- Email: [email protected]
No evidence of an association between polymorphisms in the IRAK-M gene and atopic dermatitis in a German cohort
Molecular and Cellular Probes 23 (2009) 16–19
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
No evidence of an association between polymorphisms in the IRAK-M gene and atopic dermatitis in a German cohort Jasmin Beygo a, Qumar Parwez b, Elisabeth Petrasch-Parwez c, Jo¨rg T. Epplen a, Sabine Hoffjan a, * a
Department of Human Genetics, Ruhr-University Bochum, Bochum, Germany Private medical practice, Gladbeck, Germany c Department of Neuroanatomy and Brain Research, Ruhr-University Bochum, Germany b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 September 2008 Accepted 7 October 2008 Available online 26 October 2008
Atopic dermatitis (AD) is a chronic inflammatory skin disease which affects up to 10–15% of the human population in industrialized countries. A complex interaction of genetic and environmental factors is suggested to be involved in the pathogenesis of this disease. Activation of the innate immune system via toll-like receptors (TLRs) might play a role in this respect. Interleukin-1 receptor associated kinase M (IRAK-M) negatively regulates TLR signalling and inflammation. Recently, the IRAK-M gene was identified to confer linkage to asthma on chromosome 12q13–24 in a Sardinian population, and variation within the IRAK-M gene was associated with early-onset persistent asthma in Sardinian and Italian cohorts. In order to evaluate the possible role of polymorphisms in the IRAK-M gene in the pathogenesis of AD, we investigated six single nucleotide polymorphisms (SNPs) in this gene in a German AD case-control study. Unrelated AD patients (n ¼ 361) and healthy controls (n ¼ 325) were studied genetically using PCR-coupled methods. Analysis of single SNPs and haplotypes did not reveal a significant association between polymorphisms in the IRAK-M gene and AD in this cohort. Ó 2008 Elsevier Ltd. All rights reserved.
Keywords: IRAK-M and IRAK3 genes Atopic dermatitis Association Toll-like receptors (TLR)
1. Introduction Atopic dermatitis (AD) is a common chronic inflammatory skin disease which belongs – together with asthma and allergic rhinitis – to the ‘‘atopic triad’’ [1]. It is characterized by dry, xerotic skin with pruritus and chronic inflammations [2]. The cause of AD is still unknown, but there is evidence for a complex interaction of both genetic and environmental factors contributing to this disease [3]. AD affects up to 15% of the human population in industrialized countries [4] and there appears to have been an increasing in its prevalence in the last decades [5]. It has been suggested that this increase could be related to limited exposure to ‘physiological’ environmental factors, such as animals and infections early in life, thus reducing the stimulation of the innate immune system [6]. An important role in the activation of the innate immune system play conserved pathogen-associated molecular patterns (PAMPs) which are recognized by special pattern-recognition receptors such as toll-like receptors (TLRs) [7]. TLRs recognize, for example, endotoxins or cpG DNA and mediate the activation of the innate immune system via a complex interplay of different molecules, eventually initializing the activation of the adaptive immune system [7]. One * Corresponding author. Tel.: þ49 234 32 23823; fax: þ49 234 32 14196. E-mail address: [email protected] (S. Hoffjan). 0890-8508/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2008.10.002
of the molecules involved in the regulation of TLR signalling is interleukin-1 receptor associated kinase M (IRAK-M) [8], also known as IRAK3, which negatively regulates TLR signalling and inflammation [8]. IRAK-M is also known to play a part in the ‘immediate’ induction of endotoxin tolerance [9]. The IRAK-M gene is located to chromosome 12q14.2 [10], a region that was repeatedly shown to have linkage to asthma and IgE levels [11,12], and is mainly expressed in monocytes and macrophages [9]. The gene consists of 12 exons and encodes a 597 amino acid protein of 68 kD which contains an inactive kinase domain [9]. Recently, Balaci et al. [13] identified the IRAK-M gene to contribute to linkage to asthma on chromosome 12q in a Sardinian cohort of affected sib-pairs. The analysis of single nucleotide polymorphisms (SNPs) as well as haplotypes revealed significant association of IRAK-M variation with early-onset persistent asthma [13]. These results could be replicated in an independent casecontrol cohort from the mainland of Italy. Six SNPs were identified which characterized haplotypes significantly associated with asthma [13]. Since asthma and AD may share, at least in part, a common genetic background [14,15] and because nucleotide variation in other genes of the TLR signalling pathway has already been implicated in the pathogenesis of AD [16–18], we evaluated these six SNPs in the IRAK-M gene for an association with AD in a German case-control cohort.
