- Email: [email protected]
Phylogenetic and Molecular Characterization of the Equine Influenza Virus A (H3N8) Causing the 1997 and 2004 Outbreaks in Morocco
Journal of Equine Veterinary Science xx (2013) 1–7
Contents lists available at ScienceDirect
Journal of Equine Veterinary Science journal homepage: www.j-evs.com
Original Research
Phylogenetic and Molecular Characterization of the Equine Influenza Virus A (H3N8) Causing the 1997 and 2004 Outbreaks in Morocco Mohamed Boukharta DVM a, Nadia Touil PhD b, Elmostafa El Fahim PhD c, Meriame Terta PhD a, Bachir Kissi DVM d, Chafiqua Loutfi MS d, Mehdi El Harrak DVM, PhD d, My Mustapha Ennaji PhD, PROF a, * a
Laboratory of Virology, Microbiology, and Quality/ETB, Faculty of Sciences and Techniques, Mohammedia, University Hassan II Mohammadia-Casablanca, Morocco b Department of Biology, Instruction Military Hospital Med V Rabat, University Mohammed V Souissi, Rabat, Morocco c Functional Genomics Platform, Technical Support Unit for Scientific Research, CNRST, Rabat, Morocco d Society of Pharmaceutical and Veterinary Products, Virology Laboratory, Rabat, Morocco
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 June 2013 Received in revised form 1 October 2013 Accepted 17 October 2013 Available online xxxx
Reported here are the results of antigenic and genetic characterization of equine influenza strains causing local outbreaks reported in Morocco, respectively, in 1997 and 2004. The antigenic and genetic characterizations of the equine influenza virus H3N8 are reported here. The highest similarity between the HA1 nucleotide sequences of A/equine/Nador/1/ 1997 and those of A/equine/Rome/5/1991 and A/equine/Italy/1199/1992 demonstrate that A/equine/Nador/1/1997 belongs to the European lineage. On the other hand, A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 were classified in the predivergent lineage. The present work emphasizes the importance of a national influenza survey program, which requires a collaborative laboratory network to promote the collection and characterization (antigenic and genetic) of equine influenza viruses in real time. Ó 2013 Elsevier Inc. All rights reserved.
Keywords: Equine influenza virus A/equine/Nador/1/1997 A/equine/Essaouira/2/2004 A/equine/Essaouira/3/2004 Predivergent lineage circulation Morocco
1. Introduction Equine influenza virus belongs to the family Orthomyxovirus, genus Influenzavirus A, species Influenza A virus and encloses a multisegmented negative strand RNA genome. Equine influenza is caused by two subtypes of influenza viruses: H7N7 (prototype A/equine/Prague/1/57), which has been considered extinct since 1979, and H3N8 (prototype A/equine/Miami/1/63). The second type is
* Corresponding author at: Pr. My Mustapha Ennaji, PhD, Laboratory of Virology, Microbiology, and Quality/ETB, Faculty of Sciences and Techniques, Mohammedia, University Hassan II Mohammadia-Casablanca, Mohammedia BP 146, (20650), Morocco. E-mail address: [email protected] (M.M. Ennaji). 0737-0806/$ – see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jevs.2013.10.174
currently considered an important cause of respiratory disease in equines, especially in immunologically naïve populations [1-3]. The Moroccan equine population is approximately 1,610,000, but few studies concerning equine influenza disease are available. The seroepidemiological surveys conducted in Morocco from 1990 to 2010 revealed the following results: during the period 1990 to 1994, there was a predominance of the H7N7 subtype with a seroprevalence rate of 16.9% compared to 8.6% for the H3N8 subtype [4]. In contrast, in 2010, only 10% of the population was seropositive for H7N7 compared to 44% for H3N8 [5]. Nevertheless, studies reported the presence of serological traces of H7N7 virus in many different countries. Indeed, some serological data in the 1990s indicated the
2
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
circulation of H7N7 in horses in central Asia and Eastern Europe [6]. The same data have been reported in Africa, in Mali (2002) and in Algeria (2006) [7,8]. In order to explain the persistence of antibodies against H7N7, two hypotheses are currently discussed: either the virus continues to circulate insidiously or it effectively disappeared after being supplanted by the virus subtype (H3N8) [9]. Currently, the second subtype (H3N8) is the major subtype circulating in the equine population. From 1963 to 1990, this virus had evolved in a single lineage (A/equine/ Fontainebleau/76-like). Thereafter, H3N8 was subdivided into two evolutionary lineages, which were designated European (A/equne/Suffolk/89-like) and American (A/ equine/Newmarket/1/93-like) [10,11]. Both had been found circulating together without geographical limitation. The American lineage has been subdivided into three sublineages: the Florida, Kentucky, and South American sublineages [12]. Currently, the Florida sublineage had evolved into clades 1 and 2. During 2012, several outbreaks were reported in Europe, America, and Asia. The sequencing of HA1 genes of isolated viruses showed their relationship with the American lineage (Florida sublineage clades 1 and 2) (http://www.oie.int/fr/notre-expertise-scientifique/info rmations-specifiques-et-recommandations/grippe-equine/). These variants were obtained from the accumulation of at least 2 amino acid mutations that happened in 2 separate antigenic sites (i.e., antigenic drift) in the gene coding for the hemagglutinin subunit 1 (HA1), which is a major surface protein of equine influenza A viruses [13]. Nevertheless, as with human influenza viruses, the antigenic drift was less pronounced in equine influenza viruses [14]. The antigenicity of the HA of the human H3 influenza A virus subtype has been studied in detail, and the mapping of 5 major antibody binding sites (A–E) have been proposed [15,16]. The antigenic sites may be equivalent to those for equine H3 HA1 [10], because it is believed that human and equine H3 influenza viruses may share a common ancestor [17]. Equine influenza is endemic to Morocco, and circulating virus strains have never been genetically characterized. The first equine influenza virus was isolated in late 1997 from a mule in the Mediterranean side of northeastern Morocco (Nador) and designated A/Equi/Maroc/97. A sporadic outbreak of severe respiratory disease was reported by the local veterinarian [18]. The outbreak started on 28 December 1997 in Nador and did not spread to other parts of the country. This strain caused a severe localized outbreak of the disease in 2 mules which presented with prominent clinical signs consisting mainly of frequent, harsh dyspnea and dry coughing accompanied with high fever. The virus was isolated only from 1 animal and was antigenetically different from both A/equine/Prague/1/56 (H7N7) and A/equine/Miami/1/63 (H3N8), based on hemagglutination-inhibition (HI) testing, and the isolate was characterized with postinfection chicken sera as described previously [19]. No antibody trace against the isolated Moroccan strain A/equi/Maroc/97 was detected at 7 to 9 days. Nevertheless, a significant increase in HI antibody titer against A/equi/Maroc/97 was observed at the late stage of illness (5 weeks). It clearly seems that the antibody titers against the Nador strain were indicative of a recent
equine influenza infection. This outbreak could have been due to the effect of strain variation. In June 2004, three influenza outbreaks infected 70 members of the Equidae family in the northwest districts of the Atlantic coast, resulting in the death of 1 donkey [20], and these outbreaks were limited (Office international des epizooties [OIE], 2004). Two equine influenza A H3N8 virus isolates were identified as the causative strains of equine influenza outbreaks in Essaouira in western Morocco. The isolate identified in a donkey was named A/equine/ Essaouira/2/2004, and the one isolated from a horse was called A/equine/Essaouira/3/2004. The antigenic similarities of these strains and the reference virus A/equine/Miami/1/63 was confirmed (unpublished data). Presently there is no national network survey of equine influenza in Morocco. Therefore, detecting and identifying epidemic variants in real time is not possible. In the present study, antigenic and genetic analysis of the strains isolated from epidemics in 1997 and 2004 led us to characterize them among global equine influenza viruses. 2. Materials and Methods 2.1. Viruses A/Equi/Maroc/1/97 was isolated in Nador from a mule, using 11-day-old specific-pathogen-free chicken eggs as described by Kissi et al [19]. Both A/equine/Essaouira/2/ 2004 and A/equine/Essaouira/3/2004 were isolated from an infected donkey and a horse during the 2004 outbreaks in Essaouira. The isolates were passaged on Madin-Darby canine kidney (MDCK) cells at 34 C in an atmosphere of 5% CO2 in Eagle minimum essential medium supplemented with 5% fetal calf serum [21]. Isolation was confirmed by both HI and RT-PCR assays (M. El Harrak, 2004, unpublished data).
