- Email: [email protected]
Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade
Journal Pre-proofs Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade Jialing Bao, Lulu Liu, Yaoyao An, Maoshuang Ran, Wenjia Ni, Jie Chen, Junhong Wei, Tian Li, Guoqing Pan, Zeyang Zhou PII: DOI: Reference:
S0022-2011(19)30194-6 https://doi.org/10.1016/j.jip.2019.107260 YJIPA 107260
To appear in:
Journal of Invertebrate Pathology
Received Date: Revised Date: Accepted Date:
9 July 2019 9 October 2019 12 October 2019
Please cite this article as: Bao, J., Liu, L., An, Y., Ran, M., Ni, W., Chen, J., Wei, J., Li, T., Pan, G., Zhou, Z., Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade, Journal of Invertebrate Pathology (2019), doi: https://doi.org/10.1016/j.jip. 2019.107260
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier Inc.
Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade
Jialing Bao1,2,*, Lulu Liu1,2,*, Yaoyao An1,2,*, Maoshuang Ran1,2, Wenjia Ni1,2, Jie Chen1,2, Junhong Wei1,2, Tian Li1,2,Guoqing Pan1,2,†, Zeyang Zhou1,2,3
1 State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, China 2 Chongqing Key Laboratory of Microsporidia Infection and Control, Southwest University, Chongqing, China 3 Chongqing Normal University, Chongqing, China * Authors contribute equally to this article † To Whom correspondence should be addressed: Guoqing Pan, State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, China; Email: [email protected] Tel: +86-23-68251088
ABSTRACT Nosema bombycis is a pathogen of the silkworm that belongs to the microsporidia, a group of obligate intracellular parasites related to fungi. N. bombycis infection causes the disease pébrine in silkworms. Insects utilize hemolymph melanization as part of the innate immune response to fight against pathogens, and melanization relies on a serine protease-mediated prophenoloxidase (PPO) activation cascade that is tightly regulated by serine protease inhibitors (serpins). Previous studies showed that N. bombycis infection suppressed silkworm hemolymph melanization, however the mechanism has not been elucidated. We hypothesize that N. bombycis can secret serpins (NbSPNs) to inhibit host serine proteases in the PPO activation cascade, thus suppressing phenoloxidase (PO) activity and the consequent melanization. We demonstrated in this study that N. bombycis infection suppressed silkworm PO activity and melanization and we identified the expression of N. bombycis serpin 6 (NbSPN6) in the hemolymph of the infected host. When recombinant NbSPN6 was added to
normal hemolymph, PO activity was inhibited in a dose-dependent manner. Moreover, in vivo analysis by RNA interference technology showed that when NbSPN6 expression is blocked, the inhibitory effects on PO activity can be reversed and the proliferation of N. bombycis within host can be suppressed. These results demonstrated the indispensable role of NbSPN6 in successful pathogen infection. To further elucidate the molecular basis of NbSPN6 suppressing host defense, we determined that the host serine protease prophenoloxidase-activating enzyme (PPAE) is the direct target of NbSPN6 inhibition. Taken together, our novel study is the first to elucidate the molecular mechanism of pathogen-derived serpin inhibiting hemolymph melanization and, thus, regulating host innate immune responses. This study may also provide novel strategies for preventing microsporidia infection.
Keywords: Nosema bombycis, serpin, hemolymph melanization, phenoloxidase activity, innate immunity
1. Introduction
Microsporidia are a group of unicellular parasites related to fungi that have a broad range of hosts, including insects (e.g., silkworms and fruit fly), fish and humans. Nosema bombycis was the first microsporidium to be described (Nägeli, 1857). More than 1400 species have been identified; approximately 700 species can infect insects and over 17 species in 9 genera are known to infect humans, especially immune-deficient individuals (Vávra & Lukeš 2013). N. bombycis usually infects the host silkworm by oral infection. The pathogen encounters the digestive tract first, then ejects the spore contents through a polar tube into the gut epithelia. It then enters the hemolymph and causes systemic infection (Botts et al. 2016; Keeling & Fast 2002). Thus, defensive functions of hemolymph are essential for the host. Silkworms, like other invertebrates, mainly depend on the host innate immunity to fight against pathogens, and the hemocyte-mediated encapsulation and melanization in hemolymph are especially critical to clear microsporidia (Tokarev et al. 2007; Yan et al. 2017; Jiao et al. 2018). At least five types of hemocytes have been identified in insects- prohemocytes, spherulocytes, plasmatocytes, granulocytes and oenocytoids (Ribeiro & Brehelin 2006). Oenocytoids are involved in phenoloxidase (PO) production and subsequent melanization in silkworm, as well as pathogen phagocytosis and encapsulation (Ashida et al. 1988; Giulianini et al. 2003; Jiang et al 1997). However, recent studies have revealed that N. bombycis infection may suppress silkworm hemolymph melanization (Ma et al. 2013). Hemolymph melanization is initiated by a serine protease activation cascade within the hemocyte (Lu et al. 2014). Recognition of invading microorganisms or aberrant host tissues may trigger the autoactivation of the first proteinase in the pathway, leading to the sequential activation of other components in the system through limited proteolysis. Prophenoloxidase-activating proteinase (PAP) (also known as prophenoloxidase-activating enzyme (PPAE)) is the terminal enzyme that directly converts proPO to PO. The reactions catalyzed by phenoloxidase can then result in melanization of foreign organisms trapped in capsules or hemocyte nodules. (Ashida 1990; Jiang et al. 2003). Thus we hypothesized that serine protease inhibitors (serpins) secreted by N. bombycis inhibit host serine protease activation, thus affecting melanin formation in the hemolymph. Serpins are a broadly distributed superfamily of protease inhibitors that are present in all kingdoms of life (Silverman et al. 2001). Most serpins function as potent serine or cysteine
proteases inhibitors, participating in various physiological processes. Recent studies have revealed that serpins have important roles in infection and inflammation. In the insects, serpins can modulate innate immunity by targeting serine proteases of the PO activation cascade thus inhibiting hemolymph melanization (Christen et al. 2012; Meekins et al. 2017; Suwanchaichinda et al. 2013). For example, a Drosophila serpin, Serpin-27A, was shown to inhibit melanization through the specific inhibition of the prophenoloxidase-activating enzyme (PPAE) in the PO activation cascade. (Danielli et al. 2003; De Gregorio et al. 2002; Nappi & Christensen 2005). More interestingly, certain pathogens can also secret serpins that are believed to modulate host immune responses. For example, when a venom serpin from the parasitoid Cotesia rubecula was injected into the host Pieris rapae, melanization and the PO activation cascade were inhibited (Asgari et al. 2003). In addition, a serpin named Hesp018 from the Hemileuca sp. nucleopolyhedrovirus (HespNPV) inhibited melanization and PO activation when mixed with lepidopteran hemolymph (Ardisson-Araujo et al. 2015), and serpins (SPI-2 and CrmA) from poxvirus can inhibit host serine and cysteine proteases in cytokine producing and apoptosis pathways (Irving et al. 2002; Qin et al. 2017). In N. bombycis, 19 serpins (NbSPNs) have been identified. Our preliminary studies confirmed that after N. bombycis infection, certain NbSPNs exist in the hemolymph of the silkworm. These results further support our hypothesis that N. bombycis inhibits host hemolymph melanisation by secreting NbSPNs. In the current study, we aimed to identify the NbSPN(s) that inhibit melanization and the targeted serine proteases in the host. We elucidated the molecular mechanism of N. bombycis inhibition of silkworm melanization, which should provide new strategies against the harmful effects of N. bombycis infection. 2. Material and Methods 2.1. Parasite and host Microsporidia N. bombycis CQ 1 was isolated from silkworm Bombyx mori in Chongqing China and conserved in the China Veterinary Culture Collection Center (CVCC No. 102059). N. bombycis strains were propagated in silkworms and maintained in the laboratory. Purified spores were obtained using the discontinuous density gradient centrifugation method as previously described (Wu et al. 2008). Silkworm B. mori Dazao strain was maintained in the
Gene Resource Library of Domesticated Silkworm (Southwest University, Chongqing, China).
2.2. N. bombycis infection of silkworms N. bombycis spores were suspended in distilled water to a concentration of 107 spores per ml. The solution was evenly spread onto mulberry tree leaves and air dried. These tree leaves were fed to silkworms at the fifth instar stage. Silkworms were fed clean mulberry tree leaves as a control (Yue et al. 2015).
2.3. Protein extraction and Western blotting Fifth-instar larvae were chilled on ice for at least 20 min and hemolymph was collected into individual microcentrifuge tubes by clipping the dorsal horn with scissors. Phenylthiourea (PTU) was added to the hemolymph to inhibit melanization. Hemocytes were removed by centrifugation at 10,000 × g for 6 min at 4°C. Plasma samples were stored at −80°C. The total protein of hemolymph was extracted. Briefly, hemolymph was mixed with RIPA Lysis Buffer for 30 min and then centrifuged at 13,800 × g for 5 min at 4 °C. The supernatant was collected as the total protein sample. Protein concentration was detected using the BCA protein assay. For immunoblotting analysis, samples containing about 10 μg protein were subjected to SDSPAGE and transferred to a PVDF western blotting membrane (Roche). The membrane was incubated with mouse anti-NbSPN6 (diluted 1:2000 in blocking solution (PBST containing skim milk)) for 1.5 h at 37 °C, washed and reacted with secondary antibody, anti-mouse IgGperoxidase antibody produced in goat (1:8000 dilution; A3682, Sigma) for 1 h at 37 °C. The blot was developed with an ECL western blot detection kit (Thermo Fisher).
