- Email: [email protected]
No Association between Factor V Leiden Mutation and Coronary Heart Disease or Carotid Intima Media Thickness
Thrombosis Research 89 (1998) 289–293
BRIEF COMMUNICATION
No Association between Factor V Leiden Mutation and Coronary Heart Disease or Carotid Intima Media Thickness: The NHLBI Family Heart Study Uttam C. Garg1, Donna K. Arnett2, Greg Evans3 and John H. Eckfeldt1 Department of Laboratory Medicine and Pathology, School of Medicine, and 2 Division of Epidemiology, School of Public Health, University of Minnesota, Minneapolis, MN, USA; 3 Department of Public Health Sciences, Bowman Gray School of Medicine, Winston-Salem, NC, USA.
1
(Received 7 November 1997, by Editor G. M. Rodgers; revised/accepted 8 January 1998)
Key Words: Factor V Leiden mutation; Resistance to protein C; Carotid intima media thickness; Coronary heart disease
R
esistance to activated protein C resulting from a single point mutation (G1691 to A; Arg 506 to Gln) in the factor V gene is a major cause of venous thrombosis, particularly in young adults [1–3]. The mutation abolishes the cleavage site for activated protein C in the factor V molecule, rendering factor V resistant to subsequent inactivation by activated protein C. Several studies demonstrate that resistance to activated protein C is the most common cause of venous thromboembolism. The prevalence of the mutation is approximately 5% in the general population and 30–50% in individuals with a family history of venous thrombosis [2–5]. While the role of activated protein C resistance in venous thrombosis is established, the relationship of factor V to coronary heart disease (CHD) is less well understood [6–10]. To the best of our knowledge, the association of the point mutation (Arg 506 to Gln) in factor V with subclinical meaAbbreviations : CHD, coronary heart disease; FHS, Family Heart Study; LDC, low density lipoprotein; HDL, high density lipoprotein; SAS, Statistical Analysis System. Corresponding author : Dr. Donna Arnett, Division of Epidemiology, University of Minnesota, 1300 South Second Street, Suite 300, Minneapolis, MN, USA 55454–1015. Fax: 612–624–0315; E-mail: ,[email protected]..
sures of atherosclerosis has not yet been examined. In the present study, we evaluated the relationship between cardiovascular risk factors, early onset CHD and carotid artery intima-media thickness to the factor V Leiden mutation.
1. Materials and Methods 1.1. Methods 1.1.1. Selection of Study Subjects Data for this study were collected as part of the NHLBI Family Heart Study (FHS). FHS is designed to investigate genetic and nongenetic determinants of CHD, atherosclerosis, and cardiovascular risk factors [11]. The sample of 1292 adults consists of: 1) sibships in which at least two of the siblings are CHD affected full sibs (n5243 sibs); 2) sibships in which at least one sibling is above the 90th percentile of the distribution of carotid artery intima media thickness (n5231 sibs); 3) sibships with at least two full siblings at or above the age-sex specific 80th percentile of the Individual Risk Score (a score derived for each individual using sex-specific proportional hazards models to predict the age-of-onset of CHD, based on carotid artery intima media thickness, lipids, body mass index, blood pressure, hypertension, diabetes, and a CHD family history score) (n51090 sibs); and 4) randomly
0049-3848/98 $19.00 1 .00 1998 Elsevier Science Ltd. Printed in the USA. All rights reserved. PII S0049-3848(98)00019-X
290
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
selected, unrelated subjects (n5185) (note: the above sampling did not result in mutually exclusive categories). Physiologic Measurements: Blood pressure measurements were taken after a five minute rest with a random zero sphygmomanometer. Height and weight were measured and body mass index calculated as weight (kg) divided by height (m2). Smoking status was based on self report. Low density lipoprotein (LDL) and high density lipoprotein (HDL) cholesterol and fibrinogen were measured using standard techniques. Carotid B-mode ultrasound examinations were performed with a Biosound Phase II using a common scanning protocol at each of the field centers; readings were done at a central reading center. Measurements of intimamedia thickness were derived in the far wall of three segments of the right and left extracranial carotid arteries: 1) the common carotid artery (one centimeter proximal to the dilation of the carotid bulb); 2) the bifurcation (the one centimeter segment proximal to the flow divider); and 3) the internal carotid artery (the one centimeter segment in the internal branch distal to the flow divider). Eleven contiguous measurements (one millimeter each) were attempted in each of the six segments. The overall average value of the mean wall thickness at the six segments combined was calculated and used in the analysis. CHD events were validated using medical record confirmation of myocardial infarction or revascularization procedure (angioplasty or coronary artery bypass grafting). Because thrombotic factors are likely to be particularly important in younger individuals, early onset CHD was considered, and was defined by age-ofonset of CHD before age 55 years in men or 65 years in women.
