- Email: [email protected]
Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1
Journal of Bioscience and Bioengineering VOL. xx No. xx, 1e7, 2018 www.elsevier.com/locate/jbiosc
Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1 Hui Qing,1, 2 Oscar Omondi Donde,1, 3 Cuicui Tian,1 Chunbo Wang,1 Xingqiang Wu,1 Shanshan Feng,1, 2 Yao Liu,1, 2 and Bangding Xiao1, * Key Laboratory of Algal Biology of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China,1 University of the Chinese Academy of Sciences, Beijing 100049, China,2 and Egerton University, Department of Environmental Science, Egerton 536-20115, Kenya3 Received 31 October 2017; accepted 13 March 2018 Available online xxx
AD-1, an aerobic denitrifier, was isolated from activated sludge and identified as Pseudomonas stutzeri. AD-1 e D completely removed NOe 3 or NO2 and removed 99.5% of NH4 during individual culturing in a broth medium with an initial nitrogen concentration of approximately 50 mg LL1. Results showed that larger amounts of nitrogen were removed through assimilation by the bacteria. And when NHD 4 was used as the sole nitrogen source in the culture e medium, neither NOe 2 nor NO3 was detected, thus indicating that AD-1 may not be a heterotrophic nitrifier. Only trace amount of N2O was detected during the denitrification process. Single factor experiments indicated that the optimal culture conditions for AD-1 were: a carbon-nitrogen ratio (C/N) of 15, a temperature of 25 C and sodium succinate or glucose as a carbon source. In conclusion, due to the ability of AD-1 to utilize nitrogen of different forms with high efficiencies for its growth while producing only trace emissions of N2O, the bacterium had outstanding potential to use in the bioremediation of high-nitrogen-containing wastewaters. Meanwhile, it may also be a proper candidate for biotreatment of high concentration organic wastewater. Ó 2018, The Society for Biotechnology, Japan. All rights reserved. [Key words: Aerobic denitrification; Bacteria assimilation; Pseudomonas; Nitrogen removal; Trace N2O emission]
Over decades, the excessive fixation of nitrogen especially NOe 3 and NHþ 4 , has been a serious problem for aquatic ecosystems, and this has led to a series of environmental consequences (1). To control and remediate nitrogen pollutants in water, the efficient and low-cost technology used to remove nitrogen is biological nitrification and denitrification, which involves two separate steps. e e Nitrification is the oxidation of NHþ 4 to NO3 via NO2 under aerobic conditions, while denitrification indicates that NOe 3 is converted into N2O or N2 via NOe 2 and NO successively as electron receptors under completely anoxic conditions (2,3). The two steps require different oxygen conditions. Even though aerobic nitrifiers are sensitive to organic compounds (4), anaerobic denitrifiers consume large amounts of organic materials (5). Therefore, these phenomena impose restrictions on the applications of biological nitrification and denitrification. To date, the methods adopted for nitrogen removal based on biological nitrification and denitrification usually involve the following processes: short-cut nitrification and denitrification, anaerobic ammonia oxidation, completely autotrophic nitrogen removal over nitrite process, and an oxygen-limited autotrophic nitrificationedenitrification process (6). Mechanisms of aerobic denitrification have been of great concern since their first detection in the 1980s (7). It was proven that a group of bacteria known as
* Corresponding author at: Institute of Hydrobiology, Chinese Academy of Sciences, No. 7 Donghu South Road, Wuhan 430072, China. Tel.: þ86 27 68780386; fax: þ86 27 68780123. E-mail address: [email protected] (B. Xiao).
aerobic denitrifiers could carry out denitrification when exposed to oxygen, which provided evidence for the possibility of simultaneously carrying out both nitrification and denitrification. Aerobic denitrifiers could utilize NOe 3 as an electron receptor for their growth in the presence of oxygen. This is based on the fact that the enzyme that catalyzes NOe 3 restoration is a periplasmic enzyme instead of being membrane-bound (5,8). Thus, it is not sensitive to oxygen (9) and is encoded by the periplasmic nitrate reductase gene (NAP). Therefore, aerobic denitrifiers were the primary subjects of research due to their better adaptability to the aquatic environment (10), as well as on the basis of their cost benefit. Although aerobic denitrifiers are currently well-known, studies on them often focus on their mechanism of NOe 3 metabolism. Therefore, there has been little research on the removal of NHþ 4, particularly by denitrifiers (11). However, NHþ 4 along with its oxidation to NOe 2 , which is widely distributed in industrial wastewaters, can be harmful for the hydrosphere (12). It is clearly harmful for the aquaculture industry, since NOe 2 can oxidize ferrous ion to iron ion, thus weakening the oxygen carrying ability of hemoglobin resulting in a high mortality rate of aquatic animals (13). Currently, some research has focused on heterotrophic nitrification-aerobic denitrification that targets its potential applie cations for both NHþ 4 and NO3 removal. While the link between the two processes may not be universal (14), Joo et al. (15) has demonstrated a new and efficient pathway for the removal of NHþ 4 by Alcaligenes faecalis No. 4. The N2 production is thought to via the hydroxylamine that was generated by NHþ 4 oxidation, thus clearly distinguishing it from other types of microorganisms. Nitrogen
1389-1723/$ e see front matter Ó 2018, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2018.03.010
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
2
QING ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Neighbor-Joining phylogenetic tree based on the 16S rRNA gene of AD-1 and other selected sequences, using Microbulbifer yueqingensis strain Y226 as an outgroup. The numbers on the branches indicate bootstrap values based on 1000 replications. 0.02 denotes the genetic distance.
assimilatory removal pathway has been proved to be of great sige nificance due to its high efficiency in removal of both NHþ 4 and NO3 . Indeed, a study done with Vibrio sp. Y1-5 (16) had showed high assimilatory ability of NHþ 4 without the loss of nitrogen during the removal process. Therefore, both applied and basic research studies e on the response of aerobic denitrifiers to NHþ 4 and NO2 are still required for efficient wastewater purification. In this study, an aerobic denitrifier termed Pseudomonas stutzeri e þ AD-1 was used to remove NOe 3 , NO2 and NH4 separately through an experimental laboratory procedure. Results showed that NOe 3 was completely removed within 24 h along with emission of minute quantity of N2O generated from aerobic denitrification pathway. þ NOe 2 and NH4 were consumed within one day without the detection of NOe 3 , and assimilatory was the main nitrogen removal pathway. The goal of this study is to provide useful data for further applied research on the bioremediation of high-nitrogencontaining wastewaters.
MATERIALS AND METHODS Enrichment and isolation of aerobic denitrifiers The activated sludge was obtained from the Tang-Xun-Hu sewage treatment works in Wuhan, Hubei Province, China. The samples were placed in bottles, sealed and immediately transported to the laboratory. The bottles were then left undisturbed for 1 h for the sludge and upper liquid to separately settle. The liquid was carefully decanted and discarded, and the sludge was then incubated in 500 mL conical flasks with 100 mL sterilized denitrification broth medium (DBM). DBM contained the following reagents per liter: 5.0 g of KNO3; 16.67 g of sodium succinate dibasic hexahydrate; 1.5 g of KH2PO4; 10.55 g of Na2HPO4$12H2O; 0.1 g of MgSO4; 0.3 g of NH4Cl and 2 mL of trace element solution. The final pH was adjusted to 7.0. The components of the trace element solution were as follows per liter: 1.8 g of FeCl2$4H2O; 0.25 g of CoCl2$6H2O; 0.01 g of NiCl2$6H2O; 0.01 g of CuCl2$2H2O; 0.70 g of MnCl2$4H2O; 0.5 g of ZnCl2; 0.5 g of H3BO3; 0.03 g of Na2MoO4$2H2O and 0.01 g of Na2SeO3$5H2O. Culture flasks were then sealed with a breathable sealing membrane and shaken in a rotary shaker at 30 C and 160 rpm. A five mL suspension was incubated into 100 mL fresh DBM after every 4 days for 4 consecutive times. The suspension was subjected to 10efold serial dilutions and then spread on BTB agar plates. BTB agar plates contained the following reagents per liter: 1.0 g of KNO3; 8.5 g of trisodium citrate dehydrate; 1.0 g of KH2PO4; 0.05 g of FeSO4$7H2O; 0.2 g of CaCl2; 1.0 g of MgSO4$7H20; 1 mL of 1% bromothymol blue; and 20 g of agar. The pH was maintained at 7.0e7.3. The BTB plates were then cultured in a 30 C temperature chemostat until blue-ringed colonies formed. Each single colony was separately tested using denitrification test medium (DTM), which was similar to DBM but used NOe 3 -N as the sole N source at 50 mg L1. After comparing the NOe 3 removal rates, the colony with the highest efficiency was marked AD-1 and cultured in DBM for further research.