2.4. Immunofluorescence assay (IFA) Infected cells were fixed in paraformadehyde and permeabilized with Triton X-100. Samples were then washed 3 times with PBS + 0.1% Triton X-100 (PBST) and blocked in PBST containing 10% goat serum and 5% BSA for 1 h at 37˚C. After three washes, samples were incubated for 1 h at 37 ˚ C with NbSPN6 antiserum (diluted 1:100 in blocking solution)
containing 2% Triton X-100. After washing with PBST, the samples were maintained in darkness for 1 h at 37˚C with Alexa Fluor 594 conjugate Goat anti-Mouse IgG (Thermo Fisher). Samples were then washed in PBST and stained for 5 min in DAPI (4 ’ 6-diamidino-2phenylindole, Sigma) for nucleus labeling. After washing with PBST, ProLong1 Gold antifade reagents (Thermo Fisher) were added and cells were imaged using an Olympus FV1200 laser scanning confocal microscope.
2.5. PO activity assay The PO activity assays were conducted in 96-well plates containing 5 μL hemolymph followed by addition of a 150-μL substrate solution (2 mM dopamine in PBS [pH 7.4]). PO activity was determined at 492 nm using a plate reader. One unit of activity was defined as ΔA492 of 0.001 in one minute. To measure the inhibition effect of NbSPN6 on PO activity of hemolymph, the recombinant NbSPN6 was purified from E. coli Rosetta expression (pGEX-4T-1- NbSPN6 vector)；GST affinity chromatography was used to purify the protein. Hemolymph from naïve fifth instar larvae was then mixed with recombinant NbSPN6 (at final concentrations of 0, 12.5, 25, 50 ng/μL). Phenylthiourea (PTU) was used as control to show inhibition effect. After incubation for 10 min at room temperature, the reaction mixtures were subjected to the PO activity assay mentioned above.
2.6. RNA interference Double strand RNA (dsRNA) specifically designed for targeting NbSPN6 was synthesized using MEGAscript T7 Transcription kit (Invitrogen). The synthesizing primers designated for NbSPN6 were Forward 5'-AACTGCAGTGAAGGCGAATTTGAAAAT-3' and Reverse 5'ATAGTTTAGCGGCCGCTCCAACCATTTTGAATGT-3'. The dsRNA was then isolated and purified, stored at -80oC. To block the expression of NbSPN6, 10 μL (3 μg) dsRNA was injected into the silkworm hemocoel; ddH2O was injected into the hemocoel of the control insects. These injections were performed immediately after the silkworms were orally inoculated with N. bombycis spores. To confirm the interference efficiency, NbSPN6 transcripts
levels
were
determined
by
qRT-PCR
using
Forward
primer
5'-
GTTTTACCGAAGCGGATGC
-3'
and
Reverse
primer
5'-
CACCAACGTCTCTCGTAAGGAAC -3'.
2.7. Yeast two-hybrid analysis A yeast two-hybrid assay was used to investigate the interaction of NbSPN6 with PPAE. The detailed procedure was described previously (Bouzahzah et al. 2010). NbSPN6 was cloned into a pGBKT7 plasmid, and PPAE was cloned into pGADT7 plasmid (Clontech, Takara Bio USA). The plasmids were used to transform competent yeast cells using YeastMaker Yeast Transformation System 2 (Takara, Mountain View, CA 94043, USA), and the binding was validated in synthetic dropout-Leu-Trp-His-Ade medium supplemented with X-α-gal. The fusion strain of pGBKT7-53 with pGADT7-T was used as the positive control; the fusion strain of pGBKT7-lam with pGADT7-T was used as the negative control.
3. Results 3.1. Host hemolymph melanization is suppressed after N. bombycis infection In order to study the inhibition of silkworm hemolymph melanization by N. bombycis, silkworms at the 5th instar stage were infected with 1×107/ml of N. bombycis.
Hemolymph
was drawn daily from the third day of infection (3 dpi) until the sixth day of infection (6 dpi). The results showed that the hemolymph melanization of infected silkworms was significantly suppressed compared to that of normal silkworms (Fig. 1).
3.2. Host phenoloxidase activity is inhibited after N. bombycis infection Hemolymph melanization is initiated by a serine protease activation cascade that leads to phenoloxidase (PO) and melanin production. Thus the PO activity in hemolymph can reflect the extent of hemolymph melanization, and also function as the indicator of the serine protease cascade activation. In this study, silkworms of the 5th instar were infected with 1×107/ml of N. bombycis and hemolymph was drawn on the first day after infection and daily for 6 days. The PO activity of each sample was measured as described in the Materials and Methods Section. The results demonstrated that the PO activity of infected silkworm was significantly inhibited compared to the control silkworms by day 3 and thereafter (Fig. 2).
3.3. NbSPN6 is identified in N. bombycis-infected silkworm hemolymph To explore the role of N. bombycis-derived serpins in melanization inhibition, we first utilized Western blot assays to confirm whether NbSPNs exist in the hemolymph. Our preliminary study revealed 19 serpin genes from N. bombycis genome and found ten of them possess signal peptide sequences; NbSPN6 is one of them. In addition, so far we have detected the expression of NbSPN6 but not other NbSPNs in the host hemolymph after N. bombycis infection (Fig. 3A). The expression of NbSPN6 was also confirmed in the cytoplasm of infected-hemocytes, as shown by IFA (Fig. 3B). Taken together, the expression patterns of NbSPN6 in host indicate that NbSPN6 may play a role in modulating host immunity, and probably in directly contact with serine proteases of the PO activation cascade in host hemocyte.
3.4. Recombinant NbSPN6 inhibits phenoloxidase activation To further confirm the inhibiting effects of NbSPN6 on hemolymph melanization, we mixed control silkworm hemolymph with different concentrations of purified recombinant NbSPN6. Then we analyzed the PO activity by measuring the absorbance at 492nm. The results showed that NbSPN6 efficiently inhibits hemolymph PO activity, in a dose-dependent manner (Fig. 4). These results indicate that NbSPN6 specifically inhibits the PO activation cascade.
3.5. Interfering with NbSPN6 expression reverses inhibition effects In order to further confirm the inhibiting efficiency and specificity of NbSPN6 under physiological conditions, we utilized RNAi technology to block the expression of NbSPN6 in Nb-infected silkworms. NbSPN6-dsRNA or control (ddH2O) was injected into the silkworm hemocoel immediately after N. bombycis infection. The expression of NbSPN6 was determined by RT-PCR (Fig. 5A). The hemolymph was drawn from 3 dpi to 6 dpi, and PO activity was measured. As shown in Fig. 5B, the PO activity was significantly restored in response to the interference of NbSPN6 expression in the host hemolymph. Furthermore, interference with expressions of NbSPN6 suppressed proliferation of N. bombycis.
3.6. NbSPN6 directly interacts with host serine protease PPAE
To identify the target enzyme of NbSPN6 in the host, we first analyzed the P1 site of NbSPN6 and compared it to other serpins. Prediction of P1 residue is mainly based on the distance between P14 and P1 including gap(s). Minor adjustments are made by considering that most inhibitory serpins have Ser/Thr as well as small hydrophobic residues at P1′ site (Zou et al. 2009). The result showed that the P1 site of NbSPN6 is phenylalanine, the same as for BmSerpin 31 (Fig. 6). It is known that the target enzyme of BmSerpin31/drosophila version spn77Ba is the key serine protease in melanization pathway PPAE/MP1 (Tang et al. 2008). Thus we hypothesized the target enzyme of NbSPN6 is also PPAE. To confirm our inference, we collected hemocytes from N. bombycis infected silkworms, and then used specific antibodies to analyze the sub-cellular localization of NbSPN6 and PPAE within the infected cells. The results showed that NbSPN6 and PPAE are largely co-localized in the cytoplasm of infected hemocytes (Fig. 7A). To further confirm the direct interactions between NbSPN6 and PPAE, a yeast two-hybrid system was employed. Yeast colonies containing the constructs pGBKT7- NbSPN6/pGADT7- NbSPN6 and pGBKT7- PPAE /pGADT7- PPAE grew on synthetic dropout medium (SD) plates lacking Leu, Trp, His, and Ade and containing X-α-gal (5-bromo-4-chloro-3-indoxyl- α-D-galactopyranoside) and turned blue by hydrolyzing X-αgal (Fig. 7B). Taken together, these results confirmed that NbSPN6 is able to interact with PPAE of the host, and bring about the inhibition effect on the host PO activation cascade leading to melanization suppression. 4. Discussion We elucidated the molecular basis of Nosema bombycis inhibition of host silkworm hemolymph melanization. Silkworm and other insects utilize innate immune responses, including hemolymph melanization, to combat invading pathogens (Gorman et al. 2007; Wang et al. 2019). Thus, inhibiting hemolymph melanization may be the key to N. bombycis suppression of the innate immunity and facilitation of proliferation within the host. Our data showed that N. bombycis expresses the serine protease inhibitor serpin 6 in the hemolymph of infected silkworm. We also demonstrated that the N. bombycis-expressed serpin6 interacts directly with the serine protease PPAE, a key protease in PPO activation and
subsequent melanization. Thus, the host melanization and innate immunity are inhibited. Serpins participate in a variety of biological reactions, however, there only a few studies about pathogen-derived serpin suppressing host immunity. For example, serpin CrmA from cowpox virus inhibits host cell apoptosis (Komiyama et al. 1996), and serpin27A from Drosophila inhibits immune response melanization (Nappi et al. 2005). N. bombycis has 19 serpin genes, and 10 of them have signal peptides, indicating the possibility they are secreted proteins. These serpins might be secreted by N. bombycis into the host body and modulate host immunity (Ma et al. 2013). N. bombycis proliferates within the host cell and most of the secreted proteins of N. bombycis are synthesized and released into the host cells during proliferating of protoplasm within host cells (Huang et al. 2018; Reinke et al. 2017). This enables the direct interaction/inhibition between the secreted NbSPN6 and the host melanization pathway enzymes within the host cell. In the current study, we demonstrated that serpin6 of N. bombycis is secreted into host hemolymph and directly interacts with PPAE, which is the key serine protease in the PPO activation cascade (Satoh et al. 1999). We noticed that the expression peak of NbSPN6 was occurred 3 - 4 dpi, but the inhibition effects remained throughout the infection process. Our understanding is that N. bombycis enter the hemocytes at approximately day 3 - 4 and begins to express NbSPN6 within the hemocytes and inhibit the PO activity. When proliferation terminates and mature spores burst out of hemocytes (day 5 6), increased protein expression stops.. This explains why the NbSPN6 expression levels on day 5 - 6 were much lower. However the inhibiting effects remained high because the infected hemocytes had burst and continuous infection affects more hemocytes, so that there are fewer hemocytes remaining to produce PO. Through this molecular mechanism, N. bombycis exerts an inhibiting effect on host hemolymph melanization. Our study also showed that interference with serpin 6 expression levels in the host by RNAi significantly reversed the inhibiting effect on hemolymph melanization. More importantly, when NbSPN6 expression was blocked by RNAi, the proliferation of N. bombycis within the host was significantly suppressed. These results indicate that serpin 6 from N. bombycis is a key player of N. bombycis inhibition of host hemolymph melanization.