1.1.2. Factor V Leiden Genotyping Factor V genotyping was done as described by Bertina et al. [16] with modifications. A 192 bp DNA fragment spanning the mutation locus at position 1691 was amplified by polymerase chain reaction (PCR) using sense primer (59CCAGTGCTTAACAAGACCATA39) and antisense primer (59GCCAGGAGACCTAACATGTT39). The primers used were synthesized on a DNA synthesizer (Model ABI 394, Applied Biosystems, Inc., Foster City, CA) by the Microchemical Facility at the University of Minnesota and purified
by HPLC. PCR reactions were carried out with approximately 50 ng of genomic DNA and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) in a volume of 50 mL, containing 10 mmol/L Tris (pH 5 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, 0.2 mmol/L of all four deoxynucleoside triphosphates and 0.2 mmol/L of each primer. After denaturation for 3 min at 958C, temperature was cycled 30 times (958C, 1 min; 608C, 2 min; and 728C, 1 min) followed by extension at 728C for 3 min to amplify the target DNA (Ericomp Twin BlockE System, Easy CyclerE Series, Ericomp Inc., San Diego, CA). To verify amplification, the PCR products were electrophoresed on a 2% low melting point agarose gel (NuSieve GTG; FMC Bioproducts) containing ethidium bromide. To distinguish between the presence or absence of factor V Leiden mutation, the PCR product was digested with MnlI restriction enzyme according to the manufacturer’s (New England Biolabs) instructions. The presence of G to A mutation at nucleotide 1691, causes loss of the restriction site. Restriction digest products were separated on 12% polyacrylamide gels. After electrophoresis, the polyacrylamide gels were fixed with 10% ethanol/ 0.5% acetic acid, stained with 0.1% AgN03, and developed with 1.5% NaOH, 0.01% NaBH4, and 0.15% formaldehyde.
1.1.3. Statistical Analysis Differences in intima-media thickness, CHD prevalence, and risk factors as a function of the presence or absence of the factor V Leiden mutation were tested using linear (intima-media thickness and continuous risk factors) and logistic (CHD and categorical risk factors) regression. Models using intima-media thickness and early onset CHD as dependent variables were fit first without covariate adjustment and again after adjustment for sex, smoking, fibrinogen, hyperhomocysteinemia (homocysteine >15.4 mmol), and LDL and HDL cholesterol. Only fibrinogen and smoking were of borderline significance and retained in subsequent models. Similar results were obtained for early CHD and any CHD outcomes; only the results for early CHD are presented here. To correct the p values and confidence intervals (CI) for the familial correlation in the data, a bootstrap procedure was used. The bootstrap randomly selected one individual per family for each model and averaged over
291
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
Table 1. Characteristics (mean1SD or %) of study subjects by factor V mutation present/absent and p values for tests of differences between groups Variable Age (years) Male (%) HDL-cholesterol (mg/dL) LDL-cholesterol (mg/dL) Fibrinogen (mg/dL) Body mass index Current smoking (%) Hyperhomocysteinemia (%) Carotid intima media thickness (mm) Coronary heart disease (%)
Mutation present n583 (6.4%) 56.2 49.0 46.0 129.5 339.8 28.3 20.5 16.0
(12.5) (13.9) (35.8) (110.6) (5.6)
0.782 (0.283) 6.0
100 replications. All analyses were conducted using the Statistical Analysis System (SAS) version 6.0. [12]