Identification of AD-1 Amplification of the 16S rRNA gene was conducted by PCR using bacterial universal primers 8F (AGAGTTTGATCCTGGCTCAG)/1492R (GGTTACCTTGTTACGACTT), subjected to electrophoresis in 1% agarose gels, and then visualized using ethidium bromide staining. The PCR amplification occurred in a total volume of 50 mL and contained the following components: 25 mL of 2 Es Taq MasterMix (CW Biotechnology Company, Beijing. China), 1 mL of template, 1 mL of each primer and 22 mL of sterilized DD H2O. The PCR conditions were as follows: 94 C for 7 min; 40 cycles at 94 C for 30 s, 55 C for 30 s and 72 C for 1 min; then 72 C for 4 min. The PCR products were sequenced by the I-congene Biotechnical Company (Wuhan, China). After online analysis of the sequencing results using the Basic Local Alignment Search Tool (BLAST) on the NCBI, several related sequences were selected to construct phylogenetic tree. The construction of the phylogenetic tree was carried out using the Neighbor-Joining (NJ) method with the BIOEDIT and MEGA5.1 software. For NAP gene analysis, the primers were NAP1 (TCTGGACCATGGGCTTCAA CCA) and NAP2 (ACGACGACCGGCCAGCGCAG). The PCR procedures were as follows: 95 C for 7 min; 37 cycles at 95 C for 30 s, 59 C for 30 s and 72 C for 1 min; and 72 C for 4 min. Nitrogen removal characteristics of AD-1 Broth medium with several different forms of nitride was used to test AD-1, to characterize the response of this isolates. The source of nitrogen per liter for this study was as follows: 1. 50 mg L1 of 1 1 1 NOe of NOe of NHþ of NHþ 3 -N; 2. 50 mg L 2 -N; 3.50 mg L 4 -N; 4. 50 mg L 4 -N and 50 mg L1 of NOe 2 -N. Other components in one liter of the broth medium were as follows: 16.67 g of sodium succinate dibasic hexahydrate; 1.5 g of KH2PO4; 5.27 g of Na2HPO4$12H2O; 0.1 g of MgSO4; and 2 mL trace element solution. The isolates were pre-cultured at 30 C and 160 rpm in a rotary shaker to the exponential phase, and then 4 mL bacterial suspension was centrifuged at 8000 rpm for 7 min, followed by three washed with sterilized DD H2O, and then re-suspended to 4 mL. The suspension was inoculated into flasks of 500 mL with a working volume of 200 mL to obtain 2% inoculum. During the cultivation, the bacterial suspensions were sampled periodically to determinate the optical density (OD600), e þ then filtered through 0.22 mm membrane filters to determine the NOe 3 , NO2 , NH4 and dissolved total nitrogen (DTN). The same process was conducted to determine the suspended total nitrogen (TN) prior to filtration at the beginning and the end e þ (60 h) of culture. TN, DTN, NOe 3 , NO2 , NH4 , NH2OH and intracellular nitrogen was detected to test nitrogen balance by the consumption of NOe 3 at the beginning and the end. Detection of nitrous oxide One milliliter bacterial suspension as described was inoculated into a 1 L bottle with 100 mL DTM. The bottles were tightly sealed with a gas-impermeable rubber plug and then cultured in a rotary shaker. For comparison, the blank DTM without inoculation was used as the control. For the determination of N2O, headspace air (21% oxygen) in the bottle was not replaced to form an aerobic environment. Twenty milliliters of headspace gas was collected using a 50 mL gas-tight syringe through the rubber stopper every 12 h to detect N2O. The samples were collected in triplicate. Impact of temperature, C source and C/N To determine the influence of temperature, 2 mL of the bacterial suspension were collected at the exponential phase, centrifuged, washed by sterilized DD H2O, re-suspended to 2 mL and inoculated (2% inoculum) into 100 mL DTM with an initial NOe 3 -N concentration of 50 mg L1. The suspension was then cultured in rotary shaker at temperatures of 15 C, 20 C, 25 C, 30 C, 35 C and 40 C. Additional conditions were as follows: the carbon source was sodium succinate and the C/N was 60. For carbon sources,
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
3
þ e e þ FIG. 2. Concentration variation of nitrogen compounds with the growth of AD-1 when NOe 3 (A), NH4 (B), NO2 (C), NO2 and NH4 (D) served as nitrogen sources under aerobic conditions.
sodium succinate, glucose, sucrose, trisodium citrate and sodium acetate were selected to test the performance of AD-1 by fixing the C/N at 60 accompanied 1 with a constant NOe under a culture temperature 3 -N concentration of 50 mg L of 30 C, the carbon concentration of different forms in the broth medium was determined every 24 h. For the C/N test, the concentration of sodium succinate was increased to set the ratio at 5, 10, 15, 20, 30 and 60, respectively, at a temperature of 30 C. The cultures were harvested every 24 h to measure the NOe 3 and OD600. Analytical method Optical density (OD600) values were determined by a UVVIS spectrophotometer (UV759, Shanghai Jingke Industrial Company, Shanghai, China) at wavelength of 600 nm. The sodium succinate, trisodium citrate, sodium e acetate, NOe 3 and NO2 concentrations were measured by ion chromatography (ICS5000þ, Thermo Fisher Scientific, MA, USA). The concentration of glucose and sucrose was examined by phenol-sulphuric acid method according to Dubois et al. (17). The NHþ 4 was tested by Nessler’s reagent photometry. The DTN and TN were analyzed by hydrochloric acid photometry method. NH2OH was analyzed by indirect spectrophotometry according to Frear and Burrell (18). Organic nitrogen e e in the broth medium was calculated by subtracting NH2OH, NHþ 4 , NO3 , and NO2 from DTN. Intracellular nitrogen was calculated from the relationship between dry biomass (mg L1) and nitrogen content (%) obtained from the organic elemental analyzer (FLASH 2000, Thermo Fisher Scientific) of dry cells. These dry cells were prepared by freeze-drying the cell for 24 h after centrifugation. The gaseous product N2O was detected by gas chromatography (7890A, Agilent Technologies Inc., CA, USA) equipped with an electron capture detector. The results are presented as the mean SD from three independent experiments, and all of the graphs were drawn using OriginPro 8 (OriginLab Corporation, Northampton, MA, USA). Nucleotide sequence accession number Amplification and sequencing of the 16S rRNA gene fragment of 1431 bp was conducted by PCR products, and then submitted to GenBank under accession number of MF098763.
RESULTS AND DISCUSSION Identification of AD-1 Strain AD-1 was gram-negative, rodshaped, with a length of 1.5e2.9 mm and a width of 0.6e0.9 mm, oxidase-positive and catalase-positive. The colonies of strain AD-1 were faint yellow, irregular, and displayed a plicated surface on a BTB agar plate. Phylogenetic analysis based on the 16S rRNA showed that AD-1 has 99% similarity with P. stutzeri strain B7. A phylogenetic tree based on the 16S rRNA partial sequences using the NJ method (Fig. 1), proved that AD-1 groups with the genus P.
stutzeri. Thus, we identified the strain as P. stutzeri AD-1. Denitrification is a metabolic activity that can be detected in several kinds of bacteria. Studies on aerobic denitrifiers primary include Pseudomonas, Alcaligenes, Paracoccus, Bacillus and Marinobacter (2,19). Several strains in genus Pseudomonas, such as P. stutzeri PCN-1 (20), have been reported to be able to carry out denitrification under aerobic conditions. NAP is a special functional gene that is responsible for encoding the periplasmic nitrate reductase, which mediates the reduction of NOe 3 under aerobic conditions. In this study, we sequenced 786 bp fragments of NAP (results not shown), proving that AD-1 has a e promising ability to reduce NOe 3 to NO2 . Therefore, the aerobic denitrification performance of isolate AD-1 was subsequently investigated. Nitrogen removal performance of AD-1 Nitrate was used as sole nitrogen source in order to classify the metabolism characteristic of AD-1. As shown in Fig. 2A, AD-1 possesses aerobic denitrification ability, which utilized NOe 3 as the nitrogen source for growth. In one day, the concentration of NOe 3 decreased from 47.46 mg L1 to below the detectable limit by ion chromatography without a lag period. The calculated average rate 1 1 of removal of NOe h , which was more effective 3 was 1.98 mg L than some other aerobic denitrifiers that have been previously reported. For instance, a rate of 1.11 mg L1 h1 has been demonstrated for Pseudomonas sp. Y2-1-1 (21). Additionally, the accumulation of NOe 2 was detected during the early 24 h with a maximum of 18.42 mg L1 at hour 16 and then rapidly decreased to near zero, which would be an advantage for wastewater management. After 24 h, the DTN declined to 2.5 mg L1 with the rapid growth of AD-1, which showed more than 95% removal rates, corresponding to the increase in the OD600 from 0.01 to 0.50. The calculated maximal growth rate (mm) of AD-1 according to Yao et al. (22) was 0.11 h1, which was much higher than that of the autotrophs. For example, the mm for Nitrosomonas europaea (23) was approximately 0.03e0.05 h1. It was worth noticing that e there was a decline in the NOe 3 , NO2 and DTN, and all were used up during the early 24 h. At the same time, the OD600 was only
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
4
QING ET AL.
J. BIOSCI. BIOENG., TABLE 1. Nitrogen removal by consumption of nitrate in 60 h (unit: mg L1). Initial N
49.66 0.61
Lost Na
Final amount of N NOe 3 -N
NHþ 4 -N
NOe 2 -N
NH2OH-N
Organic N
Intracellular N
e
0.47 0.17
e
e
3.27 1.86
38.26 2.23
8.81 1.51
e. Undetectable. Values represent mean S.D. of triplicates. a Calculated value. Lost N ¼ initial TN final TN.
