46635; A/duck/Manitoba/1/1953, AAA52234; A/gadwall/Ohio/37/1999, ABI95177; A/swine/Germany/2/1981, AAA43667; A/ swine/Belgium/WVL1/1979, ACO24984; A/swine/Germany/SEk1178/2000, CAP49194; A/swine/France/WVL13/1995, ACO25027; A/ Swine/Italy/1523/98,CAC40064; A/swine/Ploufragan/0214/2006, AFR76768; A/equine/Miami/1/1963, AAA43106; A/equine/Alaska/ 29759/1991, ACA24649; A/equine/Ohio/1/2003, AAZ23583; A/equine/Athens/04/2007, ADT80589; A/equine/California/8560/2002, ACA96815; A/equine/Berlin/1/1989, ACD85411; A/equine/Nador/1/1997, AFJ69904; A/equine/Italy/1062/1991, ACD85356; A/equine/ Rome/5/1991, ACD85345; A/Aichi/198/2009, ACY39802;A/Amman/WRAIR1339 N/2009, ADM32950; A/Ankara/WRAIR1425T/2009, ADM32978; A/Antwerp/INS221/2009, ADK32641; A/Andalucia/GP251/2009, ACT67136; A/Texas/05/2009, ACU13087; A/equine/ Prague/1956, AAA43108.
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco
167
Fig. 2 The amino acid sequence of the nucleoprotein (aa 260–454) of 30 equine influenza viruses (H3N8). CTL epitopes are framed. Green line: CAS, red line: tail loup A/equine/Miami/1/1963, AAA43106; A/equine/Nador/1/1997, AFJ69904; A/equine/Algiers/1/1972, ACF22130; A/equine/Berlin/1/1989, ACD85411; A/equine/California/4537/1997, ACA96804; A/equine/Cordoba/18/1985, ACD85279; A/equine/Fontainbleu/1/1979, ACD85400; A/equine/Gansu/7/2008, ACE81939; A/equine/Georgia/1/1981, ABY81529; A/equine/Italy/ 1199/1992, ACD85312; A/equine/Jilin/1/1989,AAA52247; A/equine/Johannesburg/1/1986, ACF22141; A/equine/Kentucky/1/1992, ACA24638; A/equine/Kentucky/5/2002, AAX23576; A/equine/Kentucky/8/1994, ACA24682; A/equine/Liaoning/9/2008, ACE81906; A/equine/Newmarket/1/1993, ACI48794; A/equine/Newmarket/2/1993, ACI48784; A/equine/Newmarket/5/2003, ACI48805; A/equine/ Ohio/1/2003, AAZ23583; A/equine/Qinghai/1/1994, ACE81884; A/equine/Romania/1/1980, ACD85378; A/equine/Rome/5/1991, ACD85345; A/equine/Rook/93753/1989, ACD97440; A/equine/Santa Fe/1/1985 ACD85290; A/equine/Santiago/1/1985 AAQ90289; A/ equine/Sussex/1/1989, ACD97429; A/equine/Texas/39655/1991, ACA24627; A/equine/Uruguay/1/1963, ACD85422; A/equine/Wisconsin/1/03, ABB17175.
equine shows a continuous evolutionary progression with time. It is noteworthy to mention that the rate of mutation of mammalian influenza virus nucleoprotein is much higher than for avian influenza viruses. The N319 K mutation improves the interaction NP-PB2 and the polymerase activity in mammalian infected cells (Gabriel et al., 2008). This was approved by the virulence of the strain A/equine/Nador/1/1997 in the nature. The thirty aligned sequences of equine influenza viruses showed no mutation at the first ILRGSVAHK epitope (aa 265–273) and proved to be conserved (Voeten et al., 2000). Only one mutation I/265/V (ADC34563 A/equine/Huabei/1/ 2007) was found in this epitope out of the 102 equine influenza viruses available at Genbank (data not shown). Equine Leucocyte Antigen (ELA) epitope FEDLRVSNFI (aa 338–347) has the mutation (S/344/L), which is common in several equine influenza viruses and one rare mutation in residues N/345/S was found in the A/equine/Jilin/1/1989