However, N.
bombycis may express other serpins or enzymes to produce the full effect. Our preliminary studies found that N. bombycis serpin13 may be a factor.
Although the N. bombycis genome is highly compacted, this species possesses many serpinencoding genes. It is reasonable to speculate that these serpins exert multiple functions to facilitate pathogen invasion and survival. Not surprisingly, our preliminary data show that serpin 8, another serpin from N. bombycis, is able to inhibit host cell apoptosis.
By inhibiting
host cell apoptosis, N. bombycis would have more time to replicate within the infected host cells. It is of great interest to explore whether there are more serpins from N. bombycis that participate in facilitating pathogen survival and proliferation. Because serpins function as central regulators for many vital processes in various organisms, when serpin activity becomes dysfunctional, pathogenesis or severe disease states can occur. For example, a disease state in humans, serpinopathy, is caused by inactivated serpins resulting from genetic mutations (Lomas et al. 2005). The symptoms include sepsis, atherosclerosis, cancer, obesity, and unbalanced immune responses. Returning overall balance of host immunity by introduction of a beneficial serpin or by blockading detrimental serpins has been a recent trend of human disease research. Several drugs have been developed and are currently in use to replace dysfunctional serpins or to block adverse effects induced by aberrant serpins. We showed that serpins from N. bombycis infecting silkworm exert detrimental effects by modulating host immune responses. Thus, blocking the adverse effect of a pathogen-derived serpin would be a feasible strategy to control N. bombycis infection. Moreover, microsporidia are a group of pathogens that have a broad range of targeted hosts including humans, suggesting that we could also apply this strategy to control human microsporidiosis.
Conflict of interest: The authors declare that they have no conflicts of interest with the contents of this article.
Acknowledgements: We thank Dr. Judith S. Bond, Evan Pugh Professor Emeritus, Department of Biochemistry and Molecular Biology Penn State University College of Medicine at Hershey; Adjunct Professor, Department of Biochemistry & Biophysics, University of North Carolina School of Medicine at Chapel Hill, for her editorial support. We also thank Dr. Timothy Keiffer, Postdoctoral Fellow at Georgia State University as well as Dr.
Mortimer Poncz, Professor at University of Pennsylvania, for their editorial contributions.
Author contributions: JB, GP and ZZ designed the experiments. JB, LL, YA and TL performed the activity assay, IFA assay and Western blot. MR, WN, JC and JW purified the protein. JB wrote the manuscript. All authors helped with manuscript editing.
Funding: Supported by grants, Natural Science Foundation of China (No. 31802141) and Natural Science Foundation of China (No. 31470250)
References Ardisson-Araujo DMP, Rohrmann GF, Ribeiro BM, and Clem RJ. 2015. Functional characterization of hesp018, a baculovirus-encoded serpin gene. Journal of General Virology 96:1150. Asgari S, Zhang G, Zareie R, and Schmidt O. 2003. A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph. Insect Biochemistry & Molecular Biology 33:1017-1024. Ashida M, Ochiai M, Niki T. 1988. Immunolocalization of prophenoloxidase among hemocytes of the silkworm, Bombyx mori. Tissue Cell 20 (4): 599-610. 10.1016/0040-8166(88)90061-4
Ashida M. 1990. The prophenoloxidase cascade in insect immunity. Res Immunol 141:908-910. Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER. 2016. Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host. G3 (Bethesda) Sep 8;6(9):270716. 10.1534/g3.116.029983.
Bouzahzah B, Nagajyothi F, Ghosh K, Takvorian PM, Cali A, Tanowitz HB, and Weiss LM. 2010. Interactions of Encephalitozoon cuniculi polar tube proteins. Infect Immun 78:2745-2753. 10.1128/IAI.01205-09 Christen JM, Hiromasa Y, An C, and Kanost MR. 2012. Identification of plasma proteinase complexes with
serpin-3
in
Manduca
sexta.
Insect
Biochem
Mol
Biol
42:946-955.
10.1016/j.ibmb.2012.09.008 Danielli A, Kafatos FC, and Loukeris TG. 2003. Cloning and characterization of four Anopheles gambiae serpin isoforms, differentially induced in the midgut by Plasmodium berghei invasion. Journal Of Biological Chemistry 278:4184-4193. 10.1074/jbc.M208187200 De Gregorio E, Han SJ, Lee WJ, Baek MJ, Osaki T, Kawabata S, Lee BL, Iwanaga S, Lemaitre B, and Brey PT. 2002. An immune-responsive Serpin regulates the melanization cascade in Drosophila. Dev Cell 3:581-592. Giulianini PG, Bertolo F, Battistella S, Amirante GA. 2003. Ultrastructure of the hemocytes of Cetonischema aeruginosa larvae (Coleoptera, Scarabaeidae): involvement of both granulocytes and oenocytoids in in vivo phagocytosis. Tissue Cell 35 (4):243-51. 10.1016/s0040-8166(03)00037-5 Gorman MJ, Wang Y, Jiang H, and Kanost MR. 2007. Manduca sexta hemolymph proteinase 21 activates
prophenoloxidase-activating proteinase 3 in an insect innate immune response proteinase cascade. Journal Of Biological Chemistry 282:11742-11749. Huang Y, Zheng S, Mei X, Yu B, Sun B, Li B, Wei J, Chen J, Li T, Pan G, Zhou Z, Li C. 2018. A secretory hexokianse plays an active role in the proliferation of Nosema bombycis. PeerJ Sep 21;6:e5658. doi: 10.7717/peerj.5658. Jiao Z, Wen G, Tao S, Wang J, Wang G. 2018. Induction of hemocyte apoptosis by ovomermis sinensis: Implications for host immune suppression. J Invertebr Pathol Nov;159:41-48. doi: 10.1016/j.jip.2018.10.011. Irving JA, Pike RN, Weiwen D, Dieter BM, D Margaret W, Silverman GA, Coetzer THT, Clive D, Bottomley SP, and Whisstock JC. 2002. Evidence that serpin architecture intrinsically supports papain-like cysteine protease inhibition: engineering alpha(1)-antitrypsin to inhibit cathepsin proteases. Biochemistry 41:4998-5004. Jiang H, Wang Y, Korochkina SE, Benes H, Kanost MR. 1997. Molecular cloning of cDNAs for two pro-phenol oxidase subunits from the malaria vector, Anopheles gambiae. Insect Biochem Mol Biol 27 (7): 693-9. Jiang H, Wang Y, Yu XQ, Kanost MR. 2003. Prophenoloxidase-activating proteinase-2 from hemolymph of Manduca sexta. A bacteria-inducible serine proteinase containing two clip domains. J Biol Chem Feb 7; 278 (6): 3552-61.
Keeling PJ, Fast NM. 2002. Microsporidia: biology and evolution of highly reduced intracellular parasites. Annu Rev Microbiol 56:93-116. 10.1146/annurev.micro.56.012302.160854 Komiyama T, Quan LT, and Salvesen GS. 1996. Inhibition of cysteine and serine proteinases by the cowpox virus serpin CRMA. Intracellular Protein Catabolism: Springer, 173-176. Lomas DA, Belorgey D, Mallya M, Miranda E, Kinghorn KJ, Sharp LK, Phillips RL, Page R, Robertson AS, and Crowther DC. 2005. Molecular mousetraps and the serpinopathies. Biochem Soc Trans 33:321-330. 10.1042/BST0330321 Lu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan YX, Ling E. 2014. Insect Prophenoloxidase: the view beyond immunity. Front Physiol Jul 11;5:252. 10.3389/fphys.2014.00252. Ma Z, Li C, Pan G, Li Z, Han B, Xu J, Lan X, Chen J, Yang D, Chen Q, Sang Q, Ji X, Li T, Long M, and Zhou Z. 2013. Genome-wide transcriptional response of silkworm (Bombyx mori) to infection by the microsporidian Nosema bombycis. PLoS One 8:e84137. 10.1371/journal.pone.0084137 Meekins DA, Kanost MR, and Michel K. 2017. Serpins in Arthropod Biology. Seminars in Cell & Developmental Biology 62:105-119. Nägeli K. 1857. Uber die neue Krankheit der Seidenraupe und verwandte Organismen. Bot. Ztg.15:760– 761 Nappi A, Frey F, and Carton Y. 2005. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J Insect Physiol 51:197-205. Nappi AJ, and Christensen BM. 2005. Melanogenesis and associated cytotoxic reactions: Applications to insect innate immunity. Insect Biochemistry & Molecular Biology 35:443-459. Pan MH, Cai XJ, Liu M, Lv J, Tang H, Tan J, and Lu C. 2010. Establishment and characterization of an ovarian
cell
line
of
the
silkworm,
Bombyx
mori.