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19
17
2. Material and methods
3. Results and discussion
2.1. Human subjects
Previously, six SNPs in the IRAK-M gene were used to define predisposing and protective haplotypes in the Sardinian population [13]. In the present study, these SNPs were investigated in 361 AD patients and 325 control subjects. All SNPs were in HWE in both cases and controls. Allele and genotype frequencies for any of the SNPs did not differ between AD patients and control subjects in this cohort (Table 2). Similarly, haplotype analyses did not reveal any significant differences between the frequencies of the most common haplotypes in AD patients and controls (Table 3). The results of the association analysis in this German AD casecontrol cohort did not support the hypothesis that variation in the IRAK-M gene contributes to the pathogenesis of AD. Prior to the present study, the IRAK-M gene had not been evaluated comprehensively for an association with AD, although a Japanese research group investigated a possible link between IRAK-M variation and asthma, but did not provide evidence of a significant association [10]. Thus, the role of this gene in the pathogenesis of the different atopic diseases remains unclear. Several studies have revealed linkage of chromosome 12q13-24 to asthma and other atopic phenotypes [23], but no evidence of linkage has yet been found specifically for AD [24]. Overall, there is surprisingly little overlap in the proposed linkage regions of asthma and AD [24], which implicates that these diseases may have less genetic background in common than initially proposed based on the ‘‘atopic triad’’ [25]. Therefore, it is possible that variation in the IRAK-M gene may play a role for asthma, and perhaps more specifically for the subtype of early-onset persistent asthma, but not for AD or allergic rhinitis. On the other hand, polymorphisms in the IRAK-M gene could possibly have a weak influence on AD which might only be detected in connection with other genetic variation or specific environmental factors. Both gene/gene [26] and gene/environment interactions [27] have already been described for AD. Especially for variation in genes of the innate immune system, it appears to be a promising approach to integrate information on related environmental factors, such as endotoxin or pet exposure in early childhood, into genetic analyses. For the CD14 gene, for example, an antagonistic interaction between endotoxin exposure and genotype at the locus 159 C/T has been described consistently [28]. In the present study, we did not have information on household endotoxin levels, such that we were unable to undertake such an analysis. Another possibility could be that the observed association between nucleotide variation/s in the IRAK-M gene and asthma might be restricted to Sardinians, given that Sardinia underwent genetic isolation with the possibility of ‘genetic drift’ of respective alleles [29]. Studies comparing HLA genetics in populations from Sardinia and other parts of Europe showed different genotype and haplotype frequencies [30]. Association studies for other multifactorial diseases, such as multiple sclerosis (MS), also revealed
The case-control cohort of German AD patients has been presented in detail elsewhere [19]. In brief, 361 unrelated patients with AD were recruited by Q.P., a specialist in Gladbeck, Germany. The diagnostic criteria for AD [20] were met by all subjects in this cohort. The mean age of the patients was 18.5 17.6 years. For the control group, 325 unrelated persons with no history of AD, asthma or rhinitis were recruited via the same practice as the AD patients. The mean age of these controls was 62.1 11.7 years. Patients as well as controls were Germans with European ancestry. Informed consent was obtained from all subjects, the study was approved by the Ethics Committee of the Ruhr-University Bochum, Germany, and protocols defined in the Declaration of Helsinki protocols were followed. 2.2. Molecular genetic analysis Genomic DNA was extracted from blood samples according to a standard salting-out method [21]. Four nucleotide variations (rs1177578, rs2141709, rs11465955 and rs1370128) were investigated using polymerase chain reaction (PCR)-coupled restriction endonuclease digestion (see Table 1 for details). The PCR was carried out in a volume of 10 ml using 40 ng DNA, 2 mM of each dNTP, 3 mmol MgCl2, 5 pmol of the respective forward (F) and reverse (R) primer and 0.4 U Taq polymerase (Genecraft, Cologne, Germany). Thermal cycling was performed on a Biometra thermal cycler (Go¨ttingen, Germany). After two initial cycles at 6 C and 3 C above the annealing temperature, 27 cycles of 95 C (45 s), annealing temperature (45 s) and 72 C (30 s) were run. Primer sequences and annealing temperatures are shown in Table 1. PCR products were treated with the respective restriction enzymes (0.01 U/ng DNA; Table 1) at 37 C for 3 h and then resolved in ethidium-stained (2.5%) agarose gel bands; images of the gels were captured digitally. The remaining two SNPs (rs2870784 and rs1624395) were investigated using TaqMan assays (Applied Biosystems, Foster City, USA), according to the manufacturer’s instructions for the thermal cycler used (iCycler, Bio-Rad Laboratories, Munich, Germany). Reliability of the results was affirmed by random re-evaluation on consecutive days. 2.3. Statistics Comparison of allele and genotype frequencies between AD patients and control subjects was performed using c2-tests. P 0.05 was considered as significant. Testing for Hardy–Weinberg equilibrium (HWE) was conducted using the program DeFinetti (http://ihg2. helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl). Haplotype analyses were performed using the program Haploview v.4.1 [22].