(AAA522479), this strain caused two severe outbreaks in China, one was in 1989 which was shown to be more closely related to avian H3N8 influenza virus (Guo et al., 1995). In this second epitope, the substitution S/344/L of A/equine/Nador/1/1997 strain also presents in cytoplasmic accumulation signal (CAS), (residues 327–345), which had integrated with F-actin and causes cytoplasmic retention of the NP towards the end of infection (Portela and Digard, 2002). This mutation appears to facilitate the migration of NP to the cytoplasm and consequently the viral cycle. In the last two epitopes aa 380–388 and aa 383–391, we saw a frequent mutation in several equine influenza viruses at residue 384 (R/384/K) and only one mutation R/391/K of A/ equine/Kentucky/8/1994 (ACA24682). The R384 K mutation seems to abrogate MHC class I presentation and recognition by specific CTLs (Voeten et al., 2000). The crystalian structure of the nucleoprotein showed that each NP contains a ‘‘tail loup’’ formed by residues 402–428
168 (Li et al., 2009). As shown in Fig. 2, this sequence was conserved among the studied strains. Conclusion The identified mutations were grouped into two categories, one includes residues that facilitate the adaptation and evolution of influenza viruses within the equine lineage such as A/286/T, R/ 293/K, S/344/L, V/353/I and R/452/K, while the other contained the substitutions which enhance the virulence such as polymerase activity (N319 K) and mutations that affect CTL epitopes, resulting in the escape from immune surveillance by specific CTLs (S/344/L). Competing interests The authors declare that they have no competing interests. Acknowledgements This study was supported by the University Hassan II. Mohammedia-Casablanca, Faculty of Sciences and Techniques, Mohammedia, Morocco. The authors would like to thank the Inspection de Service de Sante´ Militaire/Division Ve´te´rinaire (EMG/ISS/DV) for their support. References Albo, C., Valencia, A., Portela, A., 1995. Identification of an RNA binding region within the N-terminal third of the influenza A virus nucleoprotein. J. Virol. 69, 3799–3806. Barquero, N., Daly, J.M., Newton, J.R., 2007. Risk factors for influenza infection in vaccinated racehorses: Lessons from an outbreak in Newmarket, UK in 2003. Vaccine 25, 7520–7529. Bean, W., 1984. Correlation of influenza A virus nucleoprotein genes with host species. Virology 133, 438–442. DiBrino, M., Tsuchida, T., Turner, R.V., Parker, K.C., Coligan, J.E., Biddison, W.E., 1993. HLA-A1 and HLA-A3 T cell epitopes derived from influenza virus proteins predicted from peptide binding motifs. J. Immunol. 151, 5930–5935. Elton, D., Medcalf, L., Bishop, K., Harrison, D., Digard, P., 1999. Identification of amino acid residues of influenza virus nucleoprotein essential for RNA binding. J. Virol. 73, 7357–7367. Epstein, S., 2003. Control of influenza virus infection by immunity to conserved viral features. Expert Rev. Anti Infect. Ther. 1, 627–638. Gabriel, G., Herwig, A., Klenk, H., 2008. Interaction of polymerase subunit PB2 and NP with importin alpha1 is a determinant of host range of influenza A virus. PLoS ONE 8, e11. Gorman, O.T., Bean, W.J., Kawaoka, Y., Webster, R.G., 1990. Evolution of the nucleoprotein gene of influenza A virus. J. Virol. 64, 1487–1497. Guo, Y., Wang, M., Zheng, G.S., Li, W.k., Kawaoka, Y., Webster, R.G., 1995. Seroepidemiological and molecular evidence for the presence of two H3N8 equine influenza viruses in China in 1993a` 1994. J. Gen. Virol. 76, 2009–2014. Gurkirpal, S., 1997. Serological observations on an epidemic of equine influenza in India. J. Equine Vet. Sci. 17, 380–384. Huet, S., Nixon, D., Rothbard, J., Townsend, A., Ellis, S., McMichael, A., 1990. Structural homologies between two HLA B27-restricted peptides suggest residues important for interaction with HLA B27. Int. Immunol. 2, 311–316. Kissi, B., Daoudi, N., El kantour, A., Id sidi yahia, K., Benazzou, H., 1998. Premier isolement au Maroc du virus de la grippe e´quine baptise´ A/Equi/Maroc/1/97. Espace Ve´te´rinaire 14, 10.