Tissue
Cell
42:42-46.
10.1016/j.tice.2009.07.002 Qin Y, Li M, Zhou SL, Yin W, Bian Z, and Shu HB. 2017. SPI-2/CrmA inhibits IFN-β induction by targeting TBK1/IKKε. Scientific Reports 7:10495. Reinke AW, Balla KM, Bennett EJ, Troemel ER. 2017. Identification of microsporidia host-exposed proteins reveals a repertoire of rapidly evolving proteins. Nat Commun Jan 9;8:14023. doi:
10.1038/ncomms14023. Ribeiro C, Brehelin M. 2006. Insect haemocytes:What type of cell is that? J Insect Physiol 52 (5): 417-29. 10.1016/j.jinsphys.2006.01.005 Satoh D, Horii A, Ochiai M, and Ashida M. 1999. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori. Purification, characterization, and cDNA cloning. J Biol Chem 274:7441-7453. 10.1074/jbc.274.11.7441 Silverman GA, Bird PI, Carrell RW, Church FC, Coughlin PB, Gettins PG, Irving JA, Lomas DA, Luke CJ, and Moyer RW. 2001. The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. Journal Of Biological Chemistry 276:33293-33296. Suwanchaichinda C, Ochieng R, Zhuang S, and Kanost MR. 2013. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochemistry & Molecular Biology 43:555-561. Tang H, Kambris Z, Lemaitre B, Hashimoto C. 2008. A serpin that regulateds immune melanization in the
respiratory
system
of
Drosophila.
Dev
Cell
Oct;15(4):617-26.
doi:
10.1016/j.devcel.2008.08.017. Tokarev YS, Sokolova YY, Entzeroth R. 2007. Microsporidia-insect host interactions: teratoid sporogony at the sites of host tissue melanization. J Invertebr Pathol 94(1):70-3. 10.1016/j.jip.2006.08.006 Vávra J, and Lukeš J. 2013. Microsporidia and ‘the art of living together’.
Advances in parasitology:
Elsevier, 253-319. Wang L, Liu H, Fu H, Zhang L, Guo P, Xia Q, and Zhao P. 2019. Silkworm serpin32 functions as a negativeregulator
in
prophenoloxidase
activation.
Dev
Comp
Immunol
91:123-131.
10.1016/j.dci.2018.10.006 Wu Z, Li Y, Pan G, Tan X, Hu J, Zhou Z, and Xiang Z. 2008. Proteomic analysis of spore wall proteins and identification of two spore wall proteins from Nosema bombycis (Microsporidia). Proteomics 8:2447-2461. 10.1002/pmic.200700584 Yang Z, Fang Q, Liu Y, Xiao S, Yang L, Wang F, An C, Werren JH, Ye G. 2017. A Venom Serpin Splicing Isoform of the Endoparasitoid Wasp Pteromalus puparum Suppresses Host Prophenoloxidase Cascade by Forming Complexes with Host Hemolymph Proteinases. J Biol Chem Jan 20;292(3):1038-1051. doi: 10.1074/jbc.M116.739565. Yue YJ, Tang XD, Xu L, Yan W, Li QL, Xiao SY, Fu XL, Wang W, Li N, Shen ZY. 2015. Early responses of silkworm midgut to microsporidium infection--A Digital Gene Expression analysis. J Invertebr Pathol
Jan;124:6-14. doi: 10.1016/j.jip.2014.10.003.
Zou Z, Picheng Z, Weng H, Mita K, Jiang H. 2009. A comparative analysis of serpin genes in the silkworm genome. Genomics Apr;93(4):367-75. doi: 10.1016/j.ygeno.2008.12.010.
Fig. 1. Melanization of hemolymph from control and N.bombycis-infected silkworms. (A) Observation of hemolymph melanization in 96-well plate. Left rows, hemolymph from control silkworms (n=9); Right rows, hemolymph from N. bombycis infected silkworms (n=9). The melanization of hemolymph from N. bombycis-infected silkworms was significantly suppressed. (B) Quantification of
melanization scale: absorbance was 492 nm on a spectrometer （** = P＜0.01; N=9).
Fig. 2. Phenoloxidase (PO) activities of hemolymph from control and N. bombycis-infected silkworms. Hemolymph samples were collected from 1 to 6 dpi, then L-DOPA was added as substrate. The absorbance was 492 nm on a spectrometer, and 1 unit of PO activity was defined as 0.001 Δ492/min. The results showed that the PO activity of infected silkworm was significantly inhibited compared to the control silkworms （** = P＜0.01; N=20).
Fig. 3. NbSPN6 is identified in N. bombycis-infected silkworm hemolymph. （ A ） Western blot analysis of NbSPN6 expression in the hemolymph of infected silkworms. Hemolymph samples were collected from N. bombycis-infected silkworm from 1 to 6 dpi, and total protein was extracted. Western blot assays showed NbSPN6 expression in the hemolymph beginning day 3, and reached maximum levels on 3 and 4 dpi. (B) Immunofluorescent assay to check the NbSPN6 expression in hemocytes. Hemocytes were collected from hemolymph centrifugation sediments. Cell nuclei were stained with DAPI (blue), NbSPN6 was stained with a polyclonal anti-NbSPN6 primary antibody in combination with Alexa-594 conjugated secondary antibody (red). Results showed that NbSPN6 was secreted into the cytoplasm of hemocytes (arrow) by N. bombycis (arrowhead) (Scale bar= 5 m).
Fig. 4. Recombinant NbSPN6 inhibits phenoloxidase activation in vitro. Various concentrations of recombinant NbSPN6 were added to control silkworm hemolymph. Phenoloxidase (PO) activity was measured by analyzing absorbance at 492 nm. Phenylthiourea (PTU) treatment is a positive control of inhibition. (*=P＜0.05, **=P＜0.0; N=5 in each group＝
Fig. 5. Blocking NbSPN6 expression reverses PO activity inhibition and suppresses N. bombycis proliferation. Both the control and the experiment groups were infected with N. bombycis. The silkworms of control group were then injected with ddH2O (mock interference), and the silkworms of experiment group (+NbSPN6-dsRNA) were injected with NbSPN6-dsRNA. (A) Transcription levels of NbSPN6 after RNAi assay. NbSPN6 was significantly suppressed in the experiment group. (B) PO activity measurements. PO activity was determined at 492 nm and the PO activity of NbSPN6-dsRNA treated group was significantly restored compared to the control group. (C) Proliferation of N. bombycis determined by copy number of Nb-tubulin by qPCR. Proliferation was significantly suppressed in the NbSPN6-dsRNA treated group. (*= P<0.05, **=P<0.01; N=20 in each group).
Fig. 6. Prediction of P1 site of NbSPN6. Serpins from various species were aligned by domain sequences using MEGA 6.0 software (Nb=N.bombycis; Bm=Bombyx mori; Ag= Aedes aegypti；Dm= Drosophila melanogaster; Ms=Mus musculus). The alignment was adjusted according to the conserved residue in silkworm of serpin genes. P1 residue was predicted mainly based on the distance between P14 and P1 including gap(s). The predicted P1 sites were highlighted in yellow, Nbserpin6 has Phenylalanine at its P1 site.
Fig. 7. NbSPN6 directly interacts with host serine protease PPAE. (A) Immunofluorescent assay to detect the interaction between NbSPN6 and PPAE, by co-localization within N. bombycis-infected hemocytes.
Nuclei were stained by DAPI, NbSPN6 was stained with a mouse polyclonal antibody to
NbSPN6 in combination wtihAlexa-594 conjugated secondary antibody, and PPAE was stained by a
rabbit polyclonal antibody against PPAE in combination with Alexa-488 conjugated secondary antibody. In normal silkworm hemocytes, there is no NbSPN6 expression (scale bar=2 m); while in N. bombycisinfected hemocytes, NbSPN6 is largely co-localized with host PPAE. Arrows point to the co-localization of NbSPN6 with PPAE, and arrow heads point to N. bombycis (Scale bar=5 m). (B) Yeast two-hybrid assay to verify the interaction between NbSPN6 and PPAE. Interaction of pGADT7-PPAE with pGBKT7-NbSPN6 was screened by SD/-Ade/-His/-Leu/-Trp/X-α-gal/AbA medium. As shown, NbSPN6 is able to directly interact with host serine protease PPAE.
Highlights
1. The expression of Nosema bombycis serpin 6 (NbSPN6) was identified 2. NbSPN6 occurs specifically in the hemocytes 3. NbSPN6 directly interacts with and inhibits host serine protease. 4. Nosema bombycis inhibits host immune response through the expressed serpin
Graphical abstract
N. bombycis infects host hemocytes and replicates within. During proliferation, N. bombycis expresses serpin 6 (NbSPN6) in the cytoplasm of hemocyte and interact with host PPAE, a key serine protease in melanization pathway. The inhibited PPAE leads to down-regulation of PO activation in the hemolymph and subsequent hemolymph melanization.