0.50, indicating that AD-1 had reached its early exponential phase. Studies on aerobic denitrifying bacteria show that the denitrification progress usually occurs during the proliferation of the cells (24). This is because the cells require high levels of energy to support their metabolism during the exponential period, thus leading to abundant electron release from organic oxidation and the next active redox reaction. Although aerobic denitrification has been a great concern since its discovery in the 1980s (7), only a few studies on the mechanism þ of the degradation of NOe 2 and NH4 by denitrifiers have been reported (25,26). In this section, the progresses of the utilization of þ NOe 2 and NH4 by strain AD-1will be discussed. Broth culture meþ dium with NOe 2 or NH4 was used to culture AD-1, to determine the bacterial growth and nitrogen removal rate with different forms of nitrogen sources. The results (Fig. 2B) showed that NHþ 4 was assimilated for bacteria growth. Within 16 h, the NHþ 4 declined from 49.87 to 0.27 mg L1, with a removal efficiency of 99.5%. The average NHþ removal rate of AD-1 was approximately 4 3.1 mg L1 h1, much higher than Bacillus sp. LY which had an NHþ 4 e removal rate of 0.43 mg L1 h1 (27). Additionally, NOe 2 and NO3 were not detected, indicating that AD-1 may not be a heterotrophic nitrifier. The phenomenon that coupled heterotrophic nitrification with aerobic denitrification has been well studied over the years (24,28). AD-1 only performed aerobic nitrification, this is highly unusual but similar to Marinobacter strain NNA5 (29). Studies showed that some denitrifiers may assimilate NHþ 4 for growth, while part of the NHþ 4 was converted into gaseous nitrogen products (30). Recent study (14) has revealed an additional NHþ 4 removal pathway to be via hydroxylamine (NHþ / NH2OH / 4 e N2O / N2) instead of NOe 2 or NO3 , which could be responsible for this phenomenon. When NOe 2 (Fig. 2C) was the sole nitrogen source, the phee nomenon was similar to that of NHþ 4 , but the NO2 decreased at a slower rate. Within 24 h, the NOe with an initial concentration of 2 47.99 mg L1 was nearly depleted with no accumulation of NOe 3 or NHþ 4 . This implies that no nitrification process was detected at a C/N ratio close to 60. During the growth of the bacteria, part of the nitrogen was transformed into biomass through assimilation, especially at the high C/N ratio. Zhao et al. (31) reported that 49.7% of the nitrogen was assimilated by Providencia rettgeri strain YL at a C/N ratio of 11. It is intriguing to note that the high NOe 2 concentration of 47.99 mg L1 did not inhibit the growth of strain AD-1 compared to Pseudomonas sp. yy7 (25), which showed a poor growth rate at the same concentration of NOe 2 . In addition, a higher biomass of AD-1 was observed compared to the use of NOe 3 as a sole nitrogen source, which agreed with previous studies by Yao. This may due to the lower nitrogen oxidation state in nitrite, thus increasing the ease of assimilation by bacteria (22). e e Fig. 2D depicts the variation of NHþ 4 , NO2 , NO3 and DTN when þ NOe and NH served as nitrogen sources simultaneously to 2 4 investigate the effect of NOe 2 on the nitrogen conversion of AD-1. þ AD-1 utilized NHþ 4 first for growth, and as the NH4 was being consumed, NOe 2 was assimilated by AD-1. The utilization order of e NHþ 4 and NO2 was similar to that of Klebsiella pneumoniae CF-S9 (32). During the whole process, NOe 3 was not detected using iron chromatography, indicating that there was no nitrification. There were reports (33e35) that the presence of NOe 2 limits the
expression of the enzyme that is involved in nitrogen conversion. However, this phenomenon was not monitored in this study. With þ the addition of nearly 50 mg L1 NOe 2 , AD-1 could utilize NH4 and began to proliferate immediately without any retention time. Whether NOe 2 affects the metabolism of the bacteria merits further studied. Thus, AD-1 could perform more favorably when cultured in þ e NOe 3 , NH4 and NO2 media, which provides an opportunity to manage high-nitrogen-containing wastewaters and reduce external carbon compared to conventional study. The nitrogen balance during the consumption of NOe 3 was calculated and shown in Table 1, the increase in NHþ 4 , organic nitrogen and intracellular nitrogen was observed while NOe 3 was consumed to near zero. At the end, 77.04% of initial NOe 3 -N was assimilated by AD-1 then converted to intracellular nitrogen, much higher than others. For example, Kim (36) found that proportion was 24.8% in Bacillus strains at a C/N of 8. Lost nitrogen in the broth medium was speculated due to the gaseous production in the form of N2 and N2O. Moreover, Fig. 3 shows that there was a distinct decrease in the TN concentration regardless of the type of nitrogen e that served as the substrate. The TN removal rate for NOe 3 , NO2 and NHþ was 18.7%, 17.3% and 23.6% respectively. The difference be4 tween DTN mentioned in Fig. 2 and TN indicated that AD-1 could e þ assimilate NOe 3 , NO2 and NH4 then transfer them to biomass for growth, thus leading to a high accumulation of intracellular nitrogen. In the past, research on nitrification and denitrification usually only examined the change of the total nitrogen concentration in broth medium (as DTN described in Fig. 2). In addition, a large number of studies focused on the conversion among different forms of inorganic nitrogen, such as heterotrophic nitrificationaerobic denitrification, reduction of nitrate to ammonia and anaerobic ammonia oxidation (37), but little research has been reported in this part. In consideration of time and financial consumption, the advantage of microbial assimilation pathway under aerobic heterotrophic condition is equivalent to heterotrophic nitrification-aerobic denitrification. Moreover, it’s reasonable to
FIG. 3. Comparison of TN concentration between the initiation and the end of the culture.
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
FIG. 4. Detection of N2O from the inoculated samples and blank control.
utilize fixed nitrogen for further cultivation, thus providing a novel but efficient approach for reclamation of nutrients especially nitrogen and carbon in wastewater (16). Based on the decrease in the TN concenDetection of N2O tration and the phenomenon that several bubbles were observed at the end of culture, an inference can be drawn on the possible occurrence of NOe 3 -N conversion to gaseous nitrogen product, N2 and N2O. N2O is one of the greenhouse gases that are harmful to the
5
ozone layer. The results (Fig. 4) showed that N2O was produced by AD-1 when NOe 3 served as the nitrogen source. AD-1 emitted N2O at the beginning of the culture without any retention time, average N2O-N emission rate in the broth medium was 5.79 105 mg L1 h1, and the N2O-N concentration in the headspace reached 9.1 104 mg L1 at 60 h and remained stable onwards. This concentration was much lower than that produced by other denitrifiers. Most aerobic denitrification produces primarily N2O rather than N2. For example, P. stutzeri PCN-1 (20) could generate 0.33 mg L1 N2O at 8.5 h, accounting for 0.33% of the denitrified NOe 3 -N. Additionally, Marinobacter sp. (38) isolated from marine sediment was confirmed to produce N2O as a gaseous product. Thus, the distinct decrease in the TN indicated that most of the nitrogen removed from the broth medium could be N2. When AD-1 is compared to other strains, it shows environmental-benefits based on its low levels of N2O emission. From intermediates monitored when a different form of nitrogen served as substrate and gaseous product as mentioned above, it could be concluded that AD-1’s nitrogen removal mechanisms could occur different ways. Larger amounts of nitrogen were removed through assimilation by the bacteria. Part of the nitrogen was converted into gaseous products through aerobic denitrificae þ tion with NOe 3 and NO2 , however, with NH4 , the nitrogen was likely to be removed via the hydroxylamine pathway instead of through conventional heterotrophic nitrification. Single factor experiments There are many factors that may influence the ecological functions of most microorganisms. This
FIG. 5. Carbon degradation (A), Denitrification performance (B) and Bacterial growth condition (C) when grown with different C sources.
FIG. 6. Denitrification performance (A) and Bacterial growth condition (B) during different C/N ratios.
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
6
QING ET AL.
J. BIOSCI. BIOENG.,
FIG. 7. Denitrification performance (A) and Bacterial growth condition (B) at different temperatures.
section examines the influence of temperature, carbon source and C/N. The growth characteristics, the NOe 3 and carbon concentrations during different culture conditions in the broth medium were investigated every 24 h. With aerobic denitrification bacteria, the carbon sources support not only the energy but also serve as the electron source. This is an important factor that may influence nitrogen removal performance and denitrification mechanisms (39). Research conducted by Her (40) showed that organic compounds with a simple structure (such as glucose) would be better carbon sources for denitrification bacteria. But in a 72-h culture experiment, the results (Fig. 5) showed that sodium succinate, glucose, sucrose, and trisodium citrate could support the growth of AD-1, the OD600 reached 1.95, 2.08, 2.47 and 1.60 respectively with the depletion of carbon source. Meanwhile, 100%, 63.91%, 39.38% and 100% carbon was consumed respectively at the end of the culture. The best carbon source for strain AD-1 was sodium succinate and glucose, due to their highest efficiency of removing NOe 3 and cell proliferation rate. Thus, sodium succinate was used for optimal C/N ratio and temperature tests. The results consistent with those of Bacillus methylotrophicus strain L7 (39) which showed highest nitrogen removal percentage with succinate. However, poor growth and accordingly worse nitrogen removal performance were observed with AD-1 when sodium acetate was the sole carbon source. This finding consistent with P. stutzeri YG-24, which may related to the sodium acetate was the most oxidized compound among the five carbon sources (41). But acetate could support the growth of P. stutzeri strain T1 (26) and A. faecalis no. 4 (15) due to its simple molecular structure. Therefore, the suitable carbon source for aerobic denitrifiers might vary among specific strains or species (41). Moreover, the change of carbon sources may result to different mechanism of nitrogen conversion. Zhang (39) observed that there was an obvious accumulation of NOe 2 on sodium succinate, but not on glucose. And Joo (15) reported that the denitrification ratio in citrate was larger than that in the acetate. The C/N ratio is a key factor that may influence the application potential of the strain. A lower C/N ratio leads to poor nitrogen removal performance due to the exhaustion of carbon (41). Alternatively, an excessive amount of carbon leads to a higher cost. Thus, it is important to quantify the optimal C/N ratio. In this section 1 (Fig. 6), the initial NOe 3 -N concentration was nearly 50 mg L , and the concentration of carbon was increased serially to result in a ratio of 5e60. It was found that with the increase of carbon. The biomass of AD-1 gradually increased in parallel with the increase in carbon. While the NOe 3 -N removal rate did not differ significantly when the C/N ratio varied between 15 and 60 in 3 days, the residual NOe 3 at a C/N ratio of 5 and 10 may be due to the exhaustion of
carbon. However, the optimal C/N ratio for strain AD-1 should be 15 in consideration of the lower amount of depletion by the organism. An optimum C/N ratio of AD-1 was higher than that of other strains, such as A. faecalis strain No. 4 (C/N ratio: 7e8) isolated from sewage sludge (42). The high tolerance of strain AD-1 to a wide C/N range expands the scope of its application to use as wastewater with a high C/N ratio, such as sanitary sewage as well as livestock farm wastewaters (42). The effects of temperature on bacterial growth and denitrification performance were also examined in a rotary shaker that was set at 15, 20, 25, 30, 35 and 40 C respectively. During 72-h of culture (Fig. 7), the AD-1 cells cultured at 15 C grew the slowest and had the lowest rate of NOe 3 removal. As the temperature increased from 15 to 40 C, the rate of removal of NOe 3 accelerated, while the cell density was maximal after 3 days at 25 C and then declined at temperatures higher than 30 C, which indicates that there is no positive correlation between cell growth and the removal of NOe 3. The results showed that the optimal culture temperature of AD-1 is 25 C, which is lower than that of the other reported aerobic denitrifiers, including B. methylotrophicus strain L7 (37 C) isolated from wastewater (39) and Bacillus licheniformis A13 (32.5 C) isolated from soil and liquid samples (43). In addition, AD-1 efficiently removed NOe 3 at a wide temperature range of 20e40 C in contrast to other strains, such as P. stutzeri YG-24 (41) that could only remove NOe 3 at a rate of 2.24% at 40 C, this property could make it an attractive candidate to use in the bioremediation of wastewater. In conclusion, strain AD-1 was isolated from activated sludge and identified as genus P. stutzeri based on physiological and biochemical characteristics tests and 16S rRNA phylogenetic tree e þ analysis. In 24 h, AD-1 could efficiently remove NOe 3 , NO2 and NH4 individually at an initial nitrogen concentration of 50 mg L1. In contrast to other heterotrophic nitrification-aerobic denitrification bacteria, AD-1 not only performs aerobic denitrification but also e þ assimilates large amounts of NOe 3 , NO2 and NH4 for growth, showing a new pathway for the removal of nitrogen. The strain also adapted well to a higher C/N ratio and lower temperatures, thus making it a potential candidate for wastewater management in bioremediation technology.