2.2. Viral RNA Extraction and Amplification Viral RNA was extracted directly from isolates using a Purelink viral RNA/DNA mini-kit (Invitrogen, UK) following the manufacturer’s recommended protocol. Complementary DNA was obtained by RT reactions, which were carried out by using a Superscript III reverse transcriptase kit (Invitrogen). PCR was performed using Platinum PCR SuperMix HighFidelity kit (Invitrogen) with cDNA obtained using primers specific for HA1F (CAGGGGATATTTCTGTCAATCATG) HA1R (GCTGCTTGAGTGCTCTTTAGATC), HA2F (ATTACACCAAATG GAAGCATC), and HA2R (AGTAGAAACAAGGGTGTTTTTAAC) at a final concentration of 0.5 mM for primers. Primer design is detailed by Tissier [22] and was synthesized by the Unité d’Appui Technique à la Recherche Scientifique, Centre National de Recherche Scientifique et Technique (CNRST), Rabat, Morocco. The thermal cycle program used consisted of incubation at 95 C for 2 minutes, then 35 cycles of denaturation at 95 C for 30 seconds, 52 C for 1 minute for hybridization of HA1, and 48 C for 1 minute for HA2 primer hybridization, and 72 C for 30 seconds.
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
2.3. Sequencing HA Genes and Phylogenetic Analysis The amplified PCR HA (HA1 and HA2) products were sequenced. Briefly, the PCR products were purified using EXOSAP-IT (USB Corporation, Cleveland, OH, USA) and bidirectionally sequenced by using BigDye1 Terminator version 3.1 (Applied Biosystems, Foster City, CA, USA) on a 3130xl model sequencer (Applied Biosystems). Analysis of the electropherogram was carried out with the sequencing analysis software version 5.3.1 (Applied Biosystems). The HA gene was sequenced with HA1 and HA2, which encode two polypeptides that represent the two subunits of the protein. Subsequently, these sequences were assembled to reconstruct the entire HA; for this purpose, the primers were selected, and the 2 segments were overlapped. We performed phylogenetic analysis of 32 equine influenza strains (including Moroccan isolates) published in GenBank database, selected using the neighbor-joining method [23], in which the A/equine/Miami/63 HA sequence was the root. The tree was visualized using MEGA5.1 software (http://megasoftware.net/) [24]. 2.4. Determination of Amino Acid Sequences of HA1 Genes The analyzed amino acid (aa) region was between positions 21 and 329 (308 aa) of the H3 HA1 gene of A/ equine/Nador/1/1997 and amino acid positions 24 to 329 (305 aa) of the HA1 A/equine/Essaouira/2/2004. HA1 amino acid analyses for A/equine/Essaouira/3/2004 does not include immunodominant region E and consisted only of the region from 115 to 329 (214 aa). To define the amino acid sequence of HA1 Moroccan isolates, multiple alignments of the deduced amino acid sequences were used by Basic Local Alignment Search Tool (BLAST) software. Amino acid substitutions at positions putatively involved in both antigenic and receptor binding sites for the selected equine H3N8 influenza viruses were determined. 3. Results and Discussion HA nucleotide sequences of the Moroccan equine influenza isolates were submitted to GenBank data, and the accession numbers of the A/equine/Nador/1/1997, A/ equine/Essaouira/2/2004, and A/equine/Essaouira/3/2004 partial HA genes are, respectively, JQ955607, JQ955609, and JQ955612. Moroccan HA gene sequence homologies were determined by comparison with 32 published equine influenza strains sequences available in GenBank database, and a phylogenetic tree was obtained (Fig. 1). The analysis was based on HA1 gene sequences. The A/equine/Nador/1/1997 isolate was genetically different from the A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 strains. In addition, strains recovered from Essaouira regions were closely related (>99% similarity) to each other (Fig.1). The A/ equine/Nador/1/1997 strain nucleotide sequence was closer to the sequence of strains circulating in Europe in the late 1990s, such as A/equi2/Avesta/93, A/equine/Grobois/1/ 1998, and A/equine/Brescia/1999 (Fig. 1). The Moroccan strain also is closer to the European equine influenza vaccine
3
Suffolk/89 that was recommended previously. Therefore, A/ equine/Nador/1/1997 was clustered with the Eurasian lineage viruses exhibiting the highest similarity (98%–99%) with the influenza equine viruses isolated in Italy in the early 1990s (i.e., H3N8 A/equine/Rome/5/1991 and A/equine/ Italy/1199/1992) (Fig. 1). There was a high degree of genetic similarity (>99%) among the HA genes from A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 and those of the A/equine/Miami/63 and A/equine/Algiers/1972 strains belonging to the predivergence period. It is noteworthy that HA genes were not closer to either the American (A/equine/Ohio/1/2003) or European (A/eq/Newmarket/2/ 93) vaccine strains currently used in Morocco (Fig. 1). Moreover, the sequencing analysis of the two gene segments NA (accession numbers JQ955610 and JQ955613) and NS (accession numbers JQ955611 and JQ955614) of A/ equine/Essaouira/2/2004 (H3N8) and A/equine/Essaouira/ 2/2004 (H3N8), respectively, revealed a high relatedness (over 99%) to predivergent equine influenza viruses (like Miami/1963). Such results show that the viruses isolated in Essaouira share the same ancestors as the equine influenza (H3N8) virus and that there was no genetic reassortment between co-circulating strains in Morocco. Figure 2 shows that sequence alignment revealed putative N glycosylation sites located at positions 3, 8, 22, 38, 53, 63, 165, and 285 of the A/equine/Nador/1997 HA1 gene that are conserved. Regarding the Essaouira isolates, the sequence alignment reveals that putative N glycosylation sites located at positions 38, 63, 165, and 285 of the A/ equine/Essaouira/2/2004 HA1 gene are conserved. Similar results have occurred for sites located at positions 165 and 285, which also have been conserved for A/equine/ Essaouira/3/2004 (Fig. 3). Sequence analyses of A/equine/Essaouira/3/2004 HA1 revealed that 4 amino acid residues have been changed at consensus positions (Gln/156/Lys, Gly/158/Glu, Ser/227/ Pro, and Trp/278/Val), whereas A/equine/Essaouira/2/2004 had, in addition, 5 more substitutions at consensus positions (Ser/57/Arg, Gly/58/Val, Tyr/76/Cys, Asp/77/Asn, and Gln/156/Lys). Compared to the prototype equine H3N8 influenza virus, two antigenic drifts in the site B1 at position 156 (Gln–Lys) and 158 (Gly–Glu) and in the C2 site at position 278 (Trp– Val) have been found at the antigenic sites of HA1 (Fig. 3). However, sequence analyses of A/equine/Nador/1997 HA1 demonstrated that 6 amino acid substitutions were located at consensus positions of the A/equine/Newmarket/ 2/93 (i.e., Gly/135/Arg, Thr/155/Ile, Glu/207/Gly, Trp/222/ Leu, Lys/259/Arg, and Arg/261/Lys); those substitutions are located in the globular heads of HA (116–261). At antigenic sites of HA1, there was one antigenic drift in the A2 site at position 135 (Gly–Arg), another antigenic mutation appears in the B1 site at position 155 (Gly–Glu), and 1 residue in the D2 site at position 207 (Glu–Gly) was found (Fig. 2). It is obvious that these amino acid subtitutions are located in the sialic acid-binding site at the tip of the HA molecule; therefore, they could affect the ability of the virus to recognize sialic acid linkages. Threonine residue 155 displays a relatively low degree of conservation among the 191 strains studied by Kovacova et al [25]. These strains frequently possessed a hydrophobic
4
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Fig. 1. Phylogenetic analysis of the partial protein sequences of HA1 (1–329 aa) of 32 strains are as follows: A/equine/Miami/1963, AAA43164; A/equine/Essaouira/ 2/2004, AFJ69905; A/equine/Essaouira/3/2004, AFJ69909; A/equine/Algiers/1972, ACF22126; A/equine/Tokyo/2/1971, AEM60147; A/equine/Zagreb/1/1968, AEI26206; A/equine/Uruguay/1/1963, AAA43114; A/equine/Sao Paulo/1/1969, ACD85385; A/equine/Romania/1/1980, ACD85374; A/equine/Fontainbleu/1/1979, ACD85396; A/equine/Kentucky/3/1981, ACA24535; A/equine/Kentucky/1/1987, ACA24568; A/equine/Egypt/6066NAMRU3-VSVRI/2008 (A/equine/Egypt/2008), ACH95682; A/equine/Ohio/1/2003, ABA39846; A/equine/Spain/1/2007, ADO78886; A/equine/Florida/1/93, AAB36978; A/equine/Brno/1/1997, AEI26221; A/equine/ Dubai/48/1995, AEI26218; A/equine/LaPlata/1/93, BAA33947; A/equine/Berlin/13/02, ABP35588; A/equine/Suffolk/89, CAA48482; A/equine/Ibadan/6/91, CAA64893; A/equine/Yvelines/2136/89, BAA33940; A/equi 2/Avesta/93, CAA74385; A/equine/Rome/5/1991, ACD85341; A/equine/Nador/1/1997, AFJ69903; A/equine/Italy/1199/1992, ACD85308; A/equine/Athens/04/2007, ADF55752; A/equine/Newmarket/2/93, CAA59416; A/equine/Aboyne/1/2005, ABP35601; A/equine/Brescia/1999, ABU46321; A/equine/Grobois/1/1998, ACH95594.
residue (V, L, or I) in some H3 strains. The same B1 mutation (T155–I155) has occurred in natural isolates of the H3N2 subtype, as reported by Temoltzin-Palacios and Thomas [26]. All mutations detected for A/equine/Nador/1997 presumably helped the virus to escape from the animal immune system. However, mutations in the receptor binding site can be due to the passage of the virus in MDCK cells and eggs, as well [21]. The Trp/222/Leu, Gln/156/Lys, and Gly/158/Glu mutations were often reported after MDCK or pathogen-free chicken egg passages [27]. In an attempt to understand the origin of A/equine/ Nador/1/1997, retrospective data of equine influenza
outbreaks in the Maghreb region were analyzed. Indeed, at the end of January 1998, outbreaks were reported in Tozeur and Nafta in southern Tunisia. In July 1998, 92 occurrences were confirmed, affecting approximately 1,500 equines in 13 northeastern districts including Bizerte, which includes the Mediterranean port close to the Italian border [28]. Evidence from serological investigations of affected Equidae demonstrates that an A/equine/Nador/1/1997-like strain was circulating in Tunisia. Surviving animals from the Tunisian outbreaks have significant HI titers against this Moroccan strain and not against A/equine/Miami/63 strain or the subtype 1 (H7N7) [28].
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
5
Fig. 2. Amino acid alignment of predicted HA1 (1–329 aa) sequences are compared to those of A/equine/Newmarket/2/93. Antigenic site positions are as follows: A(A1[121,126], A2[131,137]), A3(142,146); B(B1[155,163], B2[186, 199]); C(C1[48,55], C2[273,278]); D(D1[170,174], D2[201,218], D3[242,248]); E(E1[62,63], E2[78,83]). N-linked glycosylation sites are underlined. A/equine/Newmarket/2/93, CAA59416; A/equine/Nador/1/1997, AFJ69903; A/equine/Italy/1199/1992, ACD85308; A/equine/Rome/5/1991, ACD85341; A/equine/Ibadan/6/91, CAA64893; A/equine/Suffolk/89, CAA48482; A/equine/Yvelines/2136/89, BAA33940; A/equine/Sussex/1/1989, ACD97425; A/equine/Berlin/1/1989, AEI26241; A/equine/Grobois/1/1998, ACH95594; A/equine/Brescia/1999, ABU46321; A/equine/ Berlin/13/02, ABP35588; A/equine/2/Avesta/93, CAA74385; A/equine/Aboyne/1/2005, ABP35601; A/equine/Athens/04/2007, ADF55752.
This study demonstrates that a predivergent Miami-like strain was circulating in 2004. Our findings suggest that both the A/equine/Essaouira/2/2004 and A/equine/Essaouira/
3/2004 strains represent an example of “frozen evolution” or “evolutionary stasis,” first described for equine influenza viruses by Endo et al [29]. On the other hand, this evolutionary
6
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Fig. 3. Acid alignment of predicted HA1 (1–329 aa) sequences compared to those of A/equine/Miami/1963 are shown. Antigenic site positions are as follows: A(A1[121,126], A2[131,137], A3[142,146]); B(B1[155,163], B2[186, 199]); C(C1[48,55], C2[273,278]); D(D1[170,174], D2[201,218], D3[242,248]); E(E1[62,63], E2[78,83]). N-linked glycosylation sites are underlined. A/equine/Miami/1963, AAA43164; A/equine/Essaouira/2/2004, AFJ69905; A/equine/Essaouira/3/ 2004, AFJ69909; A/equine/Algiers/1/1972, ACF22126; A/equine/Zagreb/1/1968, AEI26206; A/equine/Tokyo/2/1971, AEM60147; A/equine/Fontainbleu/1/1979, ACD85396; A/equine/Romania/1/1980, ACD85374; A/equine/Sao Paulo/1/1969, ACD85385; A/equine/Kentucky/3/1981, ACA24535.
stasis could be explained by the nature of the Moroccan equine population that usually does not interact with the world’s equine population. Actually, 2 imminent questions are raised: first, does the equine influenza virus (belonging to predivergence phase isolates in 2004) still circulate in Morocco? Second, as we know that the circulation of European lineage strain was demonstrated in Morocco (1997), does an American lineage strain circulate in Morocco? However, without a national network survey of equine influenza, it is extremely difficult to confirm the continuous circulation or the existence of new epidemic variants.