S0022-2011(19)30194-6 https://doi.org/10.1016/j.jip.2019.107260 YJIPA 107260
To appear in:
Journal of Invertebrate Pathology
Received Date: Revised Date: Accepted Date:
9 July 2019 9 October 2019 12 October 2019
Please cite this article as: Bao, J., Liu, L., An, Y., Ran, M., Ni, W., Chen, J., Wei, J., Li, T., Pan, G., Zhou, Z., Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade, Journal of Invertebrate Pathology (2019), doi: https://doi.org/10.1016/j.jip. 2019.107260
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier Inc.
Nosema bombycis suppresses host hemolymph melanization through secreted serpin 6 inhibiting the prophenoloxidase activation cascade
Jialing Bao1,2,*, Lulu Liu1,2,*, Yaoyao An1,2,*, Maoshuang Ran1,2, Wenjia Ni1,2, Jie Chen1,2, Junhong Wei1,2, Tian Li1,2,Guoqing Pan1,2,†, Zeyang Zhou1,2,3
1 State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, China 2 Chongqing Key Laboratory of Microsporidia Infection and Control, Southwest University, Chongqing, China 3 Chongqing Normal University, Chongqing, China * Authors contribute equally to this article † To Whom correspondence should be addressed: Guoqing Pan, State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, China; Email: [email protected] Tel: +86-23-68251088
ABSTRACT Nosema bombycis is a pathogen of the silkworm that belongs to the microsporidia, a group of obligate intracellular parasites related to fungi. N. bombycis infection causes the disease pébrine in silkworms. Insects utilize hemolymph melanization as part of the innate immune response to fight against pathogens, and melanization relies on a serine protease-mediated prophenoloxidase (PPO) activation cascade that is tightly regulated by serine protease inhibitors (serpins). Previous studies showed that N. bombycis infection suppressed silkworm hemolymph melanization, however the mechanism has not been elucidated. We hypothesize that N. bombycis can secret serpins (NbSPNs) to inhibit host serine proteases in the PPO activation cascade, thus suppressing phenoloxidase (PO) activity and the consequent melanization. We demonstrated in this study that N. bombycis infection suppressed silkworm PO activity and melanization and we identified the expression of N. bombycis serpin 6 (NbSPN6) in the hemolymph of the infected host. When recombinant NbSPN6 was added to
normal hemolymph, PO activity was inhibited in a dose-dependent manner. Moreover, in vivo analysis by RNA interference technology showed that when NbSPN6 expression is blocked, the inhibitory effects on PO activity can be reversed and the proliferation of N. bombycis within host can be suppressed. These results demonstrated the indispensable role of NbSPN6 in successful pathogen infection. To further elucidate the molecular basis of NbSPN6 suppressing host defense, we determined that the host serine protease prophenoloxidase-activating enzyme (PPAE) is the direct target of NbSPN6 inhibition. Taken together, our novel study is the first to elucidate the molecular mechanism of pathogen-derived serpin inhibiting hemolymph melanization and, thus, regulating host innate immune responses. This study may also provide novel strategies for preventing microsporidia infection.
Keywords: Nosema bombycis, serpin, hemolymph melanization, phenoloxidase activity, innate immunity
1. Introduction
Microsporidia are a group of unicellular parasites related to fungi that have a broad range of hosts, including insects (e.g., silkworms and fruit fly), fish and humans. Nosema bombycis was the first microsporidium to be described (Nägeli, 1857). More than 1400 species have been identified; approximately 700 species can infect insects and over 17 species in 9 genera are known to infect humans, especially immune-deficient individuals (Vávra & Lukeš 2013). N. bombycis usually infects the host silkworm by oral infection. The pathogen encounters the digestive tract first, then ejects the spore contents through a polar tube into the gut epithelia. It then enters the hemolymph and causes systemic infection (Botts et al. 2016; Keeling & Fast 2002). Thus, defensive functions of hemolymph are essential for the host. Silkworms, like other invertebrates, mainly depend on the host innate immunity to fight against pathogens, and the hemocyte-mediated encapsulation and melanization in hemolymph are especially critical to clear microsporidia (Tokarev et al. 2007; Yan et al. 2017; Jiao et al. 2018). At least five types of hemocytes have been identified in insects- prohemocytes, spherulocytes, plasmatocytes, granulocytes and oenocytoids (Ribeiro & Brehelin 2006). Oenocytoids are involved in phenoloxidase (PO) production and subsequent melanization in silkworm, as well as pathogen phagocytosis and encapsulation (Ashida et al. 1988; Giulianini et al. 2003; Jiang et al 1997). However, recent studies have revealed that N. bombycis infection may suppress silkworm hemolymph melanization (Ma et al. 2013). Hemolymph melanization is initiated by a serine protease activation cascade within the hemocyte (Lu et al. 2014). Recognition of invading microorganisms or aberrant host tissues may trigger the autoactivation of the first proteinase in the pathway, leading to the sequential activation of other components in the system through limited proteolysis. Prophenoloxidase-activating proteinase (PAP) (also known as prophenoloxidase-activating enzyme (PPAE)) is the terminal enzyme that directly converts proPO to PO. The reactions catalyzed by phenoloxidase can then result in melanization of foreign organisms trapped in capsules or hemocyte nodules. (Ashida 1990; Jiang et al. 2003). Thus we hypothesized that serine protease inhibitors (serpins) secreted by N. bombycis inhibit host serine protease activation, thus affecting melanin formation in the hemolymph. Serpins are a broadly distributed superfamily of protease inhibitors that are present in all kingdoms of life (Silverman et al. 2001). Most serpins function as potent serine or cysteine
proteases inhibitors, participating in various physiological processes. Recent studies have revealed that serpins have important roles in infection and inflammation. In the insects, serpins can modulate innate immunity by targeting serine proteases of the PO activation cascade thus inhibiting hemolymph melanization (Christen et al. 2012; Meekins et al. 2017; Suwanchaichinda et al. 2013). For example, a Drosophila serpin, Serpin-27A, was shown to inhibit melanization through the specific inhibition of the prophenoloxidase-activating enzyme (PPAE) in the PO activation cascade. (Danielli et al. 2003; De Gregorio et al. 2002; Nappi & Christensen 2005). More interestingly, certain pathogens can also secret serpins that are believed to modulate host immune responses. For example, when a venom serpin from the parasitoid Cotesia rubecula was injected into the host Pieris rapae, melanization and the PO activation cascade were inhibited (Asgari et al. 2003). In addition, a serpin named Hesp018 from the Hemileuca sp. nucleopolyhedrovirus (HespNPV) inhibited melanization and PO activation when mixed with lepidopteran hemolymph (Ardisson-Araujo et al. 2015), and serpins (SPI-2 and CrmA) from poxvirus can inhibit host serine and cysteine proteases in cytokine producing and apoptosis pathways (Irving et al. 2002; Qin et al. 2017). In N. bombycis, 19 serpins (NbSPNs) have been identified. Our preliminary studies confirmed that after N. bombycis infection, certain NbSPNs exist in the hemolymph of the silkworm. These results further support our hypothesis that N. bombycis inhibits host hemolymph melanisation by secreting NbSPNs. In the current study, we aimed to identify the NbSPN(s) that inhibit melanization and the targeted serine proteases in the host. We elucidated the molecular mechanism of N. bombycis inhibition of silkworm melanization, which should provide new strategies against the harmful effects of N. bombycis infection. 2. Material and Methods 2.1. Parasite and host Microsporidia N. bombycis CQ 1 was isolated from silkworm Bombyx mori in Chongqing China and conserved in the China Veterinary Culture Collection Center (CVCC No. 102059). N. bombycis strains were propagated in silkworms and maintained in the laboratory. Purified spores were obtained using the discontinuous density gradient centrifugation method as previously described (Wu et al. 2008). Silkworm B. mori Dazao strain was maintained in the
Gene Resource Library of Domesticated Silkworm (Southwest University, Chongqing, China).
2.2. N. bombycis infection of silkworms N. bombycis spores were suspended in distilled water to a concentration of 107 spores per ml. The solution was evenly spread onto mulberry tree leaves and air dried. These tree leaves were fed to silkworms at the fifth instar stage. Silkworms were fed clean mulberry tree leaves as a control (Yue et al. 2015).
2.3. Protein extraction and Western blotting Fifth-instar larvae were chilled on ice for at least 20 min and hemolymph was collected into individual microcentrifuge tubes by clipping the dorsal horn with scissors. Phenylthiourea (PTU) was added to the hemolymph to inhibit melanization. Hemocytes were removed by centrifugation at 10,000 × g for 6 min at 4°C. Plasma samples were stored at −80°C. The total protein of hemolymph was extracted. Briefly, hemolymph was mixed with RIPA Lysis Buffer for 30 min and then centrifuged at 13,800 × g for 5 min at 4 °C. The supernatant was collected as the total protein sample. Protein concentration was detected using the BCA protein assay. For immunoblotting analysis, samples containing about 10 μg protein were subjected to SDSPAGE and transferred to a PVDF western blotting membrane (Roche). The membrane was incubated with mouse anti-NbSPN6 (diluted 1:2000 in blocking solution (PBST containing skim milk)) for 1.5 h at 37 °C, washed and reacted with secondary antibody, anti-mouse IgGperoxidase antibody produced in goat (1:8000 dilution; A3682, Sigma) for 1 h at 37 °C. The blot was developed with an ECL western blot detection kit (Thermo Fisher).