ACKNOWLEDGEMENTS The authors thank Yingying Tian of Henan institute of technology for her help in bacteria cultivation. This works was funded by Major Science and Technology Program for Water Pollution Control and Treatment of China (grant No. 2013ZX07102005), and the National Natural Science Foundation of China (grant No. 31670465).
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018 References 1. Qin, B. Q., Zhu, G. W., Gao, G., Zhang, Y. L., Li, W., Paerl, H. W., and Carmichael, W. W.: A drinking water crisis in Lake Taihu, China: linkage to climatic variability and lake management, Environ. Manage., 45, 105e112 (2010). 2. Zheng, H. Y., Liu, Y., Gao, X. Y., Ai, G. M., Miao, L. L., and Liu, Z. P.: Characterization of a marine origin aerobic nitrifying-denitrifying bacterium, J. Biosci. Bioeng., 114, 33e37 (2012). 3. Khardenavis, A. A., Kapley, A., and Purohit, H. J.: Simultaneous nitrification and denitrification by diverse Diaphorobacter sp, Appl. Microbiol. Biotechnol., 77, 403e409 (2007). 4. Kulikowska, D., Jó zwiak, T., Kowal, p., and Ciesielski, S.: Municipal landfill leachate nitrification in RBC biofilm-Process efficiency and molecular analysis of microbial structure, Bioresour. Technol., 101, 3400e3405 (2010). 5. Zumft, W. G.: Cell biology and molecular basis of denitrification, Microbiol. Mol. Biol. Rev., 61, 533e616 (1997). 6. Peng, Y. Z. and Zhu, G. B.: Biological nitrogen removal with nitrification and denitrification via nitrite pathway, Appl. Microbiol. Biotechnol., 73, 15e26 (2006). 7. Robertson, L. A. and Kuenen, J. G.: Aerobic denitrification: a controversy revived, Arch. Microbiol., 139, 351e354 (1984). 8. Yin, S. X. and Chen, L. M.: Advances in the research of soil nitrifying and denitrifying microorganisms, Tu Rang Xue Bao, 39, 116e128 (2002) (in Chinese). 9. Bell, L. C., Richardson, D. J., and Ferguson, S. J.: Periplasmic and membranebound respiratory nitrate reductases in Thiosphaera pantotropha, FEBS Lett., 265, 85e87 (1990). 10. Zhu, L., Ding, W., Feng, L. J., Kong, Y., Xu, J., and Xu, X. Y.: Isolation of aerobic denitrifiers and characterization for their potential application in the bioremediation of oligotrophic ecosystem, Bioresour. Technol., 108, 1e7 (2012). 11. Zhang, J. B., Wu, P. X., Hao, B., and Yu, Z. N.: Heterotrophic nitrification and aerobic denitrification by the bacterium Pseudomonas stutzeri YZN-001, Bioresour. Technol., 102, 9866e9869 (2011). 12. Shi, Z., Zhang, Y., Zhou, J. T., Chen, M. X., and Wang, X. J.: Biological removal of nitrate and ammonium under aerobic atmosphere by Paracoccus versutus LYM, Bioresour. Technol., 148, 144e148 (2013). 13. Shao, Q. and Yu, X. B.: Isolation and Characterization of A Strain denitrobacteria, Sheng Wu Ji Shu, 18, 63e65 (2008) (in Chinese). 14. Zhao, B., He, Y. L., Hughes, J., and Zhang, X. F.: Heterotrophic nitrogen removal by a newly isolated Acinetobacter calcoaceticus HNR, Bioresour. Technol., 101, 5194e5200 (2010). 15. Joo, H. S., Hirai, M., and Shoda, M.: Characteristics of ammonium removal by heterotrophic nitrification-aerobic denitrification by Alcaligenes faecalis No. 4, J. Biosci. Bioeng., 100, 184e191 (2005). 16. Li, Y. T., Wang, Y. R., Fu, L., Gao, Y. Z., Zhao, H. X., and Zhou, W. Z.: Aerobicheterotrophic nitrogen removal through nitrate reduction and ammonium assimilation by marine bacterium Vibrio sp. Y1-5, Bioresour. Technol., 230, 103e111 (2017). 17. Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A., and Smith, F.: Colorimetric method for determination of sugars and related substances, Anal. Chem., 28, 350e356 (1956). 18. Frear, D. S. and Burrell, R. C.: Spectrophotometric methods for determining hydroxylamine reductase activity in higher plants, Anal. Chem., 27, 1664e1665 (1955). 19. Wang, W., Cai, Z. C., Zhong, W. H., and Wang, G. X.: Research advances in aerobic denitrifiers, Ying Yong Sheng Tai Xue Bao, 18, 2618e2625 (2007) (in Chinese). 20. Zheng, M. S., He, D., Ma, T., Chen, Q., Liu, S. T., Ahmad, M., Gui, M. Y., and Ni, J. R.: Reducing NO and N2O emission during aerobic denitrification by newly isolated Pseudomonas stutzeri PCN-1, Bioresour. Technol., 162, 80e88 (2014). 21. Kong, Q. X., Wang, X. W., Jin, M., Shen, Z. Q., and Li, J. W.: Development and application of a novel and effective screening method for aerobic denitrifying bacteria, FEMS Microbiol. Lett., 260, 150e155 (2006). 22. Yao, S., Ni, J. R., Ma, T., and Li, C.: Heterotrophic nitrification and aerobic denitrification at low temperature by a newly isolated bacterium, Acinetobacter sp. HA2, Bioresour. Technol., 139, 80e86 (2013).