Table 1 PCR conditions, primers and restriction enzymes. rs number
Location
Alleles
Primer
Annealing temperature
Restriction enzyme
rs2870784 rs1177578
50 region 50 region
A/C C/G
TaqMan
– 58 C
– Alw26I
rs2141709
50 region
C/T
55 C
Hin6I
rs11465955
Intron 3 (boundary)
C/T
rs1624395 rs1370128
Intron 6 Intron 6
A/G C/T
F: GAAACGAAATTCTCCAAGGGTG R: GCTTCTTGAGACATTTTGTCTCCC F: AAAGAAAATAGAAAATGTTACCTCTCCCTA R: CACCCCTTTTATTCTGGTAATCCA F: ACTTTGTTGCATGTATAATTGAGCATAA R: CAGATCACTGAGAACAGAAAGCTCTTA TaqMan F: AGTTGTTCAAATCTGTTTACCACACC R: GCCACCCAATCTTTTGCTACA
58 C
MspI
– 62 C
– BanI
18
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19
Table 2 Allele and genotype frequencies of IRAK-M polymorphisms in AD patients and subjects with no history of AD (controls). rs number
Genotypes
rs2870784
C/C C/A A/A n
Alleles
C A n rs1624395
G/G G/A A/A n G A n
rs1370128
T/T T/C C/C n T C n
rs11465955
T/T T/C C/C n T C n
rs1177578
G/G G/C C/C n G C n
rs2141709
T/T T/C C/C n T C n
AD-patients
Controls
P-value
197 (54.6%) 133 (36.8%) 31 (8.6%) 361 527 (73.0%) 195 (27.0%) 722 159 (44.4%) 155 (43.3%) 44 (12.3%) 358 473 (66.1%) 243 (33.9%) 716 46 (12.7%) 161 (44.6%) 154 (42.7%) 361 253 (35.0%) 469 (65.0%) 722 34 (9.4%) 161 (44.6%) 166 (46.0%) 361 229 (31.7%) 493 (68.3%) 722 120 (34.0%) 161 (45.6%) 72 (20.4%) 353 401 (56.8%) 305 (43.2%) 706 50 (13.9%) 164 (45.4%) 147 (40.7%) 361 264 (36.6%) 458 (63.4%) 722
166 (51.1%) 138 (42.5%) 21 (6.5%) 325 470 (72.3%) 180 (27.7%) 650 139 (42.9%) 149 (46.0%) 36 (11.1%) 324 427 (65.9%) 221 (34.1%) 648 38 (11.8%) 149 (46.3%) 135 (41.9%) 292 225 (34.9%) 419 (65.1%) 644 24 (7.4%) 139 (42.8%) 162 (49.8%) 325 187 (28.8%) 463 (71.2%) 650 97 (29.8%) 164 (50.5%) 64 (19.7%) 325 358 (55.1%) 292 (45.0%) 650 43 (13.5%) 150 (47.0%) 126 (39.5%) 319 236 (37.0%) 402 (63.0%) 638
0.2489
several diseases, including allergic conditions [35,36]. Thus, thorough association analysis in large cohorts, integrating gene/gene and gene/environment interactions, should be considered in the future, in order to explore the possible role of TLR signalling molecules in the pathogenesis of allergic diseases. References
0.7765
0.9484
0.7531
0.8827
0.9680
0.4439
0.2145
0.3057
0.5611
0.9171
0.8710
different association patterns for HLA alleles between subjects from Sardinia and other parts of Europe [31,32]. Thus, although the original study in Sardinia was replicated using a cohort from mainland Italy, there may still have been specific genetic influences which ‘drifted’ from Sardinia to the mainland population or vice versa. Variations in several genes of the TLR family or related signal transduction molecules, including TLR2 [33], TLR9 [34], toll-interacting protein (TOLLIP) [16] and interferon regulatory factor 1 (IRF1) [17], have been linked to AD in some previous studies, although most of these results have not been able to be reproduced. Therapeutic targeting of the TLR pathway has already been suggested for
Table 3 Haplotype frequencies of IRAK-M polymorphisms in AD patients and subjects with no history of AD (controls). Haplotype
Frequency in AD patients (n ¼ 361)
Frequency in controls (n ¼ 325)
P-value
112221 121112 212212 121222 112212 112222 121121
0.333 0.267 0.247 0.033 0.026 0.016 0.013
0.338 0.246 0.254 0.044 0.026 0.018 0.018
0.863 0.378 0.754 0.291 0.933 0.764 0.382
[1] Leung DY, Bieber T. Atopic dermatitis. Lancet 2003;361:151–60. [2] Kiken DA, Silverberg NB. Atopic dermatitis in children, part 1: epidemiology, clinical features, and complications. Cutis 2006;78:241–7. [3] Wuthrich B, Cozzio A, Roll A, Senti G, Kundig T, Schmid-Grendelmeier P. Atopic eczema: genetics or environment? Ann Agric Environ Med 2007;14:195–201. [4] Williams H, Robertson C, Stewart A, Ait-Khaled N, Anabwani G, Anderson R, et al. Worldwide variations in the prevalence of symptoms of atopic eczema in the International Study of Asthma and Allergies in Childhood. J Allergy Clin Immunol 1999;103:125–38. [5] Schultz Larsen F, Hanifin JM. Secular change in the occurrence of atopic dermatitis. Acta Derm Venereol Suppl (Stockh) 1992;176:7–12. [6] Williams HC. Epidemiology of atopic dermatitis. Clin Exp Dermatol 2000;25:522–9. [7] Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol 2004;4: 499–511. [8] Su J, Xie Q, Wilson I, Li L. Differential regulation and role of interleukin-1 receptor associated kinase-M in innate immunity signaling. Cell Signal 2007;19:1596–601. [9] Kobayashi K, Hernandez LD, Galan JE, Janeway Jr CA, Medzhitov R, Flavell RA. IRAK-M is a negative regulator of toll-like receptor signaling. Cell 2002;110:191–202. [10] Nakashima K, Hirota