2. Results and Discussion In 1993, Dahlback et al. [1] reported a defect in the protein C anticoagulant pathway, which was detected by a poor anticoagulant response to exogenous activated protein C in an activated partial thromboplastin time assay. This defect is due to a mutation in factor V gene and is the most common cause of venous thrombosis, occurring in up to 50% of venous thrombosis cases [1–5]. While the role of resistance to activated protein C due to a factor V Leiden mutation is established in regard to venous thrombosis, its relation to arterial disease is controversial [6–10] and less well defined [13–15]. Other coagulation factors (e.g. factor VII, von Willebrand factor, fibrinogen, and plasminogen activator inhibitor) have been found by some investigators to be related to atherogenesis, suggesting that factor V may also contribute to atherogenesis. The aim of the present study is to investigate the association of factor V Leiden mutation with coronary heart disease and subclinical atherosclerosis (i.e., carotid intima media thickness). Table 1 shows the characteristics of the study subjects with respect to the presence or absence of factor V Leiden mutation. The mutation was present in 6.4% of study subjects. This frequency is similar to earlier published reports: 7% in a
Mutation absent n51209 (93.6%) 55.6 46.3 48.2 130.1 323.6 28.5 14.8 20.0
(11.3)
p value
(15.2) (35.4) (75.7) (5.7)
0.65 0.51 0.20 0.88 0.07 0.74 0.16 0.33
0.810 (0.283) 13.4
0.38 0.56
Swedish control group [2], 5% in Dutch population [4,16], and 6% in the Physician Health Study participants from North America [5]. No significant difference in any of the study variables was found between those with and without the mutation, although a higher level of fibrinogen was found in those with the mutation (p50.07). In the unadjusted analysis, carotid intima media thickness was not significantly different in those with or without the factor V Leiden mutation. After adjusting for fibrinogen and smoking, the lack of an association between the mutation groups for carotid intima media thickness (Figure 1) persisted. Similarly, in the unadjusted analysis, early onset coronary heart disease was not significantly different between mutation groups. There were five cases in those with the mutation (6%) compared to 162 cases in those without the mutation (13.4%, p50.56). The absence of an association of factor V Leiden and early onset CHD persisted after adjustment for fibrinogen and smoking (Logistic odds ratio (OR) 1.08, 95% CI 0.61–1.92). In conclusion, our results support other published reports of the absence of an association between the presence of factor V mutation and atherosclerotic cardiovascular disease [6–8,10]. In contrast, the Ma et al. [6] and Montaruli et al. [17] studies report that the factor V mutation is a risk factor for arterial thrombosis; however, these studies were based on a very small number of subjects. The former [6] included 20 patients with coronary heart disease (the mutation was present in 3 subjects), while the latter [17] was based on two Italian
292
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
0.05 with power of 80% was 3.0 for CHD. Given our cross-sectional design, selection bias may also account for null findings, since those with the mutation may have died during the acute phase of myocardial infarction. Due to rarity of the homozygous form, more studies are needed to elucidate the role of the factor V mutation in atherosclerosis.
References
Fig. 1. Mean carotid intima media thickness by factor V Leiden genotype, after adjusting for fibrinogen and smoking. 95% CI are shown on the top of the bars.