The future purpose requires collaborative laboratories to promote the collection and characterization (antigenic and genetic) of equine influenza viruses. 4. Conclusions In conclusion, to have equine populations with high vaccination coverage, the recommendation used in Morocco for equine influenza vaccines should contain H3N8 strains, representative of both the American and European lineages, and should include in addition the strain from predivergent lineage (i.e., A/equine/Miami/1/63).
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Acknowledgments This study was supported by the University Hassan II, Mohammedia-Casablanca, Faculty of Sciences and Techniques, Mohammedia, Morocco. The authors thank the Inspection de Service de Santé Militaire/Division Vétérinaire staff for their support and the Société Protectrice des Animaux et de la Nature du Maroc for providing facilities to collect serum from equine population. Experimental and protocol designs were performed at Laboratory of Virology, Microbiology and Quality/ETB (Faculty of Sciences and Technics, Mohammedia, University Hassan II Mohammadia-Casablanca). Strain isolations were performed at the Society of Pharmaceutical and Veterinary Products, Virology Laboratory, Rabat, Morocco. HA1 gene sequencing was done at Functional Genomics Platform, Technical Support Unit for Scientific Research, CNRST, and Rabat, Morocco. The authors declare no conflict of interest. References [1] Sovinova O, Tumova B, Pouska F, Nemec J. Isolation of a virus causing respiratory disease in horses. Acta Virol 1985;2:52–61. [2] Waddell GH, Teigland MB, Sigel MM. A new influenza virus associated with equine respiratory disease. J Am Vet Med Assoc 1963; 143:587–90. [3] Myers C, Wilson D. Equine influenza virus. Clin Tech Equine Pract 2006;5:187–96. [4] El Harrak M, Hmidouch A, Chkri A, Ouragh L, Akkari A. Epidemiology of equine influenza in Morocco. Proceedings of the Eighth International Conference on Equine Infectious Diseases, Dubai, United Arab Emirates: 1998. p. 540–542. [5] Boukharta M, El Harrak M, Ennaji MM. Seroepidemiological study on equine influenza in Morocco in 2010. European Journal of Scientific Research 2012;68:147–53. [6] Gibbs EPJ, Anderson TC. Equine and canine influenza: a review of current events. Anim Health Res Rev 2010;11:43–51. [7] Sidibé S, Bocoum Z, Simbé CF, Tounkara K, Bakkali MM. Kané M. Grippe équine au Mali: résultats d’une enquête séro-épidémiologique [Equine influenza in Mali: results of seroepidemiological survey]. Rev Elev Med Vet Pays Trop 2002;55:89–92. [8] Bererhi H, Dib AL, Aimeur R, Kabouia R, Bouaziz O, Kraouchi DE, et al. Enquête sero-épidemiologique de la grippe équine dans la région de khenchela [Seroepidemiological surevy of equine influenza in the khenchela region]. Sciences et Technologie 2006;30:29–33. [9] Zientara S. Epidemiologie moleculaire: l’exemple de la grippe des équidés [Molecular epidemiology: example of the equine influenza]. Epidémiologie et Santé Animale 2001;39:69–74. [10] Daly JM, Lai ACK, Binns MM, Chambers TM, Barrandeguy M, Mumford JA. Antigenic and genetic evolution of equine H3N8 influenza A viruses. J Gen Virol 1996;77:661–71. [11] Martella V, Elia G, Decaro N, Trani LD, Lorusso E, Campolo M, et al. An outbreak of equine influenza virus in vaccinated horses in Italy is due to an H3N8 strain closely related to recent North American representatives of the Florida sub-lineage. Vet Microbiol 2007;121:56–63.
7
[12] Lai ACK, Chambers TM, Holland RE, Morley PS, Haines DM, Townsend HG, et al. Diverged evolution of recent equine-2 influenza (H3N8) viruses in the Western Hemisphere. Arch Virol 2001; 146:1063–74. [13] Jin H, Zhou H, Liu H, Chan W, Adhikary L, Mahmood K, et al. Two residues in the hemagglutinin of A/Fujian/411/02-like influenza viruses are responsible for antigenic drift from A/Panama/2007/99. Virology 2005;336:113–9. [14] Bean WJ, Schell M, Katz J, Kawaoka Y, Naeve C, Gorman O, et al. Evolution of the H3 influenza virus hemagglutinin from human and nonhuman hosts. J Virol 1992;66:1129–38. [15] Wiley DC, Wilson IA, Skehe JJ. Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation. Nature 1981;289:373–8. [16] Wilson IA, Cox NJ. Structural basis of immune recognition of influenza virus hemagglutinin. Annu Rev Immunol 1990;8:737–71. [17] Daniels RS, Skehel JJ, Wiley DC. Amino acid sequences of haemagglutinins of influenza viruses of the H3 subtype isolated from horses. J Gen Virol 1985;66:457–64. [18] National Office for Food Safety (ONSSA). http://www.onssa.gov.ma/ onssa/index.php; 1998 [accessed 10 February 2013]. [19] Kissi B, Daoudi N, El kantour A, Id sidi yahia K, Benazzou H. Premier isolement au Maroc du virus de la grippe équine baptisé A/Equi/Maroc/1/97 [First isolation in the Morocco of the equine influenza virus named A/Equi/Maroc/1/97]. Espace Vétérinaire 1998;14:10. [20] World Organization for Animal Health. World animal health information database (WAHID). http://web.oie.int/wahid. 2004 [accessed 10 February 2013]. [21] World Organization for Animal Health. Manual of standards for diagnostic tests and vaccines 2012. Chapter 2.5.7. http://www.oie. int/fr/normes-internationales/manuel-terrestre/acces-en-ligne/. 2012 [accessed 5 January 2013]. [22] Tissier O. Etude comparative de séquences du virus de la grippe équine en sFrance [Comparative study of the equine influenza virus sequences in French]. Available at: http://www.vetagro-sup.fr/ node/370 (2008). Accessed 15 March 2011. [23] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406–25. [24] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596–9. [25] Kovacova A, Ruttkay-nedecky G, Haverlik IK, Janecek S. Sequence similarities and evolutionary relationships of influenza virus hemagglutinins. Virus Genes 2002;24:57–63. [26] Temoltzin-Palacios F, Thomas DB. Modulation of’ immunodominant sites in influenza hemagglutinin compromise antigenic variation and select receptor-binding variant viruses. J Exp Med 1994;179: 1719–24. [27] Ilobi CP, Henfrey R, Robertson JS, Mumford JA, Erasmus BJ, Wood JM. Antigenic and molecular characterization of host cell-mediated variants of equine H3N8 influenza viruses. J Gen Virol 1994;75: 669–73. [28] Chabchoub A, Landolsi F, Zientara S, Amira A, Mejri M, Ghorbel A, et al. A propos d’une épizootie de grippe équine survenue en Tunisie [About an outbreak of equine influenza in Tunisia]. Archs Inst Pasteur Tunis 2001;78:69–73. [29] Borchers K, Daly J, Stiens G, Kreling K, Kreling I, Ludwig H. Characterisation of three equine influenza A H3N8 viruses from Germany (2000 and 2002): evidence for frozen evolution. Vet Microbiol 2005;107:13–21.