2.4. Immunofluorescence assay (IFA) Infected cells were fixed in paraformadehyde and permeabilized with Triton X-100. Samples were then washed 3 times with PBS + 0.1% Triton X-100 (PBST) and blocked in PBST containing 10% goat serum and 5% BSA for 1 h at 37˚C. After three washes, samples were incubated for 1 h at 37 ˚ C with NbSPN6 antiserum (diluted 1:100 in blocking solution)
containing 2% Triton X-100. After washing with PBST, the samples were maintained in darkness for 1 h at 37˚C with Alexa Fluor 594 conjugate Goat anti-Mouse IgG (Thermo Fisher). Samples were then washed in PBST and stained for 5 min in DAPI (4 ’ 6-diamidino-2phenylindole, Sigma) for nucleus labeling. After washing with PBST, ProLong1 Gold antifade reagents (Thermo Fisher) were added and cells were imaged using an Olympus FV1200 laser scanning confocal microscope.
2.5. PO activity assay The PO activity assays were conducted in 96-well plates containing 5 μL hemolymph followed by addition of a 150-μL substrate solution (2 mM dopamine in PBS [pH 7.4]). PO activity was determined at 492 nm using a plate reader. One unit of activity was defined as ΔA492 of 0.001 in one minute. To measure the inhibition effect of NbSPN6 on PO activity of hemolymph, the recombinant NbSPN6 was purified from E. coli Rosetta expression (pGEX-4T-1- NbSPN6 vector)；GST affinity chromatography was used to purify the protein. Hemolymph from naïve fifth instar larvae was then mixed with recombinant NbSPN6 (at final concentrations of 0, 12.5, 25, 50 ng/μL). Phenylthiourea (PTU) was used as control to show inhibition effect. After incubation for 10 min at room temperature, the reaction mixtures were subjected to the PO activity assay mentioned above.
2.6. RNA interference Double strand RNA (dsRNA) specifically designed for targeting NbSPN6 was synthesized using MEGAscript T7 Transcription kit (Invitrogen). The synthesizing primers designated for NbSPN6 were Forward 5'-AACTGCAGTGAAGGCGAATTTGAAAAT-3' and Reverse 5'ATAGTTTAGCGGCCGCTCCAACCATTTTGAATGT-3'. The dsRNA was then isolated and purified, stored at -80oC. To block the expression of NbSPN6, 10 μL (3 μg) dsRNA was injected into the silkworm hemocoel; ddH2O was injected into the hemocoel of the control insects. These injections were performed immediately after the silkworms were orally inoculated with N. bombycis spores. To confirm the interference efficiency, NbSPN6 transcripts
levels
were
determined
by
qRT-PCR
using
Forward
primer
5'-
GTTTTACCGAAGCGGATGC
-3'
and
Reverse
primer
5'-
CACCAACGTCTCTCGTAAGGAAC -3'.
2.7. Yeast two-hybrid analysis A yeast two-hybrid assay was used to investigate the interaction of NbSPN6 with PPAE. The detailed procedure was described previously (Bouzahzah et al. 2010). NbSPN6 was cloned into a pGBKT7 plasmid, and PPAE was cloned into pGADT7 plasmid (Clontech, Takara Bio USA). The plasmids were used to transform competent yeast cells using YeastMaker Yeast Transformation System 2 (Takara, Mountain View, CA 94043, USA), and the binding was validated in synthetic dropout-Leu-Trp-His-Ade medium supplemented with X-α-gal. The fusion strain of pGBKT7-53 with pGADT7-T was used as the positive control; the fusion strain of pGBKT7-lam with pGADT7-T was used as the negative control.
3. Results 3.1. Host hemolymph melanization is suppressed after N. bombycis infection In order to study the inhibition of silkworm hemolymph melanization by N. bombycis, silkworms at the 5th instar stage were infected with 1×107/ml of N. bombycis.
Hemolymph
was drawn daily from the third day of infection (3 dpi) until the sixth day of infection (6 dpi). The results showed that the hemolymph melanization of infected silkworms was significantly suppressed compared to that of normal silkworms (Fig. 1).
3.2. Host phenoloxidase activity is inhibited after N. bombycis infection Hemolymph melanization is initiated by a serine protease activation cascade that leads to phenoloxidase (PO) and melanin production. Thus the PO activity in hemolymph can reflect the extent of hemolymph melanization, and also function as the indicator of the serine protease cascade activation. In this study, silkworms of the 5th instar were infected with 1×107/ml of N. bombycis and hemolymph was drawn on the first day after infection and daily for 6 days. The PO activity of each sample was measured as described in the Materials and Methods Section. The results demonstrated that the PO activity of infected silkworm was significantly inhibited compared to the control silkworms by day 3 and thereafter (Fig. 2).
3.3. NbSPN6 is identified in N. bombycis-infected silkworm hemolymph To explore the role of N. bombycis-derived serpins in melanization inhibition, we first utilized Western blot assays to confirm whether NbSPNs exist in the hemolymph. Our preliminary study revealed 19 serpin genes from N. bombycis genome and found ten of them possess signal peptide sequences; NbSPN6 is one of them. In addition, so far we have detected the expression of NbSPN6 but not other NbSPNs in the host hemolymph after N. bombycis infection (Fig. 3A). The expression of NbSPN6 was also confirmed in the cytoplasm of infected-hemocytes, as shown by IFA (Fig. 3B). Taken together, the expression patterns of NbSPN6 in host indicate that NbSPN6 may play a role in modulating host immunity, and probably in directly contact with serine proteases of the PO activation cascade in host hemocyte.
3.4. Recombinant NbSPN6 inhibits phenoloxidase activation To further confirm the inhibiting effects of NbSPN6 on hemolymph melanization, we mixed control silkworm hemolymph with different concentrations of purified recombinant NbSPN6. Then we analyzed the PO activity by measuring the absorbance at 492nm. The results showed that NbSPN6 efficiently inhibits hemolymph PO activity, in a dose-dependent manner (Fig. 4). These results indicate that NbSPN6 specifically inhibits the PO activation cascade.
3.5. Interfering with NbSPN6 expression reverses inhibition effects In order to further confirm the inhibiting efficiency and specificity of NbSPN6 under physiological conditions, we utilized RNAi technology to block the expression of NbSPN6 in Nb-infected silkworms. NbSPN6-dsRNA or control (ddH2O) was injected into the silkworm hemocoel immediately after N. bombycis infection. The expression of NbSPN6 was determined by RT-PCR (Fig. 5A). The hemolymph was drawn from 3 dpi to 6 dpi, and PO activity was measured. As shown in Fig. 5B, the PO activity was significantly restored in response to the interference of NbSPN6 expression in the host hemolymph. Furthermore, interference with expressions of NbSPN6 suppressed proliferation of N. bombycis.
3.6. NbSPN6 directly interacts with host serine protease PPAE
To identify the target enzyme of NbSPN6 in the host, we first analyzed the P1 site of NbSPN6 and compared it to other serpins. Prediction of P1 residue is mainly based on the distance between P14 and P1 including gap(s). Minor adjustments are made by considering that most inhibitory serpins have Ser/Thr as well as small hydrophobic residues at P1′ site (Zou et al. 2009). The result showed that the P1 site of NbSPN6 is phenylalanine, the same as for BmSerpin 31 (Fig. 6). It is known that the target enzyme of BmSerpin31/drosophila version spn77Ba is the key serine protease in melanization pathway PPAE/MP1 (Tang et al. 2008). Thus we hypothesized the target enzyme of NbSPN6 is also PPAE. To confirm our inference, we collected hemocytes from N. bombycis infected silkworms, and then used specific antibodies to analyze the sub-cellular localization of NbSPN6 and PPAE within the infected cells. The results showed that NbSPN6 and PPAE are largely co-localized in the cytoplasm of infected hemocytes (Fig. 7A). To further confirm the direct interactions between NbSPN6 and PPAE, a yeast two-hybrid system was employed. Yeast colonies containing the constructs pGBKT7- NbSPN6/pGADT7- NbSPN6 and pGBKT7- PPAE /pGADT7- PPAE grew on synthetic dropout medium (SD) plates lacking Leu, Trp, His, and Ade and containing X-α-gal (5-bromo-4-chloro-3-indoxyl- α-D-galactopyranoside) and turned blue by hydrolyzing X-αgal (Fig. 7B). Taken together, these results confirmed that NbSPN6 is able to interact with PPAE of the host, and bring about the inhibition effect on the host PO activation cascade leading to melanization suppression. 4. Discussion We elucidated the molecular basis of Nosema bombycis inhibition of host silkworm hemolymph melanization. Silkworm and other insects utilize innate immune responses, including hemolymph melanization, to combat invading pathogens (Gorman et al. 2007; Wang et al. 2019). Thus, inhibiting hemolymph melanization may be the key to N. bombycis suppression of the innate immunity and facilitation of proliferation within the host. Our data showed that N. bombycis expresses the serine protease inhibitor serpin 6 in the hemolymph of infected silkworm. We also demonstrated that the N. bombycis-expressed serpin6 interacts directly with the serine protease PPAE, a key protease in PPO activation and
subsequent melanization. Thus, the host melanization and innate immunity are inhibited. Serpins participate in a variety of biological reactions, however, there only a few studies about pathogen-derived serpin suppressing host immunity. For example, serpin CrmA from cowpox virus inhibits host cell apoptosis (Komiyama et al. 1996), and serpin27A from Drosophila inhibits immune response melanization (Nappi et al. 2005). N. bombycis has 19 serpin genes, and 10 of them have signal peptides, indicating the possibility they are secreted proteins. These serpins might be secreted by N. bombycis into the host body and modulate host immunity (Ma et al. 2013). N. bombycis proliferates within the host cell and most of the secreted proteins of N. bombycis are synthesized and released into the host cells during proliferating of protoplasm within host cells (Huang et al. 2018; Reinke et al. 2017). This enables the direct interaction/inhibition between the secreted NbSPN6 and the host melanization pathway enzymes within the host cell. In the current study, we demonstrated that serpin6 of N. bombycis is secreted into host hemolymph and directly interacts with PPAE, which is the key serine protease in the PPO activation cascade (Satoh et al. 1999). We noticed that the expression peak of NbSPN6 was occurred 3 - 4 dpi, but the inhibition effects remained throughout the infection process. Our understanding is that N. bombycis enter the hemocytes at approximately day 3 - 4 and begins to express NbSPN6 within the hemocytes and inhibit the PO activity. When proliferation terminates and mature spores burst out of hemocytes (day 5 6), increased protein expression stops.. This explains why the NbSPN6 expression levels on day 5 - 6 were much lower. However the inhibiting effects remained high because the infected hemocytes had burst and continuous infection affects more hemocytes, so that there are fewer hemocytes remaining to produce PO. Through this molecular mechanism, N. bombycis exerts an inhibiting effect on host hemolymph melanization. Our study also showed that interference with serpin 6 expression levels in the host by RNAi significantly reversed the inhibiting effect on hemolymph melanization. More importantly, when NbSPN6 expression was blocked by RNAi, the proliferation of N. bombycis within the host was significantly suppressed. These results indicate that serpin 6 from N. bombycis is a key player of N. bombycis inhibition of host hemolymph melanization.