families. In the Italian families, members homozygous for the mutation had stroke or myocardial infarction, suggesting the mutation was only important in homozygotes. We had only two homozygotes in our study population, and neither had CHD. Our results also differ substantially from data recently reported by Rosendaal et al. [18]. They investigated the factor V Leiden mutation in relation to myocardial infarction (MI) in a casecontrol study of women ages 18 to 44 years, and found a 2.4 fold excess of the mutation in MI cases compared to controls. They also reported a particularly strong effect (OR532) of the mutation on MI in smokers. We conducted additional analyses separately for smokers and nonsmokers and found no excess risk of the factor V Leiden mutation in smokers (OR and 95% CI 1.0 (0.1–8.7) in women and 1.2 (0.2 to 6.5) in men). Null results were also observed for nonsmokers. The difference in results from these two studies may be the definitions of CHD used or differences in the age distribution of the two study populations (the mean age of the Rosendaal et al. study [18] was about 39 years, while ours was 56 years). A limitation of our study is the limited power to detect an association: given the sample size of 1292 (n5525 families) and a mutation prevalence of 6.4%, the smallest detectable OR needed to achieve a significant level of
1. Dahlba¨ck B, Carlsson M. Svensson PJ. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: Prediction of a cofactor to activated protein C. Proc Natl Acad Sci 1993;90:1004–8. 2. Svensson PJ, Dahlba¨ck B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517–22. 3. Griffin JH, Evatt B, Wideman C, Fernandez JA. Anticoagulant protein C pathway defect in majority of thrombophilic patients. Blood 1993;82:1989–93. 4. Koster T, Rosendaal FR, de Ronde H, Briet E, Vandenbroucke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503–6. 5. Ridker PM, Hennekens CH, Lindpaintner K, Stampfer MJ, Eisenberg PR, Miletich JP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332:912–7. 6. Ma DDF, Williams BG, Aboud MR, Isbister JP. Activated protein C resistance (APC) and inherited factor V (FV) mis-sense mutation in patients with venous and arterial thrombosis in a haematology clinic. Aust NZ J Med 1995; 25:151–4. 7. Biasiutti FD, Furlan CM, Sulzer I, Binder BR, Lammle B. No association of APC resistance with myocardial infarction. Blood Coagul Fibrinol 1995;6:456–9. 8. Holm J, Zoller B, Berntorp E, Erhardt L, Dahlba¨ck B. Prevalence of factor V gene mutation amongst myocardial infarction patients and healthy controls is higher in Sweden than in other countries. J Inter Med 1996;239:221–6.
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
9. Ardissino D, Peyvandi F, Merlini PP, Colombi E, Mannucci PM. Factor V (Arg506 to Gln) mutation in young survivors of myocardial infarction. Thromb Haemost 1996;75:701–2. 10. Prohasks W, Mannebach H, Schmidt M, Gleichmann U, Kleesiek K. Evidence against heterozygous coagulation factor V 1691 G to A mutation with resistance to activated protein C being a risk factor for coronary heart disease and myocardial infarction. J Mol Med 1995; 73:521–4. 11. Higgins M, Province M, Heiss G, Eckfeldt J, Ellison RC, Folsom A, Rao DC, Sprafka JM, Williams R for the NHLBI Family Heart Study Investigators. The NHLBI Family Heart Study: Objectives and design. Am J Epidemiol 1996; 143(12):1219–28. 12. SAS Institute Inc. SAS/STATT User’s Guide, Version 6, Fourth Edition, Volume 2. Cary, NC: SAS Institute Inc.; 1989. 13. Cortellaro M, Baldassarre D, Cofrancesco E, Tremoli E, Colombo A, Boschetti C, Paoletti R. Relation between hemostatic variables and increase of common carotid intima-media thickness in patients with peripheral arterial disease. Stroke 1996;27:450–4. 14. Agewall S, Wikstrand J, Suurkula M, Teng-
15.
16.
17.
18.
293
born L, Fagerberg B. Carotid artery wall morphology, haemostatic factors and cardiovascular disease. An ultrasound study in men at high and low risk from atherosclerotic disease. Blood Coagul Fibrinol 1994;5:895–904. Sosef MN, Bosch JG, Van Oostayen J, Visser T, Reiber JH, Rosendaal FR. Relation of plasma coagulation factor VII and fibrinogen to carotid artery intima-media thickness. Thromb Haemost 1994;72:250–4. Bertina RM, Koeleman BP, Koster T, Rosendaal FR, Dirven RJ, De Ronde H, Van Der Velden PA, Reitsma PH. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64–7. Montaruli B, Voorberg J, Tamponi G, Borchiellini A, Muleo G, Pannocchia A, Van Mourik JA, Schinco P. Arterial and venous thrombosis in two Italian families with the factor V Arg506 to Gln mutation. Eur J Haematology 1996; 57:96–100. Rosendaal FR, Siscovick DS, Schwartz SM, Beverly RK, Psaty BM, Longstreth Jr WT, Raghunathan TE, Koepsell TD, Reitsma PH. Factor V Leiden (Resistance to Activated Protein C) Increases the Risk of Myocardial Infarction in Young Women. Blood 1997;89(8): 2817–21.