Contents lists available at ScienceDirect
Journal of Equine Veterinary Science journal homepage: www.j-evs.com
Original Research
Phylogenetic and Molecular Characterization of the Equine Influenza Virus A (H3N8) Causing the 1997 and 2004 Outbreaks in Morocco Mohamed Boukharta DVM a, Nadia Touil PhD b, Elmostafa El Fahim PhD c, Meriame Terta PhD a, Bachir Kissi DVM d, Chafiqua Loutfi MS d, Mehdi El Harrak DVM, PhD d, My Mustapha Ennaji PhD, PROF a, * a
Laboratory of Virology, Microbiology, and Quality/ETB, Faculty of Sciences and Techniques, Mohammedia, University Hassan II Mohammadia-Casablanca, Morocco b Department of Biology, Instruction Military Hospital Med V Rabat, University Mohammed V Souissi, Rabat, Morocco c Functional Genomics Platform, Technical Support Unit for Scientific Research, CNRST, Rabat, Morocco d Society of Pharmaceutical and Veterinary Products, Virology Laboratory, Rabat, Morocco
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 June 2013 Received in revised form 1 October 2013 Accepted 17 October 2013 Available online xxxx
Reported here are the results of antigenic and genetic characterization of equine influenza strains causing local outbreaks reported in Morocco, respectively, in 1997 and 2004. The antigenic and genetic characterizations of the equine influenza virus H3N8 are reported here. The highest similarity between the HA1 nucleotide sequences of A/equine/Nador/1/ 1997 and those of A/equine/Rome/5/1991 and A/equine/Italy/1199/1992 demonstrate that A/equine/Nador/1/1997 belongs to the European lineage. On the other hand, A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 were classified in the predivergent lineage. The present work emphasizes the importance of a national influenza survey program, which requires a collaborative laboratory network to promote the collection and characterization (antigenic and genetic) of equine influenza viruses in real time. Ó 2013 Elsevier Inc. All rights reserved.
Keywords: Equine influenza virus A/equine/Nador/1/1997 A/equine/Essaouira/2/2004 A/equine/Essaouira/3/2004 Predivergent lineage circulation Morocco
1. Introduction Equine influenza virus belongs to the family Orthomyxovirus, genus Influenzavirus A, species Influenza A virus and encloses a multisegmented negative strand RNA genome. Equine influenza is caused by two subtypes of influenza viruses: H7N7 (prototype A/equine/Prague/1/57), which has been considered extinct since 1979, and H3N8 (prototype A/equine/Miami/1/63). The second type is
* Corresponding author at: Pr. My Mustapha Ennaji, PhD, Laboratory of Virology, Microbiology, and Quality/ETB, Faculty of Sciences and Techniques, Mohammedia, University Hassan II Mohammadia-Casablanca, Mohammedia BP 146, (20650), Morocco. E-mail address: [email protected] (M.M. Ennaji). 0737-0806/$ – see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jevs.2013.10.174
currently considered an important cause of respiratory disease in equines, especially in immunologically naïve populations [1-3]. The Moroccan equine population is approximately 1,610,000, but few studies concerning equine influenza disease are available. The seroepidemiological surveys conducted in Morocco from 1990 to 2010 revealed the following results: during the period 1990 to 1994, there was a predominance of the H7N7 subtype with a seroprevalence rate of 16.9% compared to 8.6% for the H3N8 subtype [4]. In contrast, in 2010, only 10% of the population was seropositive for H7N7 compared to 44% for H3N8 [5]. Nevertheless, studies reported the presence of serological traces of H7N7 virus in many different countries. Indeed, some serological data in the 1990s indicated the
2
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
circulation of H7N7 in horses in central Asia and Eastern Europe [6]. The same data have been reported in Africa, in Mali (2002) and in Algeria (2006) [7,8]. In order to explain the persistence of antibodies against H7N7, two hypotheses are currently discussed: either the virus continues to circulate insidiously or it effectively disappeared after being supplanted by the virus subtype (H3N8) [9]. Currently, the second subtype (H3N8) is the major subtype circulating in the equine population. From 1963 to 1990, this virus had evolved in a single lineage (A/equine/ Fontainebleau/76-like). Thereafter, H3N8 was subdivided into two evolutionary lineages, which were designated European (A/equne/Suffolk/89-like) and American (A/ equine/Newmarket/1/93-like) [10,11]. Both had been found circulating together without geographical limitation. The American lineage has been subdivided into three sublineages: the Florida, Kentucky, and South American sublineages [12]. Currently, the Florida sublineage had evolved into clades 1 and 2. During 2012, several outbreaks were reported in Europe, America, and Asia. The sequencing of HA1 genes of isolated viruses showed their relationship with the American lineage (Florida sublineage clades 1 and 2) (http://www.oie.int/fr/notre-expertise-scientifique/info rmations-specifiques-et-recommandations/grippe-equine/). These variants were obtained from the accumulation of at least 2 amino acid mutations that happened in 2 separate antigenic sites (i.e., antigenic drift) in the gene coding for the hemagglutinin subunit 1 (HA1), which is a major surface protein of equine influenza A viruses [13]. Nevertheless, as with human influenza viruses, the antigenic drift was less pronounced in equine influenza viruses [14]. The antigenicity of the HA of the human H3 influenza A virus subtype has been studied in detail, and the mapping of 5 major antibody binding sites (A–E) have been proposed [15,16]. The antigenic sites may be equivalent to those for equine H3 HA1 [10], because it is believed that human and equine H3 influenza viruses may share a common ancestor [17]. Equine influenza is endemic to Morocco, and circulating virus strains have never been genetically characterized. The first equine influenza virus was isolated in late 1997 from a mule in the Mediterranean side of northeastern Morocco (Nador) and designated A/Equi/Maroc/97. A sporadic outbreak of severe respiratory disease was reported by the local veterinarian [18]. The outbreak started on 28 December 1997 in Nador and did not spread to other parts of the country. This strain caused a severe localized outbreak of the disease in 2 mules which presented with prominent clinical signs consisting mainly of frequent, harsh dyspnea and dry coughing accompanied with high fever. The virus was isolated only from 1 animal and was antigenetically different from both A/equine/Prague/1/56 (H7N7) and A/equine/Miami/1/63 (H3N8), based on hemagglutination-inhibition (HI) testing, and the isolate was characterized with postinfection chicken sera as described previously [19]. No antibody trace against the isolated Moroccan strain A/equi/Maroc/97 was detected at 7 to 9 days. Nevertheless, a significant increase in HI antibody titer against A/equi/Maroc/97 was observed at the late stage of illness (5 weeks). It clearly seems that the antibody titers against the Nador strain were indicative of a recent
equine influenza infection. This outbreak could have been due to the effect of strain variation. In June 2004, three influenza outbreaks infected 70 members of the Equidae family in the northwest districts of the Atlantic coast, resulting in the death of 1 donkey [20], and these outbreaks were limited (Office international des epizooties [OIE], 2004). Two equine influenza A H3N8 virus isolates were identified as the causative strains of equine influenza outbreaks in Essaouira in western Morocco. The isolate identified in a donkey was named A/equine/ Essaouira/2/2004, and the one isolated from a horse was called A/equine/Essaouira/3/2004. The antigenic similarities of these strains and the reference virus A/equine/Miami/1/63 was confirmed (unpublished data). Presently there is no national network survey of equine influenza in Morocco. Therefore, detecting and identifying epidemic variants in real time is not possible. In the present study, antigenic and genetic analysis of the strains isolated from epidemics in 1997 and 2004 led us to characterize them among global equine influenza viruses. 2. Materials and Methods 2.1. Viruses A/Equi/Maroc/1/97 was isolated in Nador from a mule, using 11-day-old specific-pathogen-free chicken eggs as described by Kissi et al [19]. Both A/equine/Essaouira/2/ 2004 and A/equine/Essaouira/3/2004 were isolated from an infected donkey and a horse during the 2004 outbreaks in Essaouira. The isolates were passaged on Madin-Darby canine kidney (MDCK) cells at 34 C in an atmosphere of 5% CO2 in Eagle minimum essential medium supplemented with 5% fetal calf serum [21]. Isolation was confirmed by both HI and RT-PCR assays (M. El Harrak, 2004, unpublished data).