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
7
23. Gupta, A. B. and Gupta, S. K.: Simultaneous carbon and nitrogen removal from high strength domestic wastewater in an aerobic RBC biofilm, Water Res., 35, 1714e1722 (2001). 24. Chen, P., Li, J., Li, Q. X., Wang, Y., Li, S., Ren, T., and Wang, L.: Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24, Bioresour. Technol., 116, 266e270 (2012). 25. Wan, C. L., Yang, X., Lee, D. J., Du, M. A., Wan, F., and Chen, C.: Aerobic denitrification by novel isolated strain using NO2e-N as nitrogen source, Bioresour. Technol., 102, 7244e7248 (2011). 26. Guo, L. Y., Chen, Q. K., Fang, F., Hu, Z. X., Wu, J., Miao, A. J., Xiao, L., Chen, X. F., and Yang, L. Y.: Application potential of a newly isolated indigenous aerobic denitrifier for nitrate and ammonium removal of eutrophic lake water, Bioresour. Technol., 142, 45e51 (2013). 27. Zhao, B., He, Y. L., and Zhang, X. F.: Nitrogen removal capability through simultaneous heterotrophic nitrification and aerobic denitrification by Bacillus sp. LY, Environ. Technol., 31, 409e416 (2010). 28. Chen, Q. and Ni, J. R.: Heterotrophic nitrification-aerobic denitrification by novel isolated bacteria, J. Ind. Microbiol. Biotechnol., 38, 1305e1310 (2011). 29. Liu, Y., Ai, G. M., Miao, L. L., and Liu, Z. P.: Marinobacter strain NNA5, a newly isolated and highly efficient aerobic denitrifier with zero N2O emission, Bioresour. Technol., 206, 9e15 (2016). 30. van Niel, E. W. J.: Nitrification by heterotrophic denitrifiers and its relationship to autotrophic nitrification, Ph.D. thesis, Delft University, https://repository. tudelft.nl/islandora/object/uuid:274fb0bb-e4cb-4af1-bc93-1630bf36d850/ datastream/OBJ (1991) (in Chinese). 31. Zhao, B., He, Y. L., Huang, J., Taylor, S., and Hughes, J.: Heterotrophic nitrogen removal by Providencia rettgeri strain YL, J. Ind. Microbiol. Biotechnol., 37, 609e616 (2010). 32. Padhi, S. K., Tripathy, S., Sen, R., Mahapatra, A. S., Mohanty, S., and Maiti, N. K.: Characterisation of heterotrophic nitrifying and aerobic denitrifying Klebsiella pneumoniae CF-S9 strain for bioremediation of wastewater, Int. Biodeterior. Biodegradation, 78, 67e73 (2013). 33. van Niel, E. W. J., Braber, K. J., Robertson, L. A., and Kuenen, J. G.: Heterotrophic nitrification and aerobic denitrification in Alcaligenes faecafis strain TUD, Antonie van Leeuwenhoek, 62, 231e237 (1992). 34. Oh, J. and Silverstein, J.: Acetate limitation and nitrite accumulation during denitrification, J. Environ. Eng., 125, 234e242 (1999). 35. Du, R., Peng, Y. Z., Cao, S. B., Li, B. K., Wang, S. Y., and Niu, M.: Mechanisms and microbial structure of partial denitrification with high nitrite accumulation, Appl. Microbiol. Biotechnol., 100, 2011e2021 (2016). 36. Kim, J. K., Park, K. J., Cho, K. S., Nam, S. W., Park, T. J., and Bajpai, R.: Aerobic nitrification-denitrification by heterotrophic Bacillus strains, Bioresour. Technol., 96, 1897e1906 (2005). 37. Burgin, A. J. and Hamilton, S. K.: Have we overemphasized the role of denitrification in aquatic ecosystems A review of nitrate removal pathways, Front. Ecol. Environ., 5, 89e96 (2007). 38. Nakano, M., Inagaki, T., Okunishi, S., Tanaka, R., and Maeda, H.: Effect of salinity on denitrification under limited single carbon source by Marinobacter sp. isolated from marine sediment, J. Basic Microbiol., 50, 285e289 (2010). 39. Zhang, Q. L., Liu, Y., Ai, G. M., Miao, L. L., Zheng, H. Y., and Liu, Z. P.: The characteristics of a novel heterotrophic nitrification-aerobic denitrification bacterium, Bacillus methylotrophicus strain L7, Bioresour. Technol., 108, 35e44 (2012). 40. Her, J. J. and Huang, J. S.: Influences of carbon source and C/N ratio on nitrate/ nitrite denitrification and carbon breakthrough, Bioresour. Technol., 54, 45e51 (1995). 41. Li, C. N., Yang, J. S., Wang, X., Wang, E. T., Li, B. Z., He, R. X., and Yuan, H. I.: Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a phosphate accumulating bacterium Pseudomonas stutzeri YG-24, Bioresour. Technol., 182, 18e25 (2015). 42. Joo, H. S., Hirai, M., and Shoda, M.: Piggery wastewater treatment using Alcaligenes faecalis strain No. 4 with heterotrophic nitrification and aerobic denitrification, Water Res., 40, 3029e3036 (2006). 43. Zeng, Q. W., Liang, Y. X., and Ge, X. Y.: Screening of denitrobacteria and preliminary study about its denitrification properties, Hua Zhong Nong Ye Da Xue Xue Bao, 27, 616e620 (2008) (in Chinese).
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1 Hui Qing,1, 2 Oscar Omondi Donde,1, 3 Cuicui Tian,1 Chunbo Wang,1 Xingqiang Wu,1 Shanshan Feng,1, 2 Yao Liu,1, 2 and Bangding Xiao1, * Key Laboratory of Algal Biology of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China,1 University of the Chinese Academy of Sciences, Beijing 100049, China,2 and Egerton University, Department of Environmental Science, Egerton 536-20115, Kenya3 Received 31 October 2017; accepted 13 March 2018 Available online xxx
AD-1, an aerobic denitrifier, was isolated from activated sludge and identified as Pseudomonas stutzeri. AD-1 e D completely removed NOe 3 or NO2 and removed 99.5% of NH4 during individual culturing in a broth medium with an initial nitrogen concentration of approximately 50 mg LL1. Results showed that larger amounts of nitrogen were removed through assimilation by the bacteria. And when NHD 4 was used as the sole nitrogen source in the culture e medium, neither NOe 2 nor NO3 was detected, thus indicating that AD-1 may not be a heterotrophic nitrifier. Only trace amount of N2O was detected during the denitrification process. Single factor experiments indicated that the optimal culture conditions for AD-1 were: a carbon-nitrogen ratio (C/N) of 15, a temperature of 25 C and sodium succinate or glucose as a carbon source. In conclusion, due to the ability of AD-1 to utilize nitrogen of different forms with high efficiencies for its growth while producing only trace emissions of N2O, the bacterium had outstanding potential to use in the bioremediation of high-nitrogen-containing wastewaters. Meanwhile, it may also be a proper candidate for biotreatment of high concentration organic wastewater. Ó 2018, The Society for Biotechnology, Japan. All rights reserved. [Key words: Aerobic denitrification; Bacteria assimilation; Pseudomonas; Nitrogen removal; Trace N2O emission]
Over decades, the excessive fixation of nitrogen especially NOe 3 and NHþ 4 , has been a serious problem for aquatic ecosystems, and this has led to a series of environmental consequences (1). To control and remediate nitrogen pollutants in water, the efficient and low-cost technology used to remove nitrogen is biological nitrification and denitrification, which involves two separate steps. e e Nitrification is the oxidation of NHþ 4 to NO3 via NO2 under aerobic conditions, while denitrification indicates that NOe 3 is converted into N2O or N2 via NOe 2 and NO successively as electron receptors under completely anoxic conditions (2,3). The two steps require different oxygen conditions. Even though aerobic nitrifiers are sensitive to organic compounds (4), anaerobic denitrifiers consume large amounts of organic materials (5). Therefore, these phenomena impose restrictions on the applications of biological nitrification and denitrification. To date, the methods adopted for nitrogen removal based on biological nitrification and denitrification usually involve the following processes: short-cut nitrification and denitrification, anaerobic ammonia oxidation, completely autotrophic nitrogen removal over nitrite process, and an oxygen-limited autotrophic nitrificationedenitrification process (6). Mechanisms of aerobic denitrification have been of great concern since their first detection in the 1980s (7). It was proven that a group of bacteria known as
* Corresponding author at: Institute of Hydrobiology, Chinese Academy of Sciences, No. 7 Donghu South Road, Wuhan 430072, China. Tel.: þ86 27 68780386; fax: þ86 27 68780123. E-mail address: [email protected] (B. Xiao).
aerobic denitrifiers could carry out denitrification when exposed to oxygen, which provided evidence for the possibility of simultaneously carrying out both nitrification and denitrification. Aerobic denitrifiers could utilize NOe 3 as an electron receptor for their growth in the presence of oxygen. This is based on the fact that the enzyme that catalyzes NOe 3 restoration is a periplasmic enzyme instead of being membrane-bound (5,8). Thus, it is not sensitive to oxygen (9) and is encoded by the periplasmic nitrate reductase gene (NAP). Therefore, aerobic denitrifiers were the primary subjects of research due to their better adaptability to the aquatic environment (10), as well as on the basis of their cost benefit. Although aerobic denitrifiers are currently well-known, studies on them often focus on their mechanism of NOe 3 metabolism. Therefore, there has been little research on the removal of NHþ 4, particularly by denitrifiers (11). However, NHþ 4 along with its oxidation to NOe 2 , which is widely distributed in industrial wastewaters, can be harmful for the hydrosphere (12). It is clearly harmful for the aquaculture industry, since NOe 2 can oxidize ferrous ion to iron ion, thus weakening the oxygen carrying ability of hemoglobin resulting in a high mortality rate of aquatic animals (13). Currently, some research has focused on heterotrophic nitrification-aerobic denitrification that targets its potential applie cations for both NHþ 4 and NO3 removal. While the link between the two processes may not be universal (14), Joo et al. (15) has demonstrated a new and efficient pathway for the removal of NHþ 4 by Alcaligenes faecalis No. 4. The N2 production is thought to via the hydroxylamine that was generated by NHþ 4 oxidation, thus clearly distinguishing it from other types of microorganisms. Nitrogen
1389-1723/$ e see front matter Ó 2018, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2018.03.010
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
2
QING ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Neighbor-Joining phylogenetic tree based on the 16S rRNA gene of AD-1 and other selected sequences, using Microbulbifer yueqingensis strain Y226 as an outgroup. The numbers on the branches indicate bootstrap values based on 1000 replications. 0.02 denotes the genetic distance.
assimilatory removal pathway has been proved to be of great sige nificance due to its high efficiency in removal of both NHþ 4 and NO3 . Indeed, a study done with Vibrio sp. Y1-5 (16) had showed high assimilatory ability of NHþ 4 without the loss of nitrogen during the removal process. Therefore, both applied and basic research studies e on the response of aerobic denitrifiers to NHþ 4 and NO2 are still required for efficient wastewater purification. In this study, an aerobic denitrifier termed Pseudomonas stutzeri e þ AD-1 was used to remove NOe 3 , NO2 and NH4 separately through an experimental laboratory procedure. Results showed that NOe 3 was completely removed within 24 h along with emission of minute quantity of N2O generated from aerobic denitrification pathway. þ NOe 2 and NH4 were consumed within one day without the detection of NOe 3 , and assimilatory was the main nitrogen removal pathway. The goal of this study is to provide useful data for further applied research on the bioremediation of high-nitrogencontaining wastewaters.