T, Obara K, Shimizu M, Jodo A, Kameda M, et al. An association study of asthma and related phenotypes with polymorphisms in negative regulator molecules of the TLR signaling pathway. J Hum Genet 2006;51:284–91. [11] Barnes KC, Neely JD, Duffy DL, Freidhoff LR, Breazeale DR, Schou C, et al. Linkage of asthma and total serum IgE concentration to markers on chromosome 12q: evidence from Afro-Caribbean and Caucasian populations. Genomics 1996;37:41–50. [12] Raby BA, Silverman EK, Lazarus R, Lange C, Kwiatkowski DJ, Weiss ST. Chromosome 12q harbors multiple genetic loci related to asthma and asthmarelated phenotypes. Hum Mol Genet 2003;12:1973–9. [13] Balaci L, Spada MC, Olla N, Sole G, Loddo L, Anedda F, et al. IRAK-M is involved in the pathogenesis of early-onset persistent asthma. Am J Hum Genet 2007;80:1103–14. [14] Cookson W. Genetics and genomics of asthma and allergic diseases. Immunol Rev 2002;190:195–206. [15] Osmola A, Czarnecka-Operacz M, Silny W. Genetic aspects of atopy and atopic dermatitis. Acta Dermatovenerol Croat 2005;13:122–6. [16] Schimming TT, Parwez Q, Petrasch-Parwez E, Nothnagel M, Epplen JT, Hoffjan S. Association of toll-interacting protein gene polymorphisms with atopic dermatitis. BMC Dermatol 2007;7:3. [17] Schedel M, Pinto LA, Schaub B, Rosenstiel P, Cherkasov D, Cameron L, et al. IRF1 gene variations influence IgE regulation and atopy. Am J Respir Crit Care Med 2008;177:613–21. [18] Shimizu M, Matsuda A, Yanagisawa K, Hirota T, Akahoshi M, Inomata N, et al. Functional SNPs in the distal promoter of the ST2 gene are associated with atopic dermatitis. Hum Mol Genet 2005;14:2919–27. [19] Macaluso F, Nothnagel M, Parwez Q, Petrasch-Parwez E, Bechara FG, Epplen JT, et al. Polymorphisms in NACHT-LRR (NLR) genes in atopic dermatitis. Exp Dermatol 2007;16:692–8. [20] Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta Derm Venereol 1980;92:44–7. [21] Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. [22] Zhang K, Qin ZS, Liu JS, Chen T, Waterman MS, Sun F. Haplotype block partitioning and tag SNP selection using genotype data and their applications to association studies. Genome Res 2004;14:908–16. [23] Heinzmann A, Grotherr P, Jerkic SP, Lichtenberg A, Braun S, Kruse S, et al. Studies on linkage and association of atopy with the chromosomal region 12q13-24. Clin Exp Allergy 2000;30:1555–61. [24] Hoffjan S, Epplen JT. The genetics of atopic dermatitis: recent findings and future options. J Mol Med 2005;83:682–92. [25] Ober C, Hoffjan S. Asthma genetics 2006: the long and winding road to gene discovery. Genes Immun 2006;7:95–100. [26] Tanaka K, Roberts MH, Yamamoto N, Sugiura H, Uehara M, Mao XQ, et al. Genetic variants of the receptors for thromboxane A2 and IL-4 in atopic dermatitis. Biochem Biophys Res Commun 2002;292:776–80. [27] Bisgaard H, Simpson A, Palmer CN, Bonnelykke K, McLean I, Mukhopadhyay S, et al. Gene-environment interaction in the onset of eczema in infancy: filaggrin loss-of-function mutations enhanced by neonatal cat exposure. PLoS Med 2008;5:e131. [28] Martinez FD. CD14, endotoxin, and asthma risk: actions and interactions. Proc Am Thorac Soc 2007;4:221–5. [29] Piazza A, Cappello N, Olivetti E, Rendine S. A genetic history of Italy. Ann Hum Genet 1988;52:203–13.
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19 [30] Vona G, Bitti PP, Succa V, Mameli GE, Salis M, Secchi G, et al. HLA phenotype and haplotype frequencies in Sardinia (Italy). Coll Antropol 1997;21:461–75. [31] Marrosu MG, Murru MR, Costa G, Cucca F, Sotgiu S, Rosati G, et al. Multiple sclerosis in Sardinia is associated and in linkage disequilibrium with HLA-DR3 and -DR4 alleles. Am J Hum Genet 1997;61:454–7. [32] Sotgiu S, Pugliatti M, Sanna A, Sotgiu A, Castiglia P, Solinas G, et al. Multiple sclerosis complexity in selected populations: the challenge of Sardinia, insular Italy. Eur J Neurol 2002;9:329–41. [33] Ahmad-Nejad P, Mrabet-Dahbi S, Breuer K, Klotz M, Werfel T, Herz U, et al. The toll-like receptor 2 R753Q polymorphism defines a subgroup of patients with
19
atopic dermatitis having severe phenotype. J Allergy Clin Immunol 2004;113:565–7. [34] Novak N, Yu CF, Bussmann C, Maintz L, Peng WM, Hart J, et al. Putative association of a TLR9 promoter polymorphism with atopic eczema. Allergy 2007;62:766–72. [35] Hong-Geller E, Chaudhary A, Lauer S. Targeting toll-like receptor signaling pathways for design of novel immune therapeutics. Curr Drug Discov Technol 2008;5:29–38. [36] O’Neill LA. Therapeutic targeting of toll-like receptors for inflammatory and infectious diseases. Curr Opin Pharmacol 2003;3:396–403.