M. Boukharta et al. Klumpp, K., Ruigrok, R.W.H., Baudin, F., 1997. Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure. EMBO J. 16, 1248–1257. Kobayashi, M., Toyoda, T., Adyshev, D.M., Azuma, Y., Ishihama, A., 1994. Molecular dissection of influenza virus nucleoprotein: deletion mapping of the RNA binding domain. J. Virol. 68, 8433– 8436. Li, Z., Watanabe, T., Hatta, M., Watanabe, S., Nanbo, A., Ozawa, M., et al., 2009. Mutational analysis of conserved amino acids in the influenza A virus nucleoprotein. J. Virol. 83, 4153–4162. Muller, I., Jaureguiberry, Bn., Valenzuela, P.D.T., 2005. Isolation, sequencing and phylogenetic analysis of the hemagglutinin, neuraminidase and nucleoprotein genes of the Chilean equine influenza virus subtypes H7N7 and H3N8. Biol. Res. 38, 55–67. Ng, A., Chan, W., Choi, S., Lam, M., Lau, K., Chan, P., et al., 2012. Influenza polymerase activity correlates with the strength of interaction between nucleoprotein and PB2 through the hostspecific residue K/E627. PLoS ONE 7, e36415. Portela, A., Digard, P., 2002. The influenza virus nucleoprotein: a multifunctional RNA-binding protein pivotal to virus replication. J. Gen. Virol. 83, 723–734. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Shu, L.L., Bean, W.J., Webster, R.G., 1933. 1993. Analysis of the evolution and variation of the human influenza A virus nucleoprotein gene from 1933 to 1990. J. Virol. 67, 2723–2729. Sovinova, O., Tumova, B., Pouska, F., Nemec, J., 1958. Isolation of a virus causing respiratory disease in horses. Acta Virol. 2, 52–61. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tarus, B., Chevalier, C., Richard, C.A., Delmas, B., Di Primo, C., Slama-Schwok, A., 2012. Molecular dynamics studies of the nucleoprotein of influenza A virus: role of the protein flexibility in RNA binding. PLoS ONE 7, e30038. Taylor, P.M., Askonas, B.A., 1986. Influenza nucleoprotein-specific cytotoxic T-cell clones are protective in vivo. Immunology 58, 417– 420. Thippamom, N., Sreta, D., Kitikoon, P., Thanawongnuwech, R., Poovorawan, Y., Theamboonlers, A., et al., 2010. Genetic variations of nucleoprotein gene of influenza A viruses isolated from swine in Thailand. Virol J. 7, 185. Varich, N.L., Kochergin-Nikitsky, K.S., Usachev, E.V., Usacheva, O.V., Prilipov, A.G., Webster, R.G., et al., 2009. Location of antigenic sites recognized by monoclonal antibodies in the influenza A virus nucleoprotein molecule. J. Gen. Virol. 90, 1730–1733. Voeten, J.T., Bestebroer, T.M., Nieuwkoop, N.J., Fouchier, R.A., Osterhaus, A.D., Rimmelzwaan, G.F., 2000. Antigenic drift in the influenza A virus (H3N2) nucleoprotein and escape from recognition by cytotoxic T lymphocytes. J. Virol. 74, 6800–6807. Waddell, G.H., Teigland, M.B., Sigel, M.M., 1963. A new influenza virus associated with equine respiratory disease. J. Am. Vet. Med. Assoc. 143, 587–590. Wahl, A., Schafer, F., Bardet, W., Buchli, R., Air, G.M., Hildebrand, W.H., 2009. HLA class I molecules consistently present internal influenza epitopes. Proc. Natl. Acad. Sci. 106, 540–545. Xu, J., Christman, M.C., Donis, R.O., Lu, G., 2011. Evolutionary dynamics of influenza A nucleoprotein (NP) lineages revealed by large-scale sequence analyses. Infect. Genet. Evol. 11, 2125– 2132. Zhirnov, O.P., Vorobjeva, I.V., Saphonova, O.A., Poyarkov, S.V., Ovcharenko, A.V., Anhlan, D., et al., 2009. Structural and evolutionary characteristics of HA, NA, NS and M genes of clinical influenza A/H3N2 viruses passaged in human and canine cells. J. Clin. Virol. 45, 322–333.