BRIEF COMMUNICATION
No Association between Factor V Leiden Mutation and Coronary Heart Disease or Carotid Intima Media Thickness: The NHLBI Family Heart Study Uttam C. Garg1, Donna K. Arnett2, Greg Evans3 and John H. Eckfeldt1 Department of Laboratory Medicine and Pathology, School of Medicine, and 2 Division of Epidemiology, School of Public Health, University of Minnesota, Minneapolis, MN, USA; 3 Department of Public Health Sciences, Bowman Gray School of Medicine, Winston-Salem, NC, USA.
1
(Received 7 November 1997, by Editor G. M. Rodgers; revised/accepted 8 January 1998)
Key Words: Factor V Leiden mutation; Resistance to protein C; Carotid intima media thickness; Coronary heart disease
R
esistance to activated protein C resulting from a single point mutation (G1691 to A; Arg 506 to Gln) in the factor V gene is a major cause of venous thrombosis, particularly in young adults [1–3]. The mutation abolishes the cleavage site for activated protein C in the factor V molecule, rendering factor V resistant to subsequent inactivation by activated protein C. Several studies demonstrate that resistance to activated protein C is the most common cause of venous thromboembolism. The prevalence of the mutation is approximately 5% in the general population and 30–50% in individuals with a family history of venous thrombosis [2–5]. While the role of activated protein C resistance in venous thrombosis is established, the relationship of factor V to coronary heart disease (CHD) is less well understood [6–10]. To the best of our knowledge, the association of the point mutation (Arg 506 to Gln) in factor V with subclinical meaAbbreviations : CHD, coronary heart disease; FHS, Family Heart Study; LDC, low density lipoprotein; HDL, high density lipoprotein; SAS, Statistical Analysis System. Corresponding author : Dr. Donna Arnett, Division of Epidemiology, University of Minnesota, 1300 South Second Street, Suite 300, Minneapolis, MN, USA 55454–1015. Fax: 612–624–0315; E-mail: ,[email protected]..
sures of atherosclerosis has not yet been examined. In the present study, we evaluated the relationship between cardiovascular risk factors, early onset CHD and carotid artery intima-media thickness to the factor V Leiden mutation.
1. Materials and Methods 1.1. Methods 1.1.1. Selection of Study Subjects Data for this study were collected as part of the NHLBI Family Heart Study (FHS). FHS is designed to investigate genetic and nongenetic determinants of CHD, atherosclerosis, and cardiovascular risk factors [11]. The sample of 1292 adults consists of: 1) sibships in which at least two of the siblings are CHD affected full sibs (n5243 sibs); 2) sibships in which at least one sibling is above the 90th percentile of the distribution of carotid artery intima media thickness (n5231 sibs); 3) sibships with at least two full siblings at or above the age-sex specific 80th percentile of the Individual Risk Score (a score derived for each individual using sex-specific proportional hazards models to predict the age-of-onset of CHD, based on carotid artery intima media thickness, lipids, body mass index, blood pressure, hypertension, diabetes, and a CHD family history score) (n51090 sibs); and 4) randomly
0049-3848/98 $19.00 1 .00 1998 Elsevier Science Ltd. Printed in the USA. All rights reserved. PII S0049-3848(98)00019-X
290
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
selected, unrelated subjects (n5185) (note: the above sampling did not result in mutually exclusive categories). Physiologic Measurements: Blood pressure measurements were taken after a five minute rest with a random zero sphygmomanometer. Height and weight were measured and body mass index calculated as weight (kg) divided by height (m2). Smoking status was based on self report. Low density lipoprotein (LDL) and high density lipoprotein (HDL) cholesterol and fibrinogen were measured using standard techniques. Carotid B-mode ultrasound examinations were performed with a Biosound Phase II using a common scanning protocol at each of the field centers; readings were done at a central reading center. Measurements of intimamedia thickness were derived in the far wall of three segments of the right and left extracranial carotid arteries: 1) the common carotid artery (one centimeter proximal to the dilation of the carotid bulb); 2) the bifurcation (the one centimeter segment proximal to the flow divider); and 3) the internal carotid artery (the one centimeter segment in the internal branch distal to the flow divider). Eleven contiguous measurements (one millimeter each) were attempted in each of the six segments. The overall average value of the mean wall thickness at the six segments combined was calculated and used in the analysis. CHD events were validated using medical record confirmation of myocardial infarction or revascularization procedure (angioplasty or coronary artery bypass grafting). Because thrombotic factors are likely to be particularly important in younger individuals, early onset CHD was considered, and was defined by age-ofonset of CHD before age 55 years in men or 65 years in women.