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
No evidence of an association between polymorphisms in the IRAK-M gene and atopic dermatitis in a German cohort Jasmin Beygo a, Qumar Parwez b, Elisabeth Petrasch-Parwez c, Jo¨rg T. Epplen a, Sabine Hoffjan a, * a
Department of Human Genetics, Ruhr-University Bochum, Bochum, Germany Private medical practice, Gladbeck, Germany c Department of Neuroanatomy and Brain Research, Ruhr-University Bochum, Germany b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 September 2008 Accepted 7 October 2008 Available online 26 October 2008
Atopic dermatitis (AD) is a chronic inflammatory skin disease which affects up to 10–15% of the human population in industrialized countries. A complex interaction of genetic and environmental factors is suggested to be involved in the pathogenesis of this disease. Activation of the innate immune system via toll-like receptors (TLRs) might play a role in this respect. Interleukin-1 receptor associated kinase M (IRAK-M) negatively regulates TLR signalling and inflammation. Recently, the IRAK-M gene was identified to confer linkage to asthma on chromosome 12q13–24 in a Sardinian population, and variation within the IRAK-M gene was associated with early-onset persistent asthma in Sardinian and Italian cohorts. In order to evaluate the possible role of polymorphisms in the IRAK-M gene in the pathogenesis of AD, we investigated six single nucleotide polymorphisms (SNPs) in this gene in a German AD case-control study. Unrelated AD patients (n ¼ 361) and healthy controls (n ¼ 325) were studied genetically using PCR-coupled methods. Analysis of single SNPs and haplotypes did not reveal a significant association between polymorphisms in the IRAK-M gene and AD in this cohort. Ó 2008 Elsevier Ltd. All rights reserved.
Keywords: IRAK-M and IRAK3 genes Atopic dermatitis Association Toll-like receptors (TLR)
1. Introduction Atopic dermatitis (AD) is a common chronic inflammatory skin disease which belongs – together with asthma and allergic rhinitis – to the ‘‘atopic triad’’ [1]. It is characterized by dry, xerotic skin with pruritus and chronic inflammations [2]. The cause of AD is still unknown, but there is evidence for a complex interaction of both genetic and environmental factors contributing to this disease [3]. AD affects up to 15% of the human population in industrialized countries [4] and there appears to have been an increasing in its prevalence in the last decades [5]. It has been suggested that this increase could be related to limited exposure to ‘physiological’ environmental factors, such as animals and infections early in life, thus reducing the stimulation of the innate immune system [6]. An important role in the activation of the innate immune system play conserved pathogen-associated molecular patterns (PAMPs) which are recognized by special pattern-recognition receptors such as toll-like receptors (TLRs) [7]. TLRs recognize, for example, endotoxins or cpG DNA and mediate the activation of the innate immune system via a complex interplay of different molecules, eventually initializing the activation of the adaptive immune system [7]. One * Corresponding author. Tel.: þ49 234 32 23823; fax: þ49 234 32 14196. E-mail address: [email protected] (S. Hoffjan). 0890-8508/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2008.10.002
of the molecules involved in the regulation of TLR signalling is interleukin-1 receptor associated kinase M (IRAK-M) [8], also known as IRAK3, which negatively regulates TLR signalling and inflammation [8]. IRAK-M is also known to play a part in the ‘immediate’ induction of endotoxin tolerance [9]. The IRAK-M gene is located to chromosome 12q14.2 [10], a region that was repeatedly shown to have linkage to asthma and IgE levels [11,12], and is mainly expressed in monocytes and macrophages [9]. The gene consists of 12 exons and encodes a 597 amino acid protein of 68 kD which contains an inactive kinase domain [9]. Recently, Balaci et al. [13] identified the IRAK-M gene to contribute to linkage to asthma on chromosome 12q in a Sardinian cohort of affected sib-pairs. The analysis of single nucleotide polymorphisms (SNPs) as well as haplotypes revealed significant association of IRAK-M variation with early-onset persistent asthma [13]. These results could be replicated in an independent casecontrol cohort from the mainland of Italy. Six SNPs were identified which characterized haplotypes significantly associated with asthma [13]. Since asthma and AD may share, at least in part, a common genetic background [14,15] and because nucleotide variation in other genes of the TLR signalling pathway has already been implicated in the pathogenesis of AD [16–18], we evaluated these six SNPs in the IRAK-M gene for an association with AD in a German case-control cohort.