The Egyptian German Society for Zoology
The Journal of Basic & Applied Zoology www.egsz.org www.sciencedirect.com
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco M. Boukharta a, F. Zakham a, N. Touil b, M. Elharrak c, M.M. Ennaji a b c
a,*
Laboratory of Virology, Microbiology and Quality/ETB, FSTM University Hassan II Mohammedia Casablanca, Morocco De´partement de Biologie, Hoˆpital Militaire d’Instruction Med V de Rabat, Universite´ Mohammed V, Souissi, Rabat, Morocco Socie´te´ de Produits biologiques et pharmaceutiques ve´te´rinaires (Biopharma), Rabat, Morocco
Received 25 May 2013; revised 19 June 2013; accepted 19 July 2013 Available online 17 September 2013
KEYWORDS Equine influenza; Nucleoprotein; Equine leucocyte antigen
Abstract The equine influenza (EI) is a highly contagious respiratory viral disease of equines. The aim of the present study was to determine the amino acid mutation sequences of the partial nucleoprotein (NP), which includes four epitopes of the equine leucocyte antigen (ELA) of A/equine/ Nador/1/1997 (H3N8). These epitopes are critical for their binding to major histocompatibility molecule complex (MHC) class I and recognition by specific Cytotoxic T Lymphocytes (CTLs). The isolate was subjected to RT-PCR amplifications followed by sequencing analysis. Phylogenetic analysis showed that Moroccan isolate belongs to equine host-specific lineage and more closely related to Italian strains A/equine/Rome/5/1991 and A/equine/Italy/1062/1991. Amino acid sequence comparison of the NP showed that the strain A/equine/Nador/1/1997 has twelve substitutions at the residues T/284/A, A/286/T, R/293/K, I/299/V, V/312/I, N/319/K, S/344/L, V/353/ I, M/374/I, C/377/N, N/397/S and R/452/K. All substitutions concerned both the interaction domains NP–NP and NP–PB2. However, the mutation N319 K enhances the NP–PB2 interaction and polymerase activity in mammalian infected cells. S/344/L mutation was located on the FEDLRVSNFI epitope (aa 338–347), this substitution is likely to help the virus to overcome the barrier of cell-mediated immunity of the host. The identified mutations were grouped into two groups, one included residues that facilitate the adaptation and evolution of influenza viruses within the equine lineage such as A/286/T, R/293/K, S/344/L, V/353/I and R/452/K, while the second contained the substitutions which enhance the virulence as polymerase activity (N319 K) and muta-
* Corresponding author. Address: Laboratory of Virology, Microbiology and Quality/Eco-toxicology and Biodiversity, University of Hassan II, Mohammedia-Casablanca, Faculty of Science and Techniques, BP 146, Mohammedia 20650, Morocco. Tel.: +212 6 61 74 88 62/212 6 62 01 37 72; fax: +212 5 23 31 53 53. E-mail address: [email protected] (M.M. Ennaji). Peer review under responsibility of The Egyptian German Society for Zoology.
Production and hosting by Elsevier 2090-9896 ª 2013 Production and hosting by Elsevier B.V. on behalf of The Egyptian German Society for Zoology. http://dx.doi.org/10.1016/j.jobaz.2013.07.007
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco
165
tions that affect CTL epitopes, resulting in an escape from immune surveillance by specific CTLs (S/344/L). ª 2013 Production and hosting by Elsevier B.V. on behalf of The Egyptian German Society for Zoology.
Background Equine influenza is an infectious and contagious disease of the upper respiratory tract of horses, donkeys and their cross products (Barquero et al., 2007; Gurkirpal, 1997). Two distinct subtypes of equine influenza viruses were identified: A/equine/ Prague/1/56 prototypes (H7N7) and A/equine/Miami/1/63 (H3N8) (Sovinova et al., 1958; Waddell et al., 1963). These viruses are a member of the family Orthomyxovirus (Orthomyxoviridae), which consists of eight single-stranded viral RNA segments of negative polarity encoding a total of 11 proteins (Zhirnov et al., 2009). Among these genes, the NP gene (segment 5) plays a critical role in the species barrier and host adaptation of influenza A viruses (Bean, 1984; Gorman et al., 1990; Xu et al., 2011). These genomic RNAs are incorporated into virions as ribonucleoprotein (RNP) complexes, which consist of the viral RNA (vRNA) associated with three viral polymerase subunit proteins (PA, PB1, and PB2) and nucleoprotein (NP) (Li et al., 2009). The ribonucleoprotein complex (RNP) is essential for the transcription and replication of the genome in the cellular nucleus (Klumpp et al., 1997; Voeten et al., 2000). Comma Nucleoprotein, comprises a sequence of 498 amino acids, in which the oligomerization is mediated by the insertion of the structurally conserved tail loop (aa 402–428) of one NP molecule to a groove of another NP (Ng et al., 