MATERIALS AND METHODS Enrichment and isolation of aerobic denitrifiers The activated sludge was obtained from the Tang-Xun-Hu sewage treatment works in Wuhan, Hubei Province, China. The samples were placed in bottles, sealed and immediately transported to the laboratory. The bottles were then left undisturbed for 1 h for the sludge and upper liquid to separately settle. The liquid was carefully decanted and discarded, and the sludge was then incubated in 500 mL conical flasks with 100 mL sterilized denitrification broth medium (DBM). DBM contained the following reagents per liter: 5.0 g of KNO3; 16.67 g of sodium succinate dibasic hexahydrate; 1.5 g of KH2PO4; 10.55 g of Na2HPO4$12H2O; 0.1 g of MgSO4; 0.3 g of NH4Cl and 2 mL of trace element solution. The final pH was adjusted to 7.0. The components of the trace element solution were as follows per liter: 1.8 g of FeCl2$4H2O; 0.25 g of CoCl2$6H2O; 0.01 g of NiCl2$6H2O; 0.01 g of CuCl2$2H2O; 0.70 g of MnCl2$4H2O; 0.5 g of ZnCl2; 0.5 g of H3BO3; 0.03 g of Na2MoO4$2H2O and 0.01 g of Na2SeO3$5H2O. Culture flasks were then sealed with a breathable sealing membrane and shaken in a rotary shaker at 30 C and 160 rpm. A five mL suspension was incubated into 100 mL fresh DBM after every 4 days for 4 consecutive times. The suspension was subjected to 10efold serial dilutions and then spread on BTB agar plates. BTB agar plates contained the following reagents per liter: 1.0 g of KNO3; 8.5 g of trisodium citrate dehydrate; 1.0 g of KH2PO4; 0.05 g of FeSO4$7H2O; 0.2 g of CaCl2; 1.0 g of MgSO4$7H20; 1 mL of 1% bromothymol blue; and 20 g of agar. The pH was maintained at 7.0e7.3. The BTB plates were then cultured in a 30 C temperature chemostat until blue-ringed colonies formed. Each single colony was separately tested using denitrification test medium (DTM), which was similar to DBM but used NOe 3 -N as the sole N source at 50 mg L1. After comparing the NOe 3 removal rates, the colony with the highest efficiency was marked AD-1 and cultured in DBM for further research.
Identification of AD-1 Amplification of the 16S rRNA gene was conducted by PCR using bacterial universal primers 8F (AGAGTTTGATCCTGGCTCAG)/1492R (GGTTACCTTGTTACGACTT), subjected to electrophoresis in 1% agarose gels, and then visualized using ethidium bromide staining. The PCR amplification occurred in a total volume of 50 mL and contained the following components: 25 mL of 2 Es Taq MasterMix (CW Biotechnology Company, Beijing. China), 1 mL of template, 1 mL of each primer and 22 mL of sterilized DD H2O. The PCR conditions were as follows: 94 C for 7 min; 40 cycles at 94 C for 30 s, 55 C for 30 s and 72 C for 1 min; then 72 C for 4 min. The PCR products were sequenced by the I-congene Biotechnical Company (Wuhan, China). After online analysis of the sequencing results using the Basic Local Alignment Search Tool (BLAST) on the NCBI, several related sequences were selected to construct phylogenetic tree. The construction of the phylogenetic tree was carried out using the Neighbor-Joining (NJ) method with the BIOEDIT and MEGA5.1 software. For NAP gene analysis, the primers were NAP1 (TCTGGACCATGGGCTTCAA CCA) and NAP2 (ACGACGACCGGCCAGCGCAG). The PCR procedures were as follows: 95 C for 7 min; 37 cycles at 95 C for 30 s, 59 C for 30 s and 72 C for 1 min; and 72 C for 4 min. Nitrogen removal characteristics of AD-1 Broth medium with several different forms of nitride was used to test AD-1, to characterize the response of this isolates. The source of nitrogen per liter for this study was as follows: 1. 50 mg L1 of 1 1 1 NOe of NOe of NHþ of NHþ 3 -N; 2. 50 mg L 2 -N; 3.50 mg L 4 -N; 4. 50 mg L 4 -N and 50 mg L1 of NOe 2 -N. Other components in one liter of the broth medium were as follows: 16.67 g of sodium succinate dibasic hexahydrate; 1.5 g of KH2PO4; 5.27 g of Na2HPO4$12H2O; 0.1 g of MgSO4; and 2 mL trace element solution. The isolates were pre-cultured at 30 C and 160 rpm in a rotary shaker to the exponential phase, and then 4 mL bacterial suspension was centrifuged at 8000 rpm for 7 min, followed by three washed with sterilized DD H2O, and then re-suspended to 4 mL. The suspension was inoculated into flasks of 500 mL with a working volume of 200 mL to obtain 2% inoculum. During the cultivation, the bacterial suspensions were sampled periodically to determinate the optical density (OD600), e þ then filtered through 0.22 mm membrane filters to determine the NOe 3 , NO2 , NH4 and dissolved total nitrogen (DTN). The same process was conducted to determine the suspended total nitrogen (TN) prior to filtration at the beginning and the end e þ (60 h) of culture. TN, DTN, NOe 3 , NO2 , NH4 , NH2OH and intracellular nitrogen was detected to test nitrogen balance by the consumption of NOe 3 at the beginning and the end. Detection of nitrous oxide One milliliter bacterial suspension as described was inoculated into a 1 L bottle with 100 mL DTM. The bottles were tightly sealed with a gas-impermeable rubber plug and then cultured in a rotary shaker. For comparison, the blank DTM without inoculation was used as the control. For the determination of N2O, headspace air (21% oxygen) in the bottle was not replaced to form an aerobic environment. Twenty milliliters of headspace gas was collected using a 50 mL gas-tight syringe through the rubber stopper every 12 h to detect N2O. The samples were collected in triplicate. Impact of temperature, C source and C/N To determine the influence of temperature, 2 mL of the bacterial suspension were collected at the exponential phase, centrifuged, washed by sterilized DD H2O, re-suspended to 2 mL and inoculated (2% inoculum) into 100 mL DTM with an initial NOe 3 -N concentration of 50 mg L1. The suspension was then cultured in rotary shaker at temperatures of 15 C, 20 C, 25 C, 30 C, 35 C and 40 C. Additional conditions were as follows: the carbon source was sodium succinate and the C/N was 60. For carbon sources,
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
3
þ e e þ FIG. 2. Concentration variation of nitrogen compounds with the growth of AD-1 when NOe 3 (A), NH4 (B), NO2 (C), NO2 and NH4 (D) served as nitrogen sources under aerobic conditions.
sodium succinate, glucose, sucrose, trisodium citrate and sodium acetate were selected to test the performance of AD-1 by fixing the C/N at 60 accompanied 1 with a constant NOe under a culture temperature 3 -N concentration of 50 mg L of 30 C, the carbon concentration of different forms in the broth medium was determined every 24 h. For the C/N test, the concentration of sodium succinate was increased to set the ratio at 5, 10, 15, 20, 30 and 60, respectively, at a temperature of 30 C. The cultures were harvested every 24 h to measure the NOe 3 and OD600. Analytical method Optical density (OD600) values were determined by a UVVIS spectrophotometer (UV759, Shanghai Jingke Industrial Company, Shanghai, China) at wavelength of 600 nm. The sodium succinate, trisodium citrate, sodium e acetate, NOe 3 and NO2 concentrations were measured by ion chromatography (ICS5000þ, Thermo Fisher Scientific, MA, USA). The concentration of glucose and sucrose was examined by phenol-sulphuric acid method according to Dubois et al. (17). The NHþ 4 was tested by Nessler’s reagent photometry. The DTN and TN were analyzed by hydrochloric acid photometry method. NH2OH was analyzed by indirect spectrophotometry according to Frear and Burrell (18). Organic nitrogen e e in the broth medium was calculated by subtracting NH2OH, NHþ 4 , NO3 , and NO2 from DTN. Intracellular nitrogen was calculated from the relationship between dry biomass (mg L1) and nitrogen content (%) obtained from the organic elemental analyzer (FLASH 2000, Thermo Fisher Scientific) of dry cells. These dry cells were prepared by freeze-drying the cell for 24 h after centrifugation. The gaseous product N2O was detected by gas chromatography (7890A, Agilent Technologies Inc., CA, USA) equipped with an electron capture detector. The results are presented as the mean SD from three independent experiments, and all of the graphs were drawn using OriginPro 8 (OriginLab Corporation, Northampton, MA, USA). Nucleotide sequence accession number Amplification and sequencing of the 16S rRNA gene fragment of 1431 bp was conducted by PCR products, and then submitted to GenBank under accession number of MF098763.
RESULTS AND DISCUSSION Identification of AD-1 Strain AD-1 was gram-negative, rodshaped, with a length of 1.5e2.9 mm and a width of 0.6e0.9 mm, oxidase-positive and catalase-positive. The colonies of strain AD-1 were faint yellow, irregular, and displayed a plicated surface on a BTB agar plate. Phylogenetic analysis based on the 16S rRNA showed that AD-1 has 99% similarity with P. stutzeri strain B7. A phylogenetic tree based on the 16S rRNA partial sequences using the NJ method (Fig. 1), proved that AD-1 groups with the genus P.
stutzeri. Thus, we identified the strain as P. stutzeri AD-1. Denitrification is a metabolic activity that can be detected in several kinds of bacteria. Studies on aerobic denitrifiers primary include Pseudomonas, Alcaligenes, Paracoccus, Bacillus and Marinobacter (2,19). Several strains in genus Pseudomonas, such as P. stutzeri PCN-1 (20), have been reported to be able to carry out denitrification under aerobic conditions. NAP is a special functional gene that is responsible for encoding the periplasmic nitrate reductase, which mediates the reduction of NOe 3 under aerobic conditions. In this study, we sequenced 786 bp fragments of NAP (results not shown), proving that AD-1 has a e promising ability to reduce NOe 3 to NO2 . Therefore, the aerobic denitrification performance of isolate AD-1 was subsequently investigated. Nitrogen removal performance of AD-1 Nitrate was used as sole nitrogen source in order to classify the metabolism characteristic of AD-1. As shown in Fig. 2A, AD-1 possesses aerobic denitrification ability, which utilized NOe 3 as the nitrogen source for growth. In one day, the concentration of NOe 3 decreased from 47.46 mg L1 to below the detectable limit by ion chromatography without a lag period. The calculated average rate 1 1 of removal of NOe h , which was more effective 3 was 1.98 mg L than some other aerobic denitrifiers that have been previously reported. For instance, a rate of 1.11 mg L1 h1 has been demonstrated for Pseudomonas sp. Y2-1-1 (21). Additionally, the accumulation of NOe 2 was detected during the early 24 h with a maximum of 18.42 mg L1 at hour 16 and then rapidly decreased to near zero, which would be an advantage for wastewater management. After 24 h, the DTN declined to 2.5 mg L1 with the rapid growth of AD-1, which showed more than 95% removal rates, corresponding to the increase in the OD600 from 0.01 to 0.50. The calculated maximal growth rate (mm) of AD-1 according to Yao et al. (22) was 0.11 h1, which was much higher than that of the autotrophs. For example, the mm for Nitrosomonas europaea (23) was approximately 0.03e0.05 h1. It was worth noticing that e there was a decline in the NOe 3 , NO2 and DTN, and all were used up during the early 24 h. At the same time, the OD600 was only
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
4
QING ET AL.