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19
17
2. Material and methods
3. Results and discussion
2.1. Human subjects
Previously, six SNPs in the IRAK-M gene were used to define predisposing and protective haplotypes in the Sardinian population [13]. In the present study, these SNPs were investigated in 361 AD patients and 325 control subjects. All SNPs were in HWE in both cases and controls. Allele and genotype frequencies for any of the SNPs did not differ between AD patients and control subjects in this cohort (Table 2). Similarly, haplotype analyses did not reveal any significant differences between the frequencies of the most common haplotypes in AD patients and controls (Table 3). The results of the association analysis in this German AD casecontrol cohort did not support the hypothesis that variation in the IRAK-M gene contributes to the pathogenesis of AD. Prior to the present study, the IRAK-M gene had not been evaluated comprehensively for an association with AD, although a Japanese research group investigated a possible link between IRAK-M variation and asthma, but did not provide evidence of a significant association [10]. Thus, the role of this gene in the pathogenesis of the different atopic diseases remains unclear. Several studies have revealed linkage of chromosome 12q13-24 to asthma and other atopic phenotypes [23], but no evidence of linkage has yet been found specifically for AD [24]. Overall, there is surprisingly little overlap in the proposed linkage regions of asthma and AD [24], which implicates that these diseases may have less genetic background in common than initially proposed based on the ‘‘atopic triad’’ [25]. Therefore, it is possible that variation in the IRAK-M gene may play a role for asthma, and perhaps more specifically for the subtype of early-onset persistent asthma, but not for AD or allergic rhinitis. On the other hand, polymorphisms in the IRAK-M gene could possibly have a weak influence on AD which might only be detected in connection with other genetic variation or specific environmental factors. Both gene/gene [26] and gene/environment interactions [27] have already been described for AD. Especially for variation in genes of the innate immune system, it appears to be a promising approach to integrate information on related environmental factors, such as endotoxin or pet exposure in early childhood, into genetic analyses. For the CD14 gene, for example, an antagonistic interaction between endotoxin exposure and genotype at the locus 159 C/T has been described consistently [28]. In the present study, we did not have information on household endotoxin levels, such that we were unable to undertake such an analysis. Another possibility could be that the observed association between nucleotide variation/s in the IRAK-M gene and asthma might be restricted to Sardinians, given that Sardinia underwent genetic isolation with the possibility of ‘genetic drift’ of respective alleles [29]. Studies comparing HLA genetics in populations from Sardinia and other parts of Europe showed different genotype and haplotype frequencies [30]. Association studies for other multifactorial diseases, such as multiple sclerosis (MS), also revealed
The case-control cohort of German AD patients has been presented in detail elsewhere [19]. In brief, 361 unrelated patients with AD were recruited by Q.P., a specialist in Gladbeck, Germany. The diagnostic criteria for AD [20] were met by all subjects in this cohort. The mean age of the patients was 18.5 17.6 years. For the control group, 325 unrelated persons with no history of AD, asthma or rhinitis were recruited via the same practice as the AD patients. The mean age of these controls was 62.1 11.7 years. Patients as well as controls were Germans with European ancestry. Informed consent was obtained from all subjects, the study was approved by the Ethics Committee of the Ruhr-University Bochum, Germany, and protocols defined in the Declaration of Helsinki protocols were followed. 2.2. Molecular genetic analysis Genomic DNA was extracted from blood samples according to a standard salting-out method [21]. Four nucleotide variations (rs1177578, rs2141709, rs11465955 and rs1370128) were investigated using polymerase chain reaction (PCR)-coupled restriction endonuclease digestion (see Table 1 for details). The PCR was carried out in a volume of 10 ml using 40 ng DNA, 2 mM of each dNTP, 3 mmol MgCl2, 5 pmol of the respective forward (F) and reverse (R) primer and 0.4 U Taq polymerase (Genecraft, Cologne, Germany). Thermal cycling was performed on a Biometra thermal cycler (Go¨ttingen, Germany). After two initial cycles at 6 C and 3 C above the annealing temperature, 27 cycles of 95 C (45 s), annealing temperature (45 s) and 72 C (30 s) were run. Primer sequences and annealing temperatures are shown in Table 1. PCR products were treated with the respective restriction enzymes (0.01 U/ng DNA; Table 1) at 37 C for 3 h and then resolved in ethidium-stained (2.5%) agarose gel bands; images of the gels were captured digitally. The remaining two SNPs (rs2870784 and rs1624395) were investigated using TaqMan assays (Applied Biosystems, Foster City, USA), according to the manufacturer’s instructions for the thermal cycler used (iCycler, Bio-Rad Laboratories, Munich, Germany). Reliability of the results was affirmed by random re-evaluation on consecutive days. 2.3. Statistics Comparison of allele and genotype frequencies between AD patients and control subjects was performed using c2-tests. P 0.05 was considered as significant. Testing for Hardy–Weinberg equilibrium (HWE) was conducted using the program DeFinetti (http://ihg2. helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl). Haplotype analyses were performed using the program Haploview v.4.1 [22].