1.1.2. Factor V Leiden Genotyping Factor V genotyping was done as described by Bertina et al. [16] with modifications. A 192 bp DNA fragment spanning the mutation locus at position 1691 was amplified by polymerase chain reaction (PCR) using sense primer (59CCAGTGCTTAACAAGACCATA39) and antisense primer (59GCCAGGAGACCTAACATGTT39). The primers used were synthesized on a DNA synthesizer (Model ABI 394, Applied Biosystems, Inc., Foster City, CA) by the Microchemical Facility at the University of Minnesota and purified
by HPLC. PCR reactions were carried out with approximately 50 ng of genomic DNA and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) in a volume of 50 mL, containing 10 mmol/L Tris (pH 5 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, 0.2 mmol/L of all four deoxynucleoside triphosphates and 0.2 mmol/L of each primer. After denaturation for 3 min at 958C, temperature was cycled 30 times (958C, 1 min; 608C, 2 min; and 728C, 1 min) followed by extension at 728C for 3 min to amplify the target DNA (Ericomp Twin BlockE System, Easy CyclerE Series, Ericomp Inc., San Diego, CA). To verify amplification, the PCR products were electrophoresed on a 2% low melting point agarose gel (NuSieve GTG; FMC Bioproducts) containing ethidium bromide. To distinguish between the presence or absence of factor V Leiden mutation, the PCR product was digested with MnlI restriction enzyme according to the manufacturer’s (New England Biolabs) instructions. The presence of G to A mutation at nucleotide 1691, causes loss of the restriction site. Restriction digest products were separated on 12% polyacrylamide gels. After electrophoresis, the polyacrylamide gels were fixed with 10% ethanol/ 0.5% acetic acid, stained with 0.1% AgN03, and developed with 1.5% NaOH, 0.01% NaBH4, and 0.15% formaldehyde.
1.1.3. Statistical Analysis Differences in intima-media thickness, CHD prevalence, and risk factors as a function of the presence or absence of the factor V Leiden mutation were tested using linear (intima-media thickness and continuous risk factors) and logistic (CHD and categorical risk factors) regression. Models using intima-media thickness and early onset CHD as dependent variables were fit first without covariate adjustment and again after adjustment for sex, smoking, fibrinogen, hyperhomocysteinemia (homocysteine >15.4 mmol), and LDL and HDL cholesterol. Only fibrinogen and smoking were of borderline significance and retained in subsequent models. Similar results were obtained for early CHD and any CHD outcomes; only the results for early CHD are presented here. To correct the p values and confidence intervals (CI) for the familial correlation in the data, a bootstrap procedure was used. The bootstrap randomly selected one individual per family for each model and averaged over
291
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
Table 1. Characteristics (mean1SD or %) of study subjects by factor V mutation present/absent and p values for tests of differences between groups Variable Age (years) Male (%) HDL-cholesterol (mg/dL) LDL-cholesterol (mg/dL) Fibrinogen (mg/dL) Body mass index Current smoking (%) Hyperhomocysteinemia (%) Carotid intima media thickness (mm) Coronary heart disease (%)
Mutation present n583 (6.4%) 56.2 49.0 46.0 129.5 339.8 28.3 20.5 16.0
(12.5) (13.9) (35.8) (110.6) (5.6)
0.782 (0.283) 6.0
100 replications. All analyses were conducted using the Statistical Analysis System (SAS) version 6.0. [12]