2012). The NP sequence is highly conserved among influenza virus types and subtypes (Tarus et al., 2012). It contains a binding region of the viral RNA to its N-terminus (residues 1–181), two areas are responsible for auto-interaction NP–NP (residues 189–358 and 371–465) (Kobayashi et al., 1994; Albo et al., 1995; Elton et al., 1999) and three regions of NP (aa 1–161, aa 255–340 and aa 340–465) were found to interact independently with PB2 (Li et al., 2009; Ng et al., 2012). Influenza viruses that cause severe infections are able to escape to neutralizing antibodies following the accumulation of mutations ‘‘antigenic drift’’ in their surface glycoproteins (HA) and also by the introduction of mutations in the conserved epitopes of viral proteins including NP and M1 (Epstein, 2003). The nucleoprotein includes the best preserved epitopes and appears to be the major target for the cytotoxic T lymphocytes response (CTL), which limits the replication of influenza virus and thus prevent the morbidity and mortality (Varich et al., 2009; Wahl et al., 2009). In humans, the antigenic peptides of viral nucleoprotein presented by infected cells are essential for binding to HLA (human leucocyte antigen) molecules class I of major histocompatibility complex (MHC) and specific CTL of the CD8+ phenotype cross-reactive for all type influenza A viruses (Taylor and Askonas, 1986; Voeten et al., 2000). Four NP epitopes of influenza A virus were analyzed and identified by several studies. They are in the form of short
sequences recognized by cytotoxic T lymphocytes: aa 265– 273, aa 338–347, aa 380–388 and aa 383–391 (Huet et al., 1990; DiBrino et al., 1993; Voeten et al., 2000) Phylogenetic analysis of the NP gene sequences of influenza A virus indicates that the NP gene is highly conserved within the host-specific lineages (Thippamom et al., 2010) and has been shown to be a major determinant of host specificity (Shu et al., 1993). Eight distinct lineages were identified, including the human lineage, porcine, avian and equine (Xu et al., 2011). In this paper, we studied the sequence of the nucleoprotein (NP) of the four previously described CTL epitopes (Equine Leucocyte Antigen (ELA)) of the equine influenza virus A/equine/Nador/1/1997, which was isolated on 31 December 1997 in a mule with severe respiratory signs (cough, nasal discharge, hyperthermia) in Nador in the north of Morocco. Materials and methods Viruses A/equine/Nador/1/97 was isolated in Nador from a mule using 11-day-old specific-pathogen-free chicken eggs as described by Kissi (Kissi et al., 1998). Viral RNA extraction and amplification Viral RNA was directly extracted from isolates using a Purelink viral RNA/DNA-Minikit (Life Technologies) following the manufacturer’s recommended protocol. cDNA was obtained by reverse transcription reactions by using the Superscript III Reverse transcriptase kit (Invitrogen, UK). PCR was performed by Platinum PCR SuperMix High Fidelity kit (Invitrogen, UK) on obtained cDNA using primer specific NPF (ATGGCGTCTCAAGGCACCAAA) and NPR (TTAACTGTCAAACTCCTCAGC) at a final concentration of 0.5 lM for primers. Primer design is detailed by Muller et al., 2005. The thermal cycler was programmed as: incubation at 95 C for 2 min, and then 35 cycles of denaturation at 95 C for 30 s, 52 C for 1 min for hybridization, 72 C for 30 s. Sequencing NP genes and phylogenetic analysis The amplified PCR products were sequenced. Briefly, the PCR products were purified using EXOSAP-IT (USB) and bidirectionally sequenced by using ABI BigDye1 Terminator v3.1 (Applied Biosystems) on an ABI 3130xl sequencer (Applied Biosystems). Analysis of the produced electrophrogram was carried out with the sequencing Analysis Software version 5.3.1 (Applied Biosystems). Phylogenetic analysis was performed on thirty virus influenza strains isolated from different animals (Human, Avian, equine, swine) (including Moroccan isolate) published in GenBank using the Neighbor Joining method (Saitou and Nei, 1987) in which the A/equine/Prague/1957 sequence was used
166 as the root. The tree was visualized using the MEGA5.1 software (Tamura et al., 2007). Results and discussion Partial sequencing of NP gene for influenza A (H3N8) viruses isolated in Nador in 1997 was performed. Partial NP nucleotide sequences of the Moroccan equine influenza isolate A/ equine/Nador/1/1997 was submitted to GenBank under accession number JQ955608. Phylogenetic analysis of the NP gene showed that Moroccan isolate is belonging to equine host-specific lineage ‘‘recent equine’’ (Xu et al., 2011). Within this lineage, the strain A/equine/Nador/1/1997 was more closely related to Italian strains A/equine/Rome/5/1991 and A/equine/Italy/1062/1991 (Fig. 1).