Table 1 PCR conditions, primers and restriction enzymes. rs number
Location
Alleles
Primer
Annealing temperature
Restriction enzyme
rs2870784 rs1177578
50 region 50 region
A/C C/G
TaqMan
– 58 C
– Alw26I
rs2141709
50 region
C/T
55 C
Hin6I
rs11465955
Intron 3 (boundary)
C/T
rs1624395 rs1370128
Intron 6 Intron 6
A/G C/T
F: GAAACGAAATTCTCCAAGGGTG R: GCTTCTTGAGACATTTTGTCTCCC F: AAAGAAAATAGAAAATGTTACCTCTCCCTA R: CACCCCTTTTATTCTGGTAATCCA F: ACTTTGTTGCATGTATAATTGAGCATAA R: CAGATCACTGAGAACAGAAAGCTCTTA TaqMan F: AGTTGTTCAAATCTGTTTACCACACC R: GCCACCCAATCTTTTGCTACA
58 C
MspI
– 62 C
– BanI
18
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19
Table 2 Allele and genotype frequencies of IRAK-M polymorphisms in AD patients and subjects with no history of AD (controls). rs number
Genotypes
rs2870784
C/C C/A A/A n
Alleles
C A n rs1624395
G/G G/A A/A n G A n
rs1370128
T/T T/C C/C n T C n
rs11465955
T/T T/C C/C n T C n
rs1177578
G/G G/C C/C n G C n
rs2141709
T/T T/C C/C n T C n
AD-patients
Controls
P-value
197 (54.6%) 133 (36.8%) 31 (8.6%) 361 527 (73.0%) 195 (27.0%) 722 159 (44.4%) 155 (43.3%) 44 (12.3%) 358 473 (66.1%) 243 (33.9%) 716 46 (12.7%) 161 (44.6%) 154 (42.7%) 361 253 (35.0%) 469 (65.0%) 722 34 (9.4%) 161 (44.6%) 166 (46.0%) 361 229 (31.7%) 493 (68.3%) 722 120 (34.0%) 161 (45.6%) 72 (20.4%) 353 401 (56.8%) 305 (43.2%) 706 50 (13.9%) 164 (45.4%) 147 (40.7%) 361 264 (36.6%) 458 (63.4%) 722
166 (51.1%) 138 (42.5%) 21 (6.5%) 325 470 (72.3%) 180 (27.7%) 650 139 (42.9%) 149 (46.0%) 36 (11.1%) 324 427 (65.9%) 221 (34.1%) 648 38 (11.8%) 149 (46.3%) 135 (41.9%) 292 225 (34.9%) 419 (65.1%) 644 24 (7.4%) 139 (42.8%) 162 (49.8%) 325 187 (28.8%) 463 (71.2%) 650 97 (29.8%) 164 (50.5%) 64 (19.7%) 325 358 (55.1%) 292 (45.0%) 650 43 (13.5%) 150 (47.0%) 126 (39.5%) 319 236 (37.0%) 402 (63.0%) 638
0.2489
several diseases, including allergic conditions [35,36]. Thus, thorough association analysis in large cohorts, integrating gene/gene and gene/environment interactions, should be considered in the future, in order to explore the possible role of TLR signalling molecules in the pathogenesis of allergic diseases. References
0.7765
0.9484
0.7531
0.8827
0.9680
0.4439
0.2145
0.3057
0.5611
0.9171
0.8710
different association patterns for HLA alleles between subjects from Sardinia and other parts of Europe [31,32]. Thus, although the original study in Sardinia was replicated using a cohort from mainland Italy, there may still have been specific genetic influences which ‘drifted’ from Sardinia to the mainland population or vice versa. Variations in several genes of the TLR family or related signal transduction molecules, including TLR2 [33], TLR9 [34], toll-interacting protein (TOLLIP) [16] and interferon regulatory factor 1 (IRF1) [17], have been linked to AD in some previous studies, although most of these results have not been able to be reproduced. Therapeutic targeting of the TLR pathway has already been suggested for
Table 3 Haplotype frequencies of IRAK-M polymorphisms in AD patients and subjects with no history of AD (controls). Haplotype
Frequency in AD patients (n ¼ 361)
Frequency in controls (n ¼ 325)
P-value
112221 121112 212212 121222 112212 112222 121121
0.333 0.267 0.247 0.033 0.026 0.016 0.013
0.338 0.246 0.254 0.044 0.026 0.018 0.018
0.863 0.378 0.754 0.291 0.933 0.764 0.382
[1] Leung DY, Bieber T. Atopic dermatitis. Lancet 2003;361:151–60. [2] Kiken DA, Silverberg NB. Atopic dermatitis in children, part 1: epidemiology, clinical features, and complications. Cutis 2006;78:241–7. [3] Wuthrich B, Cozzio A, Roll A, Senti G, Kundig T, Schmid-Grendelmeier P. Atopic eczema: genetics or environment? Ann Agric Environ Med 2007;14:195–201. [4] Williams H, Robertson C, Stewart A, Ait-Khaled N, Anabwani G, Anderson R, et al. Worldwide variations in the prevalence of symptoms of atopic eczema in the International Study of Asthma and Allergies in Childhood. J Allergy Clin Immunol 1999;103:125–38. [5] Schultz Larsen F, Hanifin JM. Secular change in the occurrence of atopic dermatitis. Acta Derm Venereol Suppl (Stockh) 1992;176:7–12. [6] Williams HC. Epidemiology of atopic dermatitis. Clin Exp Dermatol 2000;25:522–9. [7] Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol 2004;4: 499–511. [8] Su J, Xie Q, Wilson I, Li L. Differential regulation and role of interleukin-1 receptor associated kinase-M in innate immunity signaling. Cell Signal 2007;19:1596–601. [9] Kobayashi K, Hernandez LD, Galan JE, Janeway Jr CA, Medzhitov R, Flavell RA. IRAK-M is a negative regulator of toll-like receptor signaling. Cell 2002;110:191–202. [10] Nakashima K, Hirota T, Obara