2. Results and Discussion In 1993, Dahlback et al. [1] reported a defect in the protein C anticoagulant pathway, which was detected by a poor anticoagulant response to exogenous activated protein C in an activated partial thromboplastin time assay. This defect is due to a mutation in factor V gene and is the most common cause of venous thrombosis, occurring in up to 50% of venous thrombosis cases [1–5]. While the role of resistance to activated protein C due to a factor V Leiden mutation is established in regard to venous thrombosis, its relation to arterial disease is controversial [6–10] and less well defined [13–15]. Other coagulation factors (e.g. factor VII, von Willebrand factor, fibrinogen, and plasminogen activator inhibitor) have been found by some investigators to be related to atherogenesis, suggesting that factor V may also contribute to atherogenesis. The aim of the present study is to investigate the association of factor V Leiden mutation with coronary heart disease and subclinical atherosclerosis (i.e., carotid intima media thickness). Table 1 shows the characteristics of the study subjects with respect to the presence or absence of factor V Leiden mutation. The mutation was present in 6.4% of study subjects. This frequency is similar to earlier published reports: 7% in a
Mutation absent n51209 (93.6%) 55.6 46.3 48.2 130.1 323.6 28.5 14.8 20.0
(11.3)
p value
(15.2) (35.4) (75.7) (5.7)
0.65 0.51 0.20 0.88 0.07 0.74 0.16 0.33
0.810 (0.283) 13.4
0.38 0.56
Swedish control group [2], 5% in Dutch population [4,16], and 6% in the Physician Health Study participants from North America [5]. No significant difference in any of the study variables was found between those with and without the mutation, although a higher level of fibrinogen was found in those with the mutation (p50.07). In the unadjusted analysis, carotid intima media thickness was not significantly different in those with or without the factor V Leiden mutation. After adjusting for fibrinogen and smoking, the lack of an association between the mutation groups for carotid intima media thickness (Figure 1) persisted. Similarly, in the unadjusted analysis, early onset coronary heart disease was not significantly different between mutation groups. There were five cases in those with the mutation (6%) compared to 162 cases in those without the mutation (13.4%, p50.56). The absence of an association of factor V Leiden and early onset CHD persisted after adjustment for fibrinogen and smoking (Logistic odds ratio (OR) 1.08, 95% CI 0.61–1.92). In conclusion, our results support other published reports of the absence of an association between the presence of factor V mutation and atherosclerotic cardiovascular disease [6–8,10]. In contrast, the Ma et al. [6] and Montaruli et al. [17] studies report that the factor V mutation is a risk factor for arterial thrombosis; however, these studies were based on a very small number of subjects. The former [6] included 20 patients with coronary heart disease (the mutation was present in 3 subjects), while the latter [17] was based on two Italian
292
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
0.05 with power of 80% was 3.0 for CHD. Given our cross-sectional design, selection bias may also account for null findings, since those with the mutation may have died during the acute phase of myocardial infarction. Due to rarity of the homozygous form, more studies are needed to elucidate the role of the factor V mutation in atherosclerosis.
References
Fig. 1. Mean carotid intima media thickness by factor V Leiden genotype, after adjusting for fibrinogen and smoking. 95% CI are shown on the top of the bars.