J. BIOSCI. BIOENG., TABLE 1. Nitrogen removal by consumption of nitrate in 60 h (unit: mg L1). Initial N
49.66 0.61
Lost Na
Final amount of N NOe 3 -N
NHþ 4 -N
NOe 2 -N
NH2OH-N
Organic N
Intracellular N
e
0.47 0.17
e
e
3.27 1.86
38.26 2.23
8.81 1.51
e. Undetectable. Values represent mean S.D. of triplicates. a Calculated value. Lost N ¼ initial TN final TN.
0.50, indicating that AD-1 had reached its early exponential phase. Studies on aerobic denitrifying bacteria show that the denitrification progress usually occurs during the proliferation of the cells (24). This is because the cells require high levels of energy to support their metabolism during the exponential period, thus leading to abundant electron release from organic oxidation and the next active redox reaction. Although aerobic denitrification has been a great concern since its discovery in the 1980s (7), only a few studies on the mechanism þ of the degradation of NOe 2 and NH4 by denitrifiers have been reported (25,26). In this section, the progresses of the utilization of þ NOe 2 and NH4 by strain AD-1will be discussed. Broth culture meþ dium with NOe 2 or NH4 was used to culture AD-1, to determine the bacterial growth and nitrogen removal rate with different forms of nitrogen sources. The results (Fig. 2B) showed that NHþ 4 was assimilated for bacteria growth. Within 16 h, the NHþ 4 declined from 49.87 to 0.27 mg L1, with a removal efficiency of 99.5%. The average NHþ removal rate of AD-1 was approximately 4 3.1 mg L1 h1, much higher than Bacillus sp. LY which had an NHþ 4 e removal rate of 0.43 mg L1 h1 (27). Additionally, NOe 2 and NO3 were not detected, indicating that AD-1 may not be a heterotrophic nitrifier. The phenomenon that coupled heterotrophic nitrification with aerobic denitrification has been well studied over the years (24,28). AD-1 only performed aerobic nitrification, this is highly unusual but similar to Marinobacter strain NNA5 (29). Studies showed that some denitrifiers may assimilate NHþ 4 for growth, while part of the NHþ 4 was converted into gaseous nitrogen products (30). Recent study (14) has revealed an additional NHþ 4 removal pathway to be via hydroxylamine (NHþ / NH2OH / 4 e N2O / N2) instead of NOe 2 or NO3 , which could be responsible for this phenomenon. When NOe 2 (Fig. 2C) was the sole nitrogen source, the phee nomenon was similar to that of NHþ 4 , but the NO2 decreased at a slower rate. Within 24 h, the NOe with an initial concentration of 2 47.99 mg L1 was nearly depleted with no accumulation of NOe 3 or NHþ 4 . This implies that no nitrification process was detected at a C/N ratio close to 60. During the growth of the bacteria, part of the nitrogen was transformed into biomass through assimilation, especially at the high C/N ratio. Zhao et al. (31) reported that 49.7% of the nitrogen was assimilated by Providencia rettgeri strain YL at a C/N ratio of 11. It is intriguing to note that the high NOe 2 concentration of 47.99 mg L1 did not inhibit the growth of strain AD-1 compared to Pseudomonas sp. yy7 (25), which showed a poor growth rate at the same concentration of NOe 2 . In addition, a higher biomass of AD-1 was observed compared to the use of NOe 3 as a sole nitrogen source, which agreed with previous studies by Yao. This may due to the lower nitrogen oxidation state in nitrite, thus increasing the ease of assimilation by bacteria (22). e e Fig. 2D depicts the variation of NHþ 4 , NO2 , NO3 and DTN when þ NOe and NH served as nitrogen sources simultaneously to 2 4 investigate the effect of NOe 2 on the nitrogen conversion of AD-1. þ AD-1 utilized NHþ 4 first for growth, and as the NH4 was being consumed, NOe 2 was assimilated by AD-1. The utilization order of e NHþ 4 and NO2 was similar to that of Klebsiella pneumoniae CF-S9 (32). During the whole process, NOe 3 was not detected using iron chromatography, indicating that there was no nitrification. There were reports (33e35) that the presence of NOe 2 limits the
expression of the enzyme that is involved in nitrogen conversion. However, this phenomenon was not monitored in this study. With þ the addition of nearly 50 mg L1 NOe 2 , AD-1 could utilize NH4 and began to proliferate immediately without any retention time. Whether NOe 2 affects the metabolism of the bacteria merits further studied. Thus, AD-1 could perform more favorably when cultured in þ e NOe 3 , NH4 and NO2 media, which provides an opportunity to manage high-nitrogen-containing wastewaters and reduce external carbon compared to conventional study. The nitrogen balance during the consumption of NOe 3 was calculated and shown in Table 1, the increase in NHþ 4 , organic nitrogen and intracellular nitrogen was observed while NOe 3 was consumed to near zero. At the end, 77.04% of initial NOe 3 -N was assimilated by AD-1 then converted to intracellular nitrogen, much higher than others. For example, Kim (36) found that proportion was 24.8% in Bacillus strains at a C/N of 8. Lost nitrogen in the broth medium was speculated due to the gaseous production in the form of N2 and N2O. Moreover, Fig. 3 shows that there was a distinct decrease in the TN concentration regardless of the type of nitrogen e that served as the substrate. The TN removal rate for NOe 3 , NO2 and NHþ was 18.7%, 17.3% and 23.6% respectively. The difference be4 tween DTN mentioned in Fig. 2 and TN indicated that AD-1 could e þ assimilate NOe 3 , NO2 and NH4 then transfer them to biomass for growth, thus leading to a high accumulation of intracellular nitrogen. In the past, research on nitrification and denitrification usually only examined the change of the total nitrogen concentration in broth medium (as DTN described in Fig. 2). In addition, a large number of studies focused on the conversion among different forms of inorganic nitrogen, such as heterotrophic nitrificationaerobic denitrification, reduction of nitrate to ammonia and anaerobic ammonia oxidation (37), but little research has been reported in this part. In consideration of time and financial consumption, the advantage of microbial assimilation pathway under aerobic heterotrophic condition is equivalent to heterotrophic nitrification-aerobic denitrification. Moreover, it’s reasonable to
FIG. 3. Comparison of TN concentration between the initiation and the end of the culture.
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
FIG. 4. Detection of N2O from the inoculated samples and blank control.
utilize fixed nitrogen for further cultivation, thus providing a novel but efficient approach for reclamation of nutrients especially nitrogen and carbon in wastewater (16). Based on the decrease in the TN concenDetection of N2O tration and the phenomenon that several bubbles were observed at the end of culture, an inference can be drawn on the possible occurrence of NOe 3 -N conversion to gaseous nitrogen product, N2 and N2O. N2O is one of the greenhouse gases that are harmful to the
5
ozone layer. The results (Fig. 4) showed that N2O was produced by AD-1 when NOe 3 served as the nitrogen source. AD-1 emitted N2O at the beginning of the culture without any retention time, average N2O-N emission rate in the broth medium was 5.79 105 mg L1 h1, and the N2O-N concentration in the headspace reached 9.1 104 mg L1 at 60 h and remained stable onwards. This concentration was much lower than that produced by other denitrifiers. Most aerobic denitrification produces primarily N2O rather than N2. For example, P. stutzeri PCN-1 (20) could generate 0.33 mg L1 N2O at 8.5 h, accounting for 0.33% of the denitrified NOe 3 -N. Additionally, Marinobacter sp. (38) isolated from marine sediment was confirmed to produce N2O as a gaseous product. Thus, the distinct decrease in the TN indicated that most of the nitrogen removed from the broth medium could be N2. When AD-1 is compared to other strains, it shows environmental-benefits based on its low levels of N2O emission. From intermediates monitored when a different form of nitrogen served as substrate and gaseous product as mentioned above, it could be concluded that AD-1’s nitrogen removal mechanisms could occur different ways. Larger amounts of nitrogen were removed through assimilation by the bacteria. Part of the nitrogen was converted into gaseous products through aerobic denitrificae þ tion with NOe 3 and NO2 , however, with NH4 , the nitrogen was likely to be removed via the hydroxylamine pathway instead of through conventional heterotrophic nitrification. Single factor experiments There are many factors that may influence the ecological functions of most microorganisms. This
FIG. 5. Carbon degradation (A), Denitrification performance (B) and Bacterial growth condition (C) when grown with different C sources.
FIG. 6. Denitrification performance (A) and Bacterial growth condition (B) during different C/N ratios.
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
6
QING ET AL.