M. Boukharta et al. The amino acid sequences of the nucleoprotein of the strain A/equine/Nador/1/1997, compared to the reference strain A/equine/ Miami/1/1963 represent twelve mutations (12) in the residues T/284/A, A/286/T, R/293/K, I/299/V, V/312/I, N/319/K, S/344/L, V/353/I, M/374/I, C/377/N, N/397/S and R/452/K ( Fig. 2). All of these substitutions were carried on the interaction domains NP–NP and NP– PB2. The study of the evolution of the human influenza virus nucleoprotein gene from the earliest isolates to 1990 shows that substitutions such as A/286/T, R/293/K, S/344/ L, V/353/I and R/452/K were also affecting the human lineage (Shu et al., 1993). By analogy, these mutations are considered a kind of optimal adaptation of equine influenza viruses within the lineage «recent equine». Like human and swine lineage, the lineage
Fig. 1 Phylogenetic relationships of nucleoprotein genes from 30 influenza viruses. A/duck/Victoria/1992, ACZ46625; A/starling/ Victoria/1985, ABS89358; A/dunlin/Sweden/1/2005, ADQ20617; A/duck/Rugen/79-6/1981, AFJ12908; A/duck/Alberta/286/1978, ACZ46635; A/duck/Manitoba/1/1953, AAA52234; A/gadwall/Ohio/37/1999, ABI95177; A/swine/Germany/2/1981, AAA43667; A/ swine/Belgium/WVL1/1979, ACO24984; A/swine/Germany/SEk1178/2000, CAP49194; A/swine/France/WVL13/1995, ACO25027; A/ Swine/Italy/1523/98,CAC40064; A/swine/Ploufragan/0214/2006, AFR76768; A/equine/Miami/1/1963, AAA43106; A/equine/Alaska/ 29759/1991, ACA24649; A/equine/Ohio/1/2003, AAZ23583; A/equine/Athens/04/2007, ADT80589; A/equine/California/8560/2002, ACA96815; A/equine/Berlin/1/1989, ACD85411; A/equine/Nador/1/1997, AFJ69904; A/equine/Italy/1062/1991, ACD85356; A/equine/ Rome/5/1991, ACD85345; A/Aichi/198/2009, ACY39802;A/Amman/WRAIR1339 N/2009, ADM32950; A/Ankara/WRAIR1425T/2009, ADM32978; A/Antwerp/INS221/2009, ADK32641; A/Andalucia/GP251/2009, ACT67136; A/Texas/05/2009, ACU13087; A/equine/ Prague/1956, AAA43108.
Mutations and phylogenetic analysis of the equine influenza virus (H3N8) nucleoprotein isolated in Morocco
167
Fig. 2 The amino acid sequence of the nucleoprotein (aa 260–454) of 30 equine influenza viruses (H3N8). CTL epitopes are framed. Green line: CAS, red line: tail loup A/equine/Miami/1/1963, AAA43106; A/equine/Nador/1/1997, AFJ69904; A/equine/Algiers/1/1972, ACF22130; A/equine/Berlin/1/1989, ACD85411; A/equine/California/4537/1997, ACA96804; A/equine/Cordoba/18/1985, ACD85279; A/equine/Fontainbleu/1/1979, ACD85400; A/equine/Gansu/7/2008, ACE81939; A/equine/Georgia/1/1981, ABY81529; A/equine/Italy/ 1199/1992, ACD85312; A/equine/Jilin/1/1989,AAA52247; A/equine/Johannesburg/1/1986, ACF22141; A/equine/Kentucky/1/1992, ACA24638; A/equine/Kentucky/5/2002, AAX23576; A/equine/Kentucky/8/1994, ACA24682; A/equine/Liaoning/9/2008, ACE81906; A/equine/Newmarket/1/1993, ACI48794; A/equine/Newmarket/2/1993, ACI48784; A/equine/Newmarket/5/2003, ACI48805; A/equine/ Ohio/1/2003, AAZ23583; A/equine/Qinghai/1/1994, ACE81884; A/equine/Romania/1/1980, ACD85378; A/equine/Rome/5/1991, ACD85345; A/equine/Rook/93753/1989, ACD97440; A/equine/Santa Fe/1/1985 ACD85290; A/equine/Santiago/1/1985 AAQ90289; A/ equine/Sussex/1/1989, ACD97429; A/equine/Texas/39655/1991, ACA24627; A/equine/Uruguay/1/1963, ACD85422; A/equine/Wisconsin/1/03, ABB17175.