K, Shimizu M, Jodo A, Kameda M, et al. An association study of asthma and related phenotypes with polymorphisms in negative regulator molecules of the TLR signaling pathway. J Hum Genet 2006;51:284–91. [11] Barnes KC, Neely JD, Duffy DL, Freidhoff LR, Breazeale DR, Schou C, et al. Linkage of asthma and total serum IgE concentration to markers on chromosome 12q: evidence from Afro-Caribbean and Caucasian populations. Genomics 1996;37:41–50. [12] Raby BA, Silverman EK, Lazarus R, Lange C, Kwiatkowski DJ, Weiss ST. Chromosome 12q harbors multiple genetic loci related to asthma and asthmarelated phenotypes. Hum Mol Genet 2003;12:1973–9. [13] Balaci L, Spada MC, Olla N, Sole G, Loddo L, Anedda F, et al. IRAK-M is involved in the pathogenesis of early-onset persistent asthma. Am J Hum Genet 2007;80:1103–14. [14] Cookson W. Genetics and genomics of asthma and allergic diseases. Immunol Rev 2002;190:195–206. [15] Osmola A, Czarnecka-Operacz M, Silny W. Genetic aspects of atopy and atopic dermatitis. Acta Dermatovenerol Croat 2005;13:122–6. [16] Schimming TT, Parwez Q, Petrasch-Parwez E, Nothnagel M, Epplen JT, Hoffjan S. Association of toll-interacting protein gene polymorphisms with atopic dermatitis. BMC Dermatol 2007;7:3. [17] Schedel M, Pinto LA, Schaub B, Rosenstiel P, Cherkasov D, Cameron L, et al. IRF1 gene variations influence IgE regulation and atopy. Am J Respir Crit Care Med 2008;177:613–21. [18] Shimizu M, Matsuda A, Yanagisawa K, Hirota T, Akahoshi M, Inomata N, et al. Functional SNPs in the distal promoter of the ST2 gene are associated with atopic dermatitis. Hum Mol Genet 2005;14:2919–27. [19] Macaluso F, Nothnagel M, Parwez Q, Petrasch-Parwez E, Bechara FG, Epplen JT, et al. Polymorphisms in NACHT-LRR (NLR) genes in atopic dermatitis. Exp Dermatol 2007;16:692–8. [20] Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta Derm Venereol 1980;92:44–7. [21] Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. [22] Zhang K, Qin ZS, Liu JS, Chen T, Waterman MS, Sun F. Haplotype block partitioning and tag SNP selection using genotype data and their applications to association studies. Genome Res 2004;14:908–16. [23] Heinzmann A, Grotherr P, Jerkic SP, Lichtenberg A, Braun S, Kruse S, et al. Studies on linkage and association of atopy with the chromosomal region 12q13-24. Clin Exp Allergy 2000;30:1555–61. [24] Hoffjan S, Epplen JT. The genetics of atopic dermatitis: recent findings and future options. J Mol Med 2005;83:682–92. [25] Ober C, Hoffjan S. Asthma genetics 2006: the long and winding road to gene discovery. Genes Immun 2006;7:95–100. [26] Tanaka K, Roberts MH, Yamamoto N, Sugiura H, Uehara M, Mao XQ, et al. Genetic variants of the receptors for thromboxane A2 and IL-4 in atopic dermatitis. Biochem Biophys Res Commun 2002;292:776–80. [27] Bisgaard H, Simpson A, Palmer CN, Bonnelykke K, McLean I, Mukhopadhyay S, et al. Gene-environment interaction in the onset of eczema in infancy: filaggrin loss-of-function mutations enhanced by neonatal cat exposure. PLoS Med 2008;5:e131. [28] Martinez FD. CD14, endotoxin, and asthma risk: actions and interactions. Proc Am Thorac Soc 2007;4:221–5. [29] Piazza A, Cappello N, Olivetti E, Rendine S. A genetic history of Italy. Ann Hum Genet 1988;52:203–13.
J. Beygo et al. / Molecular and Cellular Probes 23 (2009) 16–19 [30] Vona G, Bitti PP, Succa V, Mameli GE, Salis M, Secchi G, et al. HLA phenotype and haplotype frequencies in Sardinia (Italy). Coll Antropol 1997;21:461–75. [31] Marrosu MG, Murru MR, Costa G, Cucca F, Sotgiu S, Rosati G, et al. Multiple sclerosis in Sardinia is associated and in linkage disequilibrium with HLA-DR3 and -DR4 alleles. Am J Hum Genet 1997;61:454–7. [32] Sotgiu S, Pugliatti M, Sanna A, Sotgiu A, Castiglia P, Solinas G, et al. Multiple sclerosis complexity in selected populations: the challenge of Sardinia, insular Italy. Eur J Neurol 2002;9:329–41. [33] Ahmad-Nejad P, Mrabet-Dahbi S, Breuer K, Klotz M, Werfel T, Herz U, et al. The toll-like receptor 2 R753Q polymorphism defines a subgroup of patients with
19
atopic dermatitis having severe phenotype. J Allergy Clin Immunol 2004;113:565–7. [34] Novak N, Yu CF, Bussmann C, Maintz L, Peng WM, Hart J, et al. Putative association of a TLR9 promoter polymorphism with atopic eczema. Allergy 2007;62:766–72. [35] Hong-Geller E, Chaudhary A, Lauer S. Targeting toll-like receptor signaling pathways for design of novel immune therapeutics. Curr Drug Discov Technol 2008;5:29–38. [36] O’Neill LA. Therapeutic targeting of toll-like receptors for inflammatory and infectious diseases. Curr Opin Pharmacol 2003;3:396–403.