However, N.
bombycis may express other serpins or enzymes to produce the full effect. Our preliminary studies found that N. bombycis serpin13 may be a factor.
Although the N. bombycis genome is highly compacted, this species possesses many serpinencoding genes. It is reasonable to speculate that these serpins exert multiple functions to facilitate pathogen invasion and survival. Not surprisingly, our preliminary data show that serpin 8, another serpin from N. bombycis, is able to inhibit host cell apoptosis.
By inhibiting
host cell apoptosis, N. bombycis would have more time to replicate within the infected host cells. It is of great interest to explore whether there are more serpins from N. bombycis that participate in facilitating pathogen survival and proliferation. Because serpins function as central regulators for many vital processes in various organisms, when serpin activity becomes dysfunctional, pathogenesis or severe disease states can occur. For example, a disease state in humans, serpinopathy, is caused by inactivated serpins resulting from genetic mutations (Lomas et al. 2005). The symptoms include sepsis, atherosclerosis, cancer, obesity, and unbalanced immune responses. Returning overall balance of host immunity by introduction of a beneficial serpin or by blockading detrimental serpins has been a recent trend of human disease research. Several drugs have been developed and are currently in use to replace dysfunctional serpins or to block adverse effects induced by aberrant serpins. We showed that serpins from N. bombycis infecting silkworm exert detrimental effects by modulating host immune responses. Thus, blocking the adverse effect of a pathogen-derived serpin would be a feasible strategy to control N. bombycis infection. Moreover, microsporidia are a group of pathogens that have a broad range of targeted hosts including humans, suggesting that we could also apply this strategy to control human microsporidiosis.
Conflict of interest: The authors declare that they have no conflicts of interest with the contents of this article.
Acknowledgements: We thank Dr. Judith S. Bond, Evan Pugh Professor Emeritus, Department of Biochemistry and Molecular Biology Penn State University College of Medicine at Hershey; Adjunct Professor, Department of Biochemistry & Biophysics, University of North Carolina School of Medicine at Chapel Hill, for her editorial support. We also thank Dr. Timothy Keiffer, Postdoctoral Fellow at Georgia State University as well as Dr.
Mortimer Poncz, Professor at University of Pennsylvania, for their editorial contributions.
Author contributions: JB, GP and ZZ designed the experiments. JB, LL, YA and TL performed the activity assay, IFA assay and Western blot. MR, WN, JC and JW purified the protein. JB wrote the manuscript. All authors helped with manuscript editing.
Funding: Supported by grants, Natural Science Foundation of China (No. 31802141) and Natural Science Foundation of China (No. 31470250)
References Ardisson-Araujo DMP, Rohrmann GF, Ribeiro BM, and Clem RJ. 2015. Functional characterization of hesp018, a baculovirus-encoded serpin gene. Journal of General Virology 96:1150. Asgari S, Zhang G, Zareie R, and Schmidt O. 2003. A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph. Insect Biochemistry & Molecular Biology 33:1017-1024. Ashida M, Ochiai M, Niki T. 1988. Immunolocalization of prophenoloxidase among hemocytes of the silkworm, Bombyx mori. Tissue Cell 20 (4): 599-610. 10.1016/0040-8166(88)90061-4
Ashida M. 1990. The prophenoloxidase cascade in insect immunity. Res Immunol 141:908-910. Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER. 2016. Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host. G3 (Bethesda) Sep 8;6(9):270716. 10.1534/g3.116.029983.
Bouzahzah B, Nagajyothi F, Ghosh K, Takvorian PM, Cali A, Tanowitz HB, and Weiss LM. 2010. Interactions of Encephalitozoon cuniculi polar tube proteins. Infect Immun 78:2745-2753. 10.1128/IAI.01205-09 Christen JM, Hiromasa Y, An C, and Kanost MR. 2012. Identification of plasma proteinase complexes with
serpin-3
in
Manduca
sexta.
Insect
Biochem
Mol
Biol
42:946-955.
10.1016/j.ibmb.2012.09.008 Danielli A, Kafatos FC, and Loukeris TG. 2003. Cloning and characterization of four Anopheles gambiae serpin isoforms, differentially induced in the midgut by Plasmodium berghei invasion. Journal Of Biological Chemistry 278:4184-4193. 10.1074/jbc.M208187200 De Gregorio E, Han SJ, Lee WJ, Baek MJ, Osaki T, Kawabata S, Lee BL, Iwanaga S, Lemaitre B, and Brey PT. 2002. An immune-responsive Serpin regulates the melanization cascade in Drosophila. Dev Cell 3:581-592. Giulianini PG, Bertolo F, Battistella S, Amirante GA. 2003. Ultrastructure of the hemocytes of Cetonischema aeruginosa larvae (Coleoptera, Scarabaeidae): involvement of both granulocytes and oenocytoids in in vivo phagocytosis. Tissue Cell 35 (4):243-51. 10.1016/s0040-8166(03)00037-5 Gorman MJ, Wang Y, Jiang H, and Kanost MR. 2007. Manduca sexta hemolymph proteinase 21 activates
prophenoloxidase-activating proteinase 3 in an insect innate immune response proteinase cascade. Journal Of Biological Chemistry 282:11742-11749. Huang Y, Zheng S, Mei X, Yu B, Sun B, Li B, Wei J, Chen J, Li T, Pan G, Zhou Z, Li C. 2018. A secretory hexokianse plays an active role in the proliferation of Nosema bombycis. PeerJ Sep 21;6:e5658. doi: 10.7717/peerj.5658. Jiao Z, Wen G, Tao S, Wang J, Wang G. 2018. Induction of hemocyte apoptosis by ovomermis sinensis: Implications for host immune suppression. J Invertebr Pathol Nov;159:41-48. doi: 10.1016/j.jip.2018.10.011. Irving JA, Pike RN, Weiwen D, Dieter BM, D Margaret W, Silverman GA, Coetzer THT, Clive D, Bottomley SP, and Whisstock JC. 2002. Evidence that serpin architecture intrinsically supports papain-like cysteine protease inhibition: engineering alpha(1)-antitrypsin to inhibit cathepsin proteases. Biochemistry 41:4998-5004. Jiang H, Wang Y, Korochkina SE, Benes H, Kanost MR. 1997. Molecular cloning of cDNAs for two pro-phenol oxidase subunits from the malaria vector, Anopheles gambiae. Insect Biochem Mol Biol 27 (7): 693-9. Jiang H, Wang Y, Yu XQ, Kanost MR. 2003. Prophenoloxidase-activating proteinase-2 from hemolymph of Manduca sexta. A bacteria-inducible serine proteinase containing two clip domains. J Biol Chem Feb 7; 278 (6): 3552-61.
Keeling PJ, Fast NM. 2002. Microsporidia: biology and evolution of highly reduced intracellular parasites. Annu Rev Microbiol 56:93-116. 10.1146/annurev.micro.56.012302.160854 Komiyama T, Quan LT, and Salvesen GS. 1996. Inhibition of cysteine and serine proteinases by the cowpox virus serpin CRMA. Intracellular Protein Catabolism: Springer, 173-176. Lomas DA, Belorgey D, Mallya M, Miranda E, Kinghorn KJ, Sharp LK, Phillips RL, Page R, Robertson AS, and Crowther DC. 2005. Molecular mousetraps and the serpinopathies. Biochem Soc Trans 33:321-330. 10.1042/BST0330321 Lu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan YX, Ling E. 2014. Insect Prophenoloxidase: the view beyond immunity. Front Physiol Jul 11;5:252. 10.3389/fphys.2014.00252. Ma Z, Li C, Pan G, Li Z, Han B, Xu J, Lan X, Chen J, Yang D, Chen Q, Sang Q, Ji X, Li T, Long M, and Zhou Z. 2013. Genome-wide transcriptional response of silkworm (Bombyx mori) to infection by the microsporidian Nosema bombycis. PLoS One 8:e84137. 10.1371/journal.pone.0084137 Meekins DA, Kanost MR, and Michel K. 2017. Serpins in Arthropod Biology. Seminars in Cell & Developmental Biology 62:105-119. Nägeli K. 1857. Uber die neue Krankheit der Seidenraupe und verwandte Organismen. Bot. Ztg.15:760– 761 Nappi A, Frey F, and Carton Y. 2005. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J Insect Physiol 51:197-205. Nappi AJ, and Christensen BM. 2005. Melanogenesis and associated cytotoxic reactions: Applications to insect innate immunity. Insect Biochemistry & Molecular Biology 35:443-459. Pan MH, Cai XJ, Liu M, Lv J, Tang H, Tan J, and Lu C. 2010. Establishment and characterization of an ovarian
cell
line
of
the
silkworm,
Bombyx
mori.