2.2. Viral RNA Extraction and Amplification Viral RNA was extracted directly from isolates using a Purelink viral RNA/DNA mini-kit (Invitrogen, UK) following the manufacturer’s recommended protocol. Complementary DNA was obtained by RT reactions, which were carried out by using a Superscript III reverse transcriptase kit (Invitrogen). PCR was performed using Platinum PCR SuperMix HighFidelity kit (Invitrogen) with cDNA obtained using primers specific for HA1F (CAGGGGATATTTCTGTCAATCATG) HA1R (GCTGCTTGAGTGCTCTTTAGATC), HA2F (ATTACACCAAATG GAAGCATC), and HA2R (AGTAGAAACAAGGGTGTTTTTAAC) at a final concentration of 0.5 mM for primers. Primer design is detailed by Tissier [22] and was synthesized by the Unité d’Appui Technique à la Recherche Scientifique, Centre National de Recherche Scientifique et Technique (CNRST), Rabat, Morocco. The thermal cycle program used consisted of incubation at 95 C for 2 minutes, then 35 cycles of denaturation at 95 C for 30 seconds, 52 C for 1 minute for hybridization of HA1, and 48 C for 1 minute for HA2 primer hybridization, and 72 C for 30 seconds.
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
2.3. Sequencing HA Genes and Phylogenetic Analysis The amplified PCR HA (HA1 and HA2) products were sequenced. Briefly, the PCR products were purified using EXOSAP-IT (USB Corporation, Cleveland, OH, USA) and bidirectionally sequenced by using BigDye1 Terminator version 3.1 (Applied Biosystems, Foster City, CA, USA) on a 3130xl model sequencer (Applied Biosystems). Analysis of the electropherogram was carried out with the sequencing analysis software version 5.3.1 (Applied Biosystems). The HA gene was sequenced with HA1 and HA2, which encode two polypeptides that represent the two subunits of the protein. Subsequently, these sequences were assembled to reconstruct the entire HA; for this purpose, the primers were selected, and the 2 segments were overlapped. We performed phylogenetic analysis of 32 equine influenza strains (including Moroccan isolates) published in GenBank database, selected using the neighbor-joining method [23], in which the A/equine/Miami/63 HA sequence was the root. The tree was visualized using MEGA5.1 software (http://megasoftware.net/) [24]. 2.4. Determination of Amino Acid Sequences of HA1 Genes The analyzed amino acid (aa) region was between positions 21 and 329 (308 aa) of the H3 HA1 gene of A/ equine/Nador/1/1997 and amino acid positions 24 to 329 (305 aa) of the HA1 A/equine/Essaouira/2/2004. HA1 amino acid analyses for A/equine/Essaouira/3/2004 does not include immunodominant region E and consisted only of the region from 115 to 329 (214 aa). To define the amino acid sequence of HA1 Moroccan isolates, multiple alignments of the deduced amino acid sequences were used by Basic Local Alignment Search Tool (BLAST) software. Amino acid substitutions at positions putatively involved in both antigenic and receptor binding sites for the selected equine H3N8 influenza viruses were determined. 3. Results and Discussion HA nucleotide sequences of the Moroccan equine influenza isolates were submitted to GenBank data, and the accession numbers of the A/equine/Nador/1/1997, A/ equine/Essaouira/2/2004, and A/equine/Essaouira/3/2004 partial HA genes are, respectively, JQ955607, JQ955609, and JQ955612. Moroccan HA gene sequence homologies were determined by comparison with 32 published equine influenza strains sequences available in GenBank database, and a phylogenetic tree was obtained (Fig. 1). The analysis was based on HA1 gene sequences. The A/equine/Nador/1/1997 isolate was genetically different from the A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 strains. In addition, strains recovered from Essaouira regions were closely related (>99% similarity) to each other (Fig.1). The A/ equine/Nador/1/1997 strain nucleotide sequence was closer to the sequence of strains circulating in Europe in the late 1990s, such as A/equi2/Avesta/93, A/equine/Grobois/1/ 1998, and A/equine/Brescia/1999 (Fig. 1). The Moroccan strain also is closer to the European equine influenza vaccine
3
Suffolk/89 that was recommended previously. Therefore, A/ equine/Nador/1/1997 was clustered with the Eurasian lineage viruses exhibiting the highest similarity (98%–99%) with the influenza equine viruses isolated in Italy in the early 1990s (i.e., H3N8 A/equine/Rome/5/1991 and A/equine/ Italy/1199/1992) (Fig. 1). There was a high degree of genetic similarity (>99%) among the HA genes from A/equine/ Essaouira/2/2004 and A/equine/Essaouira/3/2004 and those of the A/equine/Miami/63 and A/equine/Algiers/1972 strains belonging to the predivergence period. It is noteworthy that HA genes were not closer to either the American (A/equine/Ohio/1/2003) or European (A/eq/Newmarket/2/ 93) vaccine strains currently used in Morocco (Fig. 1). Moreover, the sequencing analysis of the two gene segments NA (accession numbers JQ955610 and JQ955613) and NS (accession numbers JQ955611 and JQ955614) of A/ equine/Essaouira/2/2004 (H3N8) and A/equine/Essaouira/ 2/2004 (H3N8), respectively, revealed a high relatedness (over 99%) to predivergent equine influenza viruses (like Miami/1963). Such results show that the viruses isolated in Essaouira share the same ancestors as the equine influenza (H3N8) virus and that there was no genetic reassortment between co-circulating strains in Morocco. Figure 2 shows that sequence alignment revealed putative N glycosylation sites located at positions 3, 8, 22, 38, 53, 63, 165, and 285 of the A/equine/Nador/1997 HA1 gene that are conserved. Regarding the Essaouira isolates, the sequence alignment reveals that putative N glycosylation sites located at positions 38, 63, 165, and 285 of the A/ equine/Essaouira/2/2004 HA1 gene are conserved. Similar results have occurred for sites located at positions 165 and 285, which also have been conserved for A/equine/ Essaouira/3/2004 (Fig. 3). Sequence analyses of A/equine/Essaouira/3/2004 HA1 revealed that 4 amino acid residues have been changed at consensus positions (Gln/156/Lys, Gly/158/Glu, Ser/227/ Pro, and Trp/278/Val), whereas A/equine/Essaouira/2/2004 had, in addition, 5 more substitutions at consensus positions (Ser/57/Arg, Gly/58/Val, Tyr/76/Cys, Asp/77/Asn, and Gln/156/Lys). Compared to the prototype equine H3N8 influenza virus, two antigenic drifts in the site B1 at position 156 (Gln–Lys) and 158 (Gly–Glu) and in the C2 site at position 278 (Trp– Val) have been found at the antigenic sites of HA1 (Fig. 3). However, sequence analyses of A/equine/Nador/1997 HA1 demonstrated that 6 amino acid substitutions were located at consensus positions of the A/equine/Newmarket/ 2/93 (i.e., Gly/135/Arg, Thr/155/Ile, Glu/207/Gly, Trp/222/ Leu, Lys/259/Arg, and Arg/261/Lys); those substitutions are located in the globular heads of HA (116–261). At antigenic sites of HA1, there was one antigenic drift in the A2 site at position 135 (Gly–Arg), another antigenic mutation appears in the B1 site at position 155 (Gly–Glu), and 1 residue in the D2 site at position 207 (Glu–Gly) was found (Fig. 2). It is obvious that these amino acid subtitutions are located in the sialic acid-binding site at the tip of the HA molecule; therefore, they could affect the ability of the virus to recognize sialic acid linkages. Threonine residue 155 displays a relatively low degree of conservation among the 191 strains studied by Kovacova et al [25]. These strains frequently possessed a hydrophobic
4
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Fig. 1. Phylogenetic analysis of the partial protein sequences of HA1 (1–329 aa) of 32 strains are as follows: A/equine/Miami/1963, AAA43164; A/equine/Essaouira/ 2/2004, AFJ69905; A/equine/Essaouira/3/2004, AFJ69909; A/equine/Algiers/1972, ACF22126; A/equine/Tokyo/2/1971, AEM60147; A/equine/Zagreb/1/1968, AEI26206; A/equine/Uruguay/1/1963, AAA43114; A/equine/Sao Paulo/1/1969, ACD85385; A/equine/Romania/1/1980, ACD85374; A/equine/Fontainbleu/1/1979, ACD85396; A/equine/Kentucky/3/1981, ACA24535; A/equine/Kentucky/1/1987, ACA24568; A/equine/Egypt/6066NAMRU3-VSVRI/2008 (A/equine/Egypt/2008), ACH95682; A/equine/Ohio/1/2003, ABA39846; A/equine/Spain/1/2007, ADO78886; A/equine/Florida/1/93, AAB36978; A/equine/Brno/1/1997, AEI26221; A/equine/ Dubai/48/1995, AEI26218; A/equine/LaPlata/1/93, BAA33947; A/equine/Berlin/13/02, ABP35588; A/equine/Suffolk/89, CAA48482; A/equine/Ibadan/6/91, CAA64893; A/equine/Yvelines/2136/89, BAA33940; A/equi 2/Avesta/93, CAA74385; A/equine/Rome/5/1991, ACD85341; A/equine/Nador/1/1997, AFJ69903; A/equine/Italy/1199/1992, ACD85308; A/equine/Athens/04/2007, ADF55752; A/equine/Newmarket/2/93, CAA59416; A/equine/Aboyne/1/2005, ABP35601; A/equine/Brescia/1999, ABU46321; A/equine/Grobois/1/1998, ACH95594.
residue (V, L, or I) in some H3 strains. The same B1 mutation (T155–I155) has occurred in natural isolates of the H3N2 subtype, as reported by Temoltzin-Palacios and Thomas [26]. All mutations detected for A/equine/Nador/1997 presumably helped the virus to escape from the animal immune system. However, mutations in the receptor binding site can be due to the passage of the virus in MDCK cells and eggs, as well [21]. The Trp/222/Leu, Gln/156/Lys, and Gly/158/Glu mutations were often reported after MDCK or pathogen-free chicken egg passages [27]. In an attempt to understand the origin of A/equine/ Nador/1/1997, retrospective data of equine influenza
outbreaks in the Maghreb region were analyzed. Indeed, at the end of January 1998, outbreaks were reported in Tozeur and Nafta in southern Tunisia. In July 1998, 92 occurrences were confirmed, affecting approximately 1,500 equines in 13 northeastern districts including Bizerte, which includes the Mediterranean port close to the Italian border [28]. Evidence from serological investigations of affected Equidae demonstrates that an A/equine/Nador/1/1997-like strain was circulating in Tunisia. Surviving animals from the Tunisian outbreaks have significant HI titers against this Moroccan strain and not against A/equine/Miami/63 strain or the subtype 1 (H7N7) [28].
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
5
Fig. 2. Amino acid alignment of predicted HA1 (1–329 aa) sequences are compared to those of A/equine/Newmarket/2/93. Antigenic site positions are as follows: A(A1[121,126], A2[131,137]), A3(142,146); B(B1[155,163], B2[186, 199]); C(C1[48,55], C2[273,278]); D(D1[170,174], D2[201,218], D3[242,248]); E(E1[62,63], E2[78,83]). N-linked glycosylation sites are underlined. A/equine/Newmarket/2/93, CAA59416; A/equine/Nador/1/1997, AFJ69903; A/equine/Italy/1199/1992, ACD85308; A/equine/Rome/5/1991, ACD85341; A/equine/Ibadan/6/91, CAA64893; A/equine/Suffolk/89, CAA48482; A/equine/Yvelines/2136/89, BAA33940; A/equine/Sussex/1/1989, ACD97425; A/equine/Berlin/1/1989, AEI26241; A/equine/Grobois/1/1998, ACH95594; A/equine/Brescia/1999, ABU46321; A/equine/ Berlin/13/02, ABP35588; A/equine/2/Avesta/93, CAA74385; A/equine/Aboyne/1/2005, ABP35601; A/equine/Athens/04/2007, ADF55752.
This study demonstrates that a predivergent Miami-like strain was circulating in 2004. Our findings suggest that both the A/equine/Essaouira/2/2004 and A/equine/Essaouira/
3/2004 strains represent an example of “frozen evolution” or “evolutionary stasis,” first described for equine influenza viruses by Endo et al [29]. On the other hand, this evolutionary
6
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Fig. 3. Acid alignment of predicted HA1 (1–329 aa) sequences compared to those of A/equine/Miami/1963 are shown. Antigenic site positions are as follows: A(A1[121,126], A2[131,137], A3[142,146]); B(B1[155,163], B2[186, 199]); C(C1[48,55], C2[273,278]); D(D1[170,174], D2[201,218], D3[242,248]); E(E1[62,63], E2[78,83]). N-linked glycosylation sites are underlined. A/equine/Miami/1963, AAA43164; A/equine/Essaouira/2/2004, AFJ69905; A/equine/Essaouira/3/ 2004, AFJ69909; A/equine/Algiers/1/1972, ACF22126; A/equine/Zagreb/1/1968, AEI26206; A/equine/Tokyo/2/1971, AEM60147; A/equine/Fontainbleu/1/1979, ACD85396; A/equine/Romania/1/1980, ACD85374; A/equine/Sao Paulo/1/1969, ACD85385; A/equine/Kentucky/3/1981, ACA24535.
stasis could be explained by the nature of the Moroccan equine population that usually does not interact with the world’s equine population. Actually, 2 imminent questions are raised: first, does the equine influenza virus (belonging to predivergence phase isolates in 2004) still circulate in Morocco? Second, as we know that the circulation of European lineage strain was demonstrated in Morocco (1997), does an American lineage strain circulate in Morocco? However, without a national network survey of equine influenza, it is extremely difficult to confirm the continuous circulation or the existence of new epidemic variants.