equine shows a continuous evolutionary progression with time. It is noteworthy to mention that the rate of mutation of mammalian influenza virus nucleoprotein is much higher than for avian influenza viruses. The N319 K mutation improves the interaction NP-PB2 and the polymerase activity in mammalian infected cells (Gabriel et al., 2008). This was approved by the virulence of the strain A/equine/Nador/1/1997 in the nature. The thirty aligned sequences of equine influenza viruses showed no mutation at the first ILRGSVAHK epitope (aa 265–273) and proved to be conserved (Voeten et al., 2000). Only one mutation I/265/V (ADC34563 A/equine/Huabei/1/ 2007) was found in this epitope out of the 102 equine influenza viruses available at Genbank (data not shown). Equine Leucocyte Antigen (ELA) epitope FEDLRVSNFI (aa 338–347) has the mutation (S/344/L), which is common in several equine influenza viruses and one rare mutation in residues N/345/S was found in the A/equine/Jilin/1/1989
(AAA522479), this strain caused two severe outbreaks in China, one was in 1989 which was shown to be more closely related to avian H3N8 influenza virus (Guo et al., 1995). In this second epitope, the substitution S/344/L of A/equine/Nador/1/1997 strain also presents in cytoplasmic accumulation signal (CAS), (residues 327–345), which had integrated with F-actin and causes cytoplasmic retention of the NP towards the end of infection (Portela and Digard, 2002). This mutation appears to facilitate the migration of NP to the cytoplasm and consequently the viral cycle. In the last two epitopes aa 380–388 and aa 383–391, we saw a frequent mutation in several equine influenza viruses at residue 384 (R/384/K) and only one mutation R/391/K of A/ equine/Kentucky/8/1994 (ACA24682). The R384 K mutation seems to abrogate MHC class I presentation and recognition by specific CTLs (Voeten et al., 2000). The crystalian structure of the nucleoprotein showed that each NP contains a ‘‘tail loup’’ formed by residues 402–428
168 (Li et al., 2009). As shown in Fig. 2, this sequence was conserved among the studied strains. Conclusion The identified mutations were grouped into two categories, one includes residues that facilitate the adaptation and evolution of influenza viruses within the equine lineage such as A/286/T, R/ 293/K, S/344/L, V/353/I and R/452/K, while the other contained the substitutions which enhance the virulence such as polymerase activity (N319 K) and mutations that affect CTL epitopes, resulting in the escape from immune surveillance by specific CTLs (S/344/L). Competing interests The authors declare that they have no competing interests. Acknowledgements This study was supported by the University Hassan II. Mohammedia-Casablanca, Faculty of Sciences and Techniques, Mohammedia, Morocco. The authors would like to thank the Inspection de Service de Sante´ Militaire/Division Ve´te´rinaire (EMG/ISS/DV) for their support. References Albo, C., Valencia, A., Portela, A., 1995. Identification of an RNA binding region within the N-terminal third of the influenza A virus nucleoprotein. J. Virol. 69, 3799–3806. Barquero, N., Daly, J.M., Newton, J.R., 2007. Risk factors for influenza infection in vaccinated racehorses: Lessons from an outbreak in Newmarket, UK in 2003. Vaccine 25, 7520–7529. Bean, W., 1984. Correlation of influenza A virus nucleoprotein genes with host species. Virology 133, 438–442. DiBrino, M., Tsuchida, T., Turner, R.V., Parker, K.C., Coligan, J.E., Biddison, W.E., 1993. HLA-A1 and HLA-A3 T cell epitopes derived from influenza virus proteins predicted from peptide binding motifs. J. Immunol. 151, 5930–5935. Elton, D., Medcalf, L., Bishop, K., Harrison, D., Digard, P., 1999. Identification of amino acid residues of influenza virus nucleoprotein essential for RNA binding. J. Virol. 73, 7357–7367. Epstein, S., 2003. Control of influenza virus infection by immunity to conserved viral features. Expert Rev. Anti Infect. Ther. 1, 627–638. Gabriel, G., Herwig, A., Klenk, H., 2008. Interaction of polymerase subunit PB2 and NP with importin alpha1 is a determinant of host range of influenza A virus. PLoS ONE 8, e11. Gorman, O.T., Bean, W.J., Kawaoka, Y., Webster, R.G., 1990. Evolution of the nucleoprotein gene of influenza A virus. J. Virol. 64, 1487–1497. Guo, Y., Wang, M., Zheng, G.S., Li, W.k., Kawaoka, Y., Webster, R.G., 1995. Seroepidemiological and molecular evidence for the presence of two H3N8 equine influenza viruses in China in 1993a` 1994. J. Gen. Virol. 76, 2009–2014. Gurkirpal, S., 1997. Serological observations on an epidemic of equine influenza in India. J. Equine Vet. Sci. 17, 380–384. Huet, S., Nixon, D., Rothbard, J., Townsend, A., Ellis, S., McMichael, A., 1990. Structural homologies between two HLA B27-restricted peptides suggest residues important for interaction with HLA B27. Int. Immunol. 2, 311–316. Kissi, B., Daoudi, N., El kantour, A., Id sidi yahia, K., Benazzou, H., 1998. Premier isolement au Maroc du virus de la grippe e´quine baptise´ A/Equi/Maroc/1/97. Espace Ve´te´rinaire 14, 10.