Tissue
Cell
42:42-46.
10.1016/j.tice.2009.07.002 Qin Y, Li M, Zhou SL, Yin W, Bian Z, and Shu HB. 2017. SPI-2/CrmA inhibits IFN-β induction by targeting TBK1/IKKε. Scientific Reports 7:10495. Reinke AW, Balla KM, Bennett EJ, Troemel ER. 2017. Identification of microsporidia host-exposed proteins reveals a repertoire of rapidly evolving proteins. Nat Commun Jan 9;8:14023. doi:
10.1038/ncomms14023. Ribeiro C, Brehelin M. 2006. Insect haemocytes:What type of cell is that? J Insect Physiol 52 (5): 417-29. 10.1016/j.jinsphys.2006.01.005 Satoh D, Horii A, Ochiai M, and Ashida M. 1999. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori. Purification, characterization, and cDNA cloning. J Biol Chem 274:7441-7453. 10.1074/jbc.274.11.7441 Silverman GA, Bird PI, Carrell RW, Church FC, Coughlin PB, Gettins PG, Irving JA, Lomas DA, Luke CJ, and Moyer RW. 2001. The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. Journal Of Biological Chemistry 276:33293-33296. Suwanchaichinda C, Ochieng R, Zhuang S, and Kanost MR. 2013. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochemistry & Molecular Biology 43:555-561. Tang H, Kambris Z, Lemaitre B, Hashimoto C. 2008. A serpin that regulateds immune melanization in the
respiratory
system
of
Drosophila.
Dev
Cell
Oct;15(4):617-26.
doi:
10.1016/j.devcel.2008.08.017. Tokarev YS, Sokolova YY, Entzeroth R. 2007. Microsporidia-insect host interactions: teratoid sporogony at the sites of host tissue melanization. J Invertebr Pathol 94(1):70-3. 10.1016/j.jip.2006.08.006 Vávra J, and Lukeš J. 2013. Microsporidia and ‘the art of living together’.
Advances in parasitology:
Elsevier, 253-319. Wang L, Liu H, Fu H, Zhang L, Guo P, Xia Q, and Zhao P. 2019. Silkworm serpin32 functions as a negativeregulator
in
prophenoloxidase
activation.
Dev
Comp
Immunol
91:123-131.
10.1016/j.dci.2018.10.006 Wu Z, Li Y, Pan G, Tan X, Hu J, Zhou Z, and Xiang Z. 2008. Proteomic analysis of spore wall proteins and identification of two spore wall proteins from Nosema bombycis (Microsporidia). Proteomics 8:2447-2461. 10.1002/pmic.200700584 Yang Z, Fang Q, Liu Y, Xiao S, Yang L, Wang F, An C, Werren JH, Ye G. 2017. A Venom Serpin Splicing Isoform of the Endoparasitoid Wasp Pteromalus puparum Suppresses Host Prophenoloxidase Cascade by Forming Complexes with Host Hemolymph Proteinases. J Biol Chem Jan 20;292(3):1038-1051. doi: 10.1074/jbc.M116.739565. Yue YJ, Tang XD, Xu L, Yan W, Li QL, Xiao SY, Fu XL, Wang W, Li N, Shen ZY. 2015. Early responses of silkworm midgut to microsporidium infection--A Digital Gene Expression analysis. J Invertebr Pathol
Jan;124:6-14. doi: 10.1016/j.jip.2014.10.003.
Zou Z, Picheng Z, Weng H, Mita K, Jiang H. 2009. A comparative analysis of serpin genes in the silkworm genome. Genomics Apr;93(4):367-75. doi: 10.1016/j.ygeno.2008.12.010.
Fig. 1. Melanization of hemolymph from control and N.bombycis-infected silkworms. (A) Observation of hemolymph melanization in 96-well plate. Left rows, hemolymph from control silkworms (n=9); Right rows, hemolymph from N. bombycis infected silkworms (n=9). The melanization of hemolymph from N. bombycis-infected silkworms was significantly suppressed. (B) Quantification of
melanization scale: absorbance was 492 nm on a spectrometer （** = P＜0.01; N=9).
Fig. 2. Phenoloxidase (PO) activities of hemolymph from control and N. bombycis-infected silkworms. Hemolymph samples were collected from 1 to 6 dpi, then L-DOPA was added as substrate. The absorbance was 492 nm on a spectrometer, and 1 unit of PO activity was defined as 0.001 Δ492/min. The results showed that the PO activity of infected silkworm was significantly inhibited compared to the control silkworms （** = P＜0.01; N=20).
Fig. 3. NbSPN6 is identified in N. bombycis-infected silkworm hemolymph. （ A ） Western blot analysis of NbSPN6 expression in the hemolymph of infected silkworms. Hemolymph samples were collected from N. bombycis-infected silkworm from 1 to 6 dpi, and total protein was extracted. Western blot assays showed NbSPN6 expression in the hemolymph beginning day 3, and reached maximum levels on 3 and 4 dpi. (B) Immunofluorescent assay to check the NbSPN6 expression in hemocytes. Hemocytes were collected from hemolymph centrifugation sediments. Cell nuclei were stained with DAPI (blue), NbSPN6 was stained with a polyclonal anti-NbSPN6 primary antibody in combination with Alexa-594 conjugated secondary antibody (red). Results showed that NbSPN6 was secreted into the cytoplasm of hemocytes (arrow) by N. bombycis (arrowhead) (Scale bar= 5 m).
Fig. 4. Recombinant NbSPN6 inhibits phenoloxidase activation in vitro. Various concentrations of recombinant NbSPN6 were added to control silkworm hemolymph. Phenoloxidase (PO) activity was measured by analyzing absorbance at 492 nm. Phenylthiourea (PTU) treatment is a positive control of inhibition. (*=P＜0.05, **=P＜0.0; N=5 in each group＝
Fig. 5. Blocking NbSPN6 expression reverses PO activity inhibition and suppresses N. bombycis proliferation. Both the control and the experiment groups were infected with N. bombycis. The silkworms of control group were then injected with ddH2O (mock interference), and the silkworms of experiment group (+NbSPN6-dsRNA) were injected with NbSPN6-dsRNA. (A) Transcription levels of NbSPN6 after RNAi assay. NbSPN6 was significantly suppressed in the experiment group. (B) PO activity measurements. PO activity was determined at 492 nm and the PO activity of NbSPN6-dsRNA treated group was significantly restored compared to the control group. (C) Proliferation of N. bombycis determined by copy number of Nb-tubulin by qPCR. Proliferation was significantly suppressed in the NbSPN6-dsRNA treated group. (*= P<0.05, **=P<0.01; N=20 in each group).
Fig. 6. Prediction of P1 site of NbSPN6. Serpins from various species were aligned by domain sequences using MEGA 6.0 software (Nb=N.bombycis; Bm=Bombyx mori; Ag= Aedes aegypti；Dm= Drosophila melanogaster; Ms=Mus musculus). The alignment was adjusted according to the conserved residue in silkworm of serpin genes. P1 residue was predicted mainly based on the distance between P14 and P1 including gap(s). The predicted P1 sites were highlighted in yellow, Nbserpin6 has Phenylalanine at its P1 site.
Fig. 7. NbSPN6 directly interacts with host serine protease PPAE. (A) Immunofluorescent assay to detect the interaction between NbSPN6 and PPAE, by co-localization within N. bombycis-infected hemocytes.
Nuclei were stained by DAPI, NbSPN6 was stained with a mouse polyclonal antibody to
NbSPN6 in combination wtihAlexa-594 conjugated secondary antibody, and PPAE was stained by a
rabbit polyclonal antibody against PPAE in combination with Alexa-488 conjugated secondary antibody. In normal silkworm hemocytes, there is no NbSPN6 expression (scale bar=2 m); while in N. bombycisinfected hemocytes, NbSPN6 is largely co-localized with host PPAE. Arrows point to the co-localization of NbSPN6 with PPAE, and arrow heads point to N. bombycis (Scale bar=5 m). (B) Yeast two-hybrid assay to verify the interaction between NbSPN6 and PPAE. Interaction of pGADT7-PPAE with pGBKT7-NbSPN6 was screened by SD/-Ade/-His/-Leu/-Trp/X-α-gal/AbA medium. As shown, NbSPN6 is able to directly interact with host serine protease PPAE.
Highlights
1. The expression of Nosema bombycis serpin 6 (NbSPN6) was identified 2. NbSPN6 occurs specifically in the hemocytes 3. NbSPN6 directly interacts with and inhibits host serine protease. 4. Nosema bombycis inhibits host immune response through the expressed serpin
Graphical abstract
N. bombycis infects host hemocytes and replicates within. During proliferation, N. bombycis expresses serpin 6 (NbSPN6) in the cytoplasm of hemocyte and interact with host PPAE, a key serine protease in melanization pathway. The inhibited PPAE leads to down-regulation of PO activation in the hemolymph and subsequent hemolymph melanization.