The future purpose requires collaborative laboratories to promote the collection and characterization (antigenic and genetic) of equine influenza viruses. 4. Conclusions In conclusion, to have equine populations with high vaccination coverage, the recommendation used in Morocco for equine influenza vaccines should contain H3N8 strains, representative of both the American and European lineages, and should include in addition the strain from predivergent lineage (i.e., A/equine/Miami/1/63).
M. Boukharta et al. / Journal of Equine Veterinary Science xx (2013) 1–7
Acknowledgments This study was supported by the University Hassan II, Mohammedia-Casablanca, Faculty of Sciences and Techniques, Mohammedia, Morocco. The authors thank the Inspection de Service de Santé Militaire/Division Vétérinaire staff for their support and the Société Protectrice des Animaux et de la Nature du Maroc for providing facilities to collect serum from equine population. Experimental and protocol designs were performed at Laboratory of Virology, Microbiology and Quality/ETB (Faculty of Sciences and Technics, Mohammedia, University Hassan II Mohammadia-Casablanca). Strain isolations were performed at the Society of Pharmaceutical and Veterinary Products, Virology Laboratory, Rabat, Morocco. HA1 gene sequencing was done at Functional Genomics Platform, Technical Support Unit for Scientific Research, CNRST, and Rabat, Morocco. The authors declare no conflict of interest. References [1] Sovinova O, Tumova B, Pouska F, Nemec J. Isolation of a virus causing respiratory disease in horses. Acta Virol 1985;2:52–61. [2] Waddell GH, Teigland MB, Sigel MM. A new influenza virus associated with equine respiratory disease. J Am Vet Med Assoc 1963; 143:587–90. [3] Myers C, Wilson D. Equine influenza virus. Clin Tech Equine Pract 2006;5:187–96. [4] El Harrak M, Hmidouch A, Chkri A, Ouragh L, Akkari A. Epidemiology of equine influenza in Morocco. Proceedings of the Eighth International Conference on Equine Infectious Diseases, Dubai, United Arab Emirates: 1998. p. 540–542. [5] Boukharta M, El Harrak M, Ennaji MM. Seroepidemiological study on equine influenza in Morocco in 2010. European Journal of Scientific Research 2012;68:147–53. [6] Gibbs EPJ, Anderson TC. Equine and canine influenza: a review of current events. Anim Health Res Rev 2010;11:43–51. [7] Sidibé S, Bocoum Z, Simbé CF, Tounkara K, Bakkali MM. Kané M. Grippe équine au Mali: résultats d’une enquête séro-épidémiologique [Equine influenza in Mali: results of seroepidemiological survey]. Rev Elev Med Vet Pays Trop 2002;55:89–92. [8] Bererhi H, Dib AL, Aimeur R, Kabouia R, Bouaziz O, Kraouchi DE, et al. Enquête sero-épidemiologique de la grippe équine dans la région de khenchela [Seroepidemiological surevy of equine influenza in the khenchela region]. Sciences et Technologie 2006;30:29–33. [9] Zientara S. Epidemiologie moleculaire: l’exemple de la grippe des équidés [Molecular epidemiology: example of the equine influenza]. Epidémiologie et Santé Animale 2001;39:69–74. [10] Daly JM, Lai ACK, Binns MM, Chambers TM, Barrandeguy M, Mumford JA. Antigenic and genetic evolution of equine H3N8 influenza A viruses. J Gen Virol 1996;77:661–71. [11] Martella V, Elia G, Decaro N, Trani LD, Lorusso E, Campolo M, et al. An outbreak of equine influenza virus in vaccinated horses in Italy is due to an H3N8 strain closely related to recent North American representatives of the Florida sub-lineage. Vet Microbiol 2007;121:56–63.
7
[12] Lai ACK, Chambers TM, Holland RE, Morley PS, Haines DM, Townsend HG, et al. Diverged evolution of recent equine-2 influenza (H3N8) viruses in the Western Hemisphere. Arch Virol 2001; 146:1063–74. [13] Jin H, Zhou H, Liu H, Chan W, Adhikary L, Mahmood K, et al. Two residues in the hemagglutinin of A/Fujian/411/02-like influenza viruses are responsible for antigenic drift from A/Panama/2007/99. Virology 2005;336:113–9. [14] Bean WJ, Schell M, Katz J, Kawaoka Y, Naeve C, Gorman O, et al. Evolution of the H3 influenza virus hemagglutinin from human and nonhuman hosts. J Virol 1992;66:1129–38. [15] Wiley DC, Wilson IA, Skehe JJ. Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation. Nature 1981;289:373–8. [16] Wilson IA, Cox NJ. Structural basis of immune recognition of influenza virus hemagglutinin. Annu Rev Immunol 1990;8:737–71. [17] Daniels RS, Skehel JJ, Wiley DC. Amino acid sequences of haemagglutinins of influenza viruses of the H3 subtype isolated from horses. J Gen Virol 1985;66:457–64. [18] National Office for Food Safety (ONSSA). http://www.onssa.gov.ma/ onssa/index.php; 1998 [accessed 10 February 2013]. [19] Kissi B, Daoudi N, El kantour A, Id sidi yahia K, Benazzou H. Premier isolement au Maroc du virus de la grippe équine baptisé A/Equi/Maroc/1/97 [First isolation in the Morocco of the equine influenza virus named A/Equi/Maroc/1/97]. Espace Vétérinaire 1998;14:10. [20] World Organization for Animal Health. World animal health information database (WAHID). http://web.oie.int/wahid. 2004 [accessed 10 February 2013]. [21] World Organization for Animal Health. Manual of standards for diagnostic tests and vaccines 2012. Chapter 2.5.7. http://www.oie. int/fr/normes-internationales/manuel-terrestre/acces-en-ligne/. 2012 [accessed 5 January 2013]. [22] Tissier O. Etude comparative de séquences du virus de la grippe équine en sFrance [Comparative study of the equine influenza virus sequences in French]. Available at: http://www.vetagro-sup.fr/ node/370 (2008). Accessed 15 March 2011. [23] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406–25. [24] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596–9. [25] Kovacova A, Ruttkay-nedecky G, Haverlik IK, Janecek S. Sequence similarities and evolutionary relationships of influenza virus hemagglutinins. Virus Genes 2002;24:57–63. [26] Temoltzin-Palacios F, Thomas DB. Modulation of’ immunodominant sites in influenza hemagglutinin compromise antigenic variation and select receptor-binding variant viruses. J Exp Med 1994;179: 1719–24. [27] Ilobi CP, Henfrey R, Robertson JS, Mumford JA, Erasmus BJ, Wood JM. Antigenic and molecular characterization of host cell-mediated variants of equine H3N8 influenza viruses. J Gen Virol 1994;75: 669–73. [28] Chabchoub A, Landolsi F, Zientara S, Amira A, Mejri M, Ghorbel A, et al. A propos d’une épizootie de grippe équine survenue en Tunisie [About an outbreak of equine influenza in Tunisia]. Archs Inst Pasteur Tunis 2001;78:69–73. [29] Borchers K, Daly J, Stiens G, Kreling K, Kreling I, Ludwig H. Characterisation of three equine influenza A H3N8 viruses from Germany (2000 and 2002): evidence for frozen evolution. Vet Microbiol 2005;107:13–21.