families. In the Italian families, members homozygous for the mutation had stroke or myocardial infarction, suggesting the mutation was only important in homozygotes. We had only two homozygotes in our study population, and neither had CHD. Our results also differ substantially from data recently reported by Rosendaal et al. [18]. They investigated the factor V Leiden mutation in relation to myocardial infarction (MI) in a casecontrol study of women ages 18 to 44 years, and found a 2.4 fold excess of the mutation in MI cases compared to controls. They also reported a particularly strong effect (OR532) of the mutation on MI in smokers. We conducted additional analyses separately for smokers and nonsmokers and found no excess risk of the factor V Leiden mutation in smokers (OR and 95% CI 1.0 (0.1–8.7) in women and 1.2 (0.2 to 6.5) in men). Null results were also observed for nonsmokers. The difference in results from these two studies may be the definitions of CHD used or differences in the age distribution of the two study populations (the mean age of the Rosendaal et al. study [18] was about 39 years, while ours was 56 years). A limitation of our study is the limited power to detect an association: given the sample size of 1292 (n5525 families) and a mutation prevalence of 6.4%, the smallest detectable OR needed to achieve a significant level of
1. Dahlba¨ck B, Carlsson M. Svensson PJ. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: Prediction of a cofactor to activated protein C. Proc Natl Acad Sci 1993;90:1004–8. 2. Svensson PJ, Dahlba¨ck B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517–22. 3. Griffin JH, Evatt B, Wideman C, Fernandez JA. Anticoagulant protein C pathway defect in majority of thrombophilic patients. Blood 1993;82:1989–93. 4. Koster T, Rosendaal FR, de Ronde H, Briet E, Vandenbroucke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503–6. 5. Ridker PM, Hennekens CH, Lindpaintner K, Stampfer MJ, Eisenberg PR, Miletich JP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332:912–7. 6. Ma DDF, Williams BG, Aboud MR, Isbister JP. Activated protein C resistance (APC) and inherited factor V (FV) mis-sense mutation in patients with venous and arterial thrombosis in a haematology clinic. Aust NZ J Med 1995; 25:151–4. 7. Biasiutti FD, Furlan CM, Sulzer I, Binder BR, Lammle B. No association of APC resistance with myocardial infarction. Blood Coagul Fibrinol 1995;6:456–9. 8. Holm J, Zoller B, Berntorp E, Erhardt L, Dahlba¨ck B. Prevalence of factor V gene mutation amongst myocardial infarction patients and healthy controls is higher in Sweden than in other countries. J Inter Med 1996;239:221–6.
U.C. Garg et al./Thrombosis Research 89 (1998) 289–293
9. Ardissino D, Peyvandi F, Merlini PP, Colombi E, Mannucci PM. Factor V (Arg506 to Gln) mutation in young survivors of myocardial infarction. Thromb Haemost 1996;75:701–2. 10. Prohasks W, Mannebach H, Schmidt M, Gleichmann U, Kleesiek K. Evidence against heterozygous coagulation factor V 1691 G to A mutation with resistance to activated protein C being a risk factor for coronary heart disease and myocardial infarction. J Mol Med 1995; 73:521–4. 11. Higgins M, Province M, Heiss G, Eckfeldt J, Ellison RC, Folsom A, Rao DC, Sprafka JM, Williams R for the NHLBI Family Heart Study Investigators. The NHLBI Family Heart Study: Objectives and design. Am J Epidemiol 1996; 143(12):1219–28. 12. SAS Institute Inc. SAS/STATT User’s Guide, Version 6, Fourth Edition, Volume 2. Cary, NC: SAS Institute Inc.; 1989. 13. Cortellaro M, Baldassarre D, Cofrancesco E, Tremoli E, Colombo A, Boschetti C, Paoletti R. Relation between hemostatic variables and increase of common carotid intima-media thickness in patients with peripheral arterial disease. Stroke 1996;27:450–4. 14. Agewall S, Wikstrand J, Suurkula M, Teng-
15.
16.
17.
18.
293
born L, Fagerberg B. Carotid artery wall morphology, haemostatic factors and cardiovascular disease. An ultrasound study in men at high and low risk from atherosclerotic disease. Blood Coagul Fibrinol 1994;5:895–904. Sosef MN, Bosch JG, Van Oostayen J, Visser T, Reiber JH, Rosendaal FR. Relation of plasma coagulation factor VII and fibrinogen to carotid artery intima-media thickness. Thromb Haemost 1994;72:250–4. Bertina RM, Koeleman BP, Koster T, Rosendaal FR, Dirven RJ, De Ronde H, Van Der Velden PA, Reitsma PH. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64–7. Montaruli B, Voorberg J, Tamponi G, Borchiellini A, Muleo G, Pannocchia A, Van Mourik JA, Schinco P. Arterial and venous thrombosis in two Italian families with the factor V Arg506 to Gln mutation. Eur J Haematology 1996; 57:96–100. Rosendaal FR, Siscovick DS, Schwartz SM, Beverly RK, Psaty BM, Longstreth Jr WT, Raghunathan TE, Koepsell TD, Reitsma PH. Factor V Leiden (Resistance to Activated Protein C) Increases the Risk of Myocardial Infarction in Young Women. Blood 1997;89(8): 2817–21.