M. Boukharta et al. Klumpp, K., Ruigrok, R.W.H., Baudin, F., 1997. Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure. EMBO J. 16, 1248–1257. Kobayashi, M., Toyoda, T., Adyshev, D.M., Azuma, Y., Ishihama, A., 1994. Molecular dissection of influenza virus nucleoprotein: deletion mapping of the RNA binding domain. J. Virol. 68, 8433– 8436. Li, Z., Watanabe, T., Hatta, M., Watanabe, S., Nanbo, A., Ozawa, M., et al., 2009. Mutational analysis of conserved amino acids in the influenza A virus nucleoprotein. J. Virol. 83, 4153–4162. Muller, I., Jaureguiberry, Bn., Valenzuela, P.D.T., 2005. Isolation, sequencing and phylogenetic analysis of the hemagglutinin, neuraminidase and nucleoprotein genes of the Chilean equine influenza virus subtypes H7N7 and H3N8. Biol. Res. 38, 55–67. Ng, A., Chan, W., Choi, S., Lam, M., Lau, K., Chan, P., et al., 2012. Influenza polymerase activity correlates with the strength of interaction between nucleoprotein and PB2 through the hostspecific residue K/E627. PLoS ONE 7, e36415. Portela, A., Digard, P., 2002. The influenza virus nucleoprotein: a multifunctional RNA-binding protein pivotal to virus replication. J. Gen. Virol. 83, 723–734. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Shu, L.L., Bean, W.J., Webster, R.G., 1933. 1993. Analysis of the evolution and variation of the human influenza A virus nucleoprotein gene from 1933 to 1990. J. Virol. 67, 2723–2729. Sovinova, O., Tumova, B., Pouska, F., Nemec, J., 1958. Isolation of a virus causing respiratory disease in horses. Acta Virol. 2, 52–61. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tarus, B., Chevalier, C., Richard, C.A., Delmas, B., Di Primo, C., Slama-Schwok, A., 2012. Molecular dynamics studies of the nucleoprotein of influenza A virus: role of the protein flexibility in RNA binding. PLoS ONE 7, e30038. Taylor, P.M., Askonas, B.A., 1986. Influenza nucleoprotein-specific cytotoxic T-cell clones are protective in vivo. Immunology 58, 417– 420. Thippamom, N., Sreta, D., Kitikoon, P., Thanawongnuwech, R., Poovorawan, Y., Theamboonlers, A., et al., 2010. Genetic variations of nucleoprotein gene of influenza A viruses isolated from swine in Thailand. Virol J. 7, 185. Varich, N.L., Kochergin-Nikitsky, K.S., Usachev, E.V., Usacheva, O.V., Prilipov, A.G., Webster, R.G., et al., 2009. Location of antigenic sites recognized by monoclonal antibodies in the influenza A virus nucleoprotein molecule. J. Gen. Virol. 90, 1730–1733. Voeten, J.T., Bestebroer, T.M., Nieuwkoop, N.J., Fouchier, R.A., Osterhaus, A.D., Rimmelzwaan, G.F., 2000. Antigenic drift in the influenza A virus (H3N2) nucleoprotein and escape from recognition by cytotoxic T lymphocytes. J. Virol. 74, 6800–6807. Waddell, G.H., Teigland, M.B., Sigel, M.M., 1963. A new influenza virus associated with equine respiratory disease. J. Am. Vet. Med. Assoc. 143, 587–590. Wahl, A., Schafer, F., Bardet, W., Buchli, R., Air, G.M., Hildebrand, W.H., 2009. HLA class I molecules consistently present internal influenza epitopes. Proc. Natl. Acad. Sci. 106, 540–545. Xu, J., Christman, M.C., Donis, R.O., Lu, G., 2011. Evolutionary dynamics of influenza A nucleoprotein (NP) lineages revealed by large-scale sequence analyses. Infect. Genet. Evol. 11, 2125– 2132. Zhirnov, O.P., Vorobjeva, I.V., Saphonova, O.A., Poyarkov, S.V., Ovcharenko, A.V., Anhlan, D., et al., 2009. Structural and evolutionary characteristics of HA, NA, NS and M genes of clinical influenza A/H3N2 viruses passaged in human and canine cells. J. Clin. Virol. 45, 322–333.