J. BIOSCI. BIOENG.,
FIG. 7. Denitrification performance (A) and Bacterial growth condition (B) at different temperatures.
section examines the influence of temperature, carbon source and C/N. The growth characteristics, the NOe 3 and carbon concentrations during different culture conditions in the broth medium were investigated every 24 h. With aerobic denitrification bacteria, the carbon sources support not only the energy but also serve as the electron source. This is an important factor that may influence nitrogen removal performance and denitrification mechanisms (39). Research conducted by Her (40) showed that organic compounds with a simple structure (such as glucose) would be better carbon sources for denitrification bacteria. But in a 72-h culture experiment, the results (Fig. 5) showed that sodium succinate, glucose, sucrose, and trisodium citrate could support the growth of AD-1, the OD600 reached 1.95, 2.08, 2.47 and 1.60 respectively with the depletion of carbon source. Meanwhile, 100%, 63.91%, 39.38% and 100% carbon was consumed respectively at the end of the culture. The best carbon source for strain AD-1 was sodium succinate and glucose, due to their highest efficiency of removing NOe 3 and cell proliferation rate. Thus, sodium succinate was used for optimal C/N ratio and temperature tests. The results consistent with those of Bacillus methylotrophicus strain L7 (39) which showed highest nitrogen removal percentage with succinate. However, poor growth and accordingly worse nitrogen removal performance were observed with AD-1 when sodium acetate was the sole carbon source. This finding consistent with P. stutzeri YG-24, which may related to the sodium acetate was the most oxidized compound among the five carbon sources (41). But acetate could support the growth of P. stutzeri strain T1 (26) and A. faecalis no. 4 (15) due to its simple molecular structure. Therefore, the suitable carbon source for aerobic denitrifiers might vary among specific strains or species (41). Moreover, the change of carbon sources may result to different mechanism of nitrogen conversion. Zhang (39) observed that there was an obvious accumulation of NOe 2 on sodium succinate, but not on glucose. And Joo (15) reported that the denitrification ratio in citrate was larger than that in the acetate. The C/N ratio is a key factor that may influence the application potential of the strain. A lower C/N ratio leads to poor nitrogen removal performance due to the exhaustion of carbon (41). Alternatively, an excessive amount of carbon leads to a higher cost. Thus, it is important to quantify the optimal C/N ratio. In this section 1 (Fig. 6), the initial NOe 3 -N concentration was nearly 50 mg L , and the concentration of carbon was increased serially to result in a ratio of 5e60. It was found that with the increase of carbon. The biomass of AD-1 gradually increased in parallel with the increase in carbon. While the NOe 3 -N removal rate did not differ significantly when the C/N ratio varied between 15 and 60 in 3 days, the residual NOe 3 at a C/N ratio of 5 and 10 may be due to the exhaustion of
carbon. However, the optimal C/N ratio for strain AD-1 should be 15 in consideration of the lower amount of depletion by the organism. An optimum C/N ratio of AD-1 was higher than that of other strains, such as A. faecalis strain No. 4 (C/N ratio: 7e8) isolated from sewage sludge (42). The high tolerance of strain AD-1 to a wide C/N range expands the scope of its application to use as wastewater with a high C/N ratio, such as sanitary sewage as well as livestock farm wastewaters (42). The effects of temperature on bacterial growth and denitrification performance were also examined in a rotary shaker that was set at 15, 20, 25, 30, 35 and 40 C respectively. During 72-h of culture (Fig. 7), the AD-1 cells cultured at 15 C grew the slowest and had the lowest rate of NOe 3 removal. As the temperature increased from 15 to 40 C, the rate of removal of NOe 3 accelerated, while the cell density was maximal after 3 days at 25 C and then declined at temperatures higher than 30 C, which indicates that there is no positive correlation between cell growth and the removal of NOe 3. The results showed that the optimal culture temperature of AD-1 is 25 C, which is lower than that of the other reported aerobic denitrifiers, including B. methylotrophicus strain L7 (37 C) isolated from wastewater (39) and Bacillus licheniformis A13 (32.5 C) isolated from soil and liquid samples (43). In addition, AD-1 efficiently removed NOe 3 at a wide temperature range of 20e40 C in contrast to other strains, such as P. stutzeri YG-24 (41) that could only remove NOe 3 at a rate of 2.24% at 40 C, this property could make it an attractive candidate to use in the bioremediation of wastewater. In conclusion, strain AD-1 was isolated from activated sludge and identified as genus P. stutzeri based on physiological and biochemical characteristics tests and 16S rRNA phylogenetic tree e þ analysis. In 24 h, AD-1 could efficiently remove NOe 3 , NO2 and NH4 individually at an initial nitrogen concentration of 50 mg L1. In contrast to other heterotrophic nitrification-aerobic denitrification bacteria, AD-1 not only performs aerobic denitrification but also e þ assimilates large amounts of NOe 3 , NO2 and NH4 for growth, showing a new pathway for the removal of nitrogen. The strain also adapted well to a higher C/N ratio and lower temperatures, thus making it a potential candidate for wastewater management in bioremediation technology.
ACKNOWLEDGEMENTS The authors thank Yingying Tian of Henan institute of technology for her help in bacteria cultivation. This works was funded by Major Science and Technology Program for Water Pollution Control and Treatment of China (grant No. 2013ZX07102005), and the National Natural Science Foundation of China (grant No. 31670465).
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010
VOL. xx, 2018 References 1. Qin, B. Q., Zhu, G. W., Gao, G., Zhang, Y. L., Li, W., Paerl, H. W., and Carmichael, W. W.: A drinking water crisis in Lake Taihu, China: linkage to climatic variability and lake management, Environ. Manage., 45, 105e112 (2010). 2. Zheng, H. Y., Liu, Y., Gao, X. Y., Ai, G. M., Miao, L. L., and Liu, Z. P.: Characterization of a marine origin aerobic nitrifying-denitrifying bacterium, J. Biosci. Bioeng., 114, 33e37 (2012). 3. Khardenavis, A. A., Kapley, A., and Purohit, H. J.: Simultaneous nitrification and denitrification by diverse Diaphorobacter sp, Appl. Microbiol. Biotechnol., 77, 403e409 (2007). 4. Kulikowska, D., Jó zwiak, T., Kowal, p., and Ciesielski, S.: Municipal landfill leachate nitrification in RBC biofilm-Process efficiency and molecular analysis of microbial structure, Bioresour. Technol., 101, 3400e3405 (2010). 5. Zumft, W. G.: Cell biology and molecular basis of denitrification, Microbiol. Mol. Biol. Rev., 61, 533e616 (1997). 6. Peng, Y. Z. and Zhu, G. B.: Biological nitrogen removal with nitrification and denitrification via nitrite pathway, Appl. Microbiol. Biotechnol., 73, 15e26 (2006). 7. Robertson, L. A. and Kuenen, J. G.: Aerobic denitrification: a controversy revived, Arch. Microbiol., 139, 351e354 (1984). 8. Yin, S. X. and Chen, L. M.: Advances in the research of soil nitrifying and denitrifying microorganisms, Tu Rang Xue Bao, 39, 116e128 (2002) (in Chinese). 9. Bell, L. C., Richardson, D. J., and Ferguson, S. J.: Periplasmic and membranebound respiratory nitrate reductases in Thiosphaera pantotropha, FEBS Lett., 265, 85e87 (1990). 10. Zhu, L., Ding, W., Feng, L. J., Kong, Y., Xu, J., and Xu, X. Y.: Isolation of aerobic denitrifiers and characterization for their potential application in the bioremediation of oligotrophic ecosystem, Bioresour. Technol., 108, 1e7 (2012). 11. Zhang, J. B., Wu, P. X., Hao, B., and Yu, Z. N.: Heterotrophic nitrification and aerobic denitrification by the bacterium Pseudomonas stutzeri YZN-001, Bioresour. Technol., 102, 9866e9869 (2011). 12. Shi, Z., Zhang, Y., Zhou, J. T., Chen, M. X., and Wang, X. J.: Biological removal of nitrate and ammonium under aerobic atmosphere by Paracoccus versutus LYM, Bioresour. Technol., 148, 144e148 (2013). 13. Shao, Q. and Yu, X. B.: Isolation and Characterization of A Strain denitrobacteria, Sheng Wu Ji Shu, 18, 63e65 (2008) (in Chinese). 14. Zhao, B., He, Y. L., Hughes, J., and Zhang, X. F.: Heterotrophic nitrogen removal by a newly isolated Acinetobacter calcoaceticus HNR, Bioresour. Technol., 101, 5194e5200 (2010). 15. Joo, H. S., Hirai, M., and Shoda, M.: Characteristics of ammonium removal by heterotrophic nitrification-aerobic denitrification by Alcaligenes faecalis No. 4, J. Biosci. Bioeng., 100, 184e191 (2005). 16. Li, Y. T., Wang, Y. R., Fu, L., Gao, Y. Z., Zhao, H. X., and Zhou, W. Z.: Aerobicheterotrophic nitrogen removal through nitrate reduction and ammonium assimilation by marine bacterium Vibrio sp. Y1-5, Bioresour. Technol., 230, 103e111 (2017). 17. Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A., and Smith, F.: Colorimetric method for determination of sugars and related substances, Anal. Chem., 28, 350e356 (1956). 18. Frear, D. S. and Burrell, R. C.: Spectrophotometric methods for determining hydroxylamine reductase activity in higher plants, Anal. Chem., 27, 1664e1665 (1955). 19. Wang, W., Cai, Z. C., Zhong, W. H., and Wang, G. X.: Research advances in aerobic denitrifiers, Ying Yong Sheng Tai Xue Bao, 18, 2618e2625 (2007) (in Chinese). 20. Zheng, M. S., He, D., Ma, T., Chen, Q., Liu, S. T., Ahmad, M., Gui, M. Y., and Ni, J. R.: Reducing NO and N2O emission during aerobic denitrification by newly isolated Pseudomonas stutzeri PCN-1, Bioresour. Technol., 162, 80e88 (2014). 21. Kong, Q. X., Wang, X. W., Jin, M., Shen, Z. Q., and Li, J. W.: Development and application of a novel and effective screening method for aerobic denitrifying bacteria, FEMS Microbiol. Lett., 260, 150e155 (2006). 22. Yao, S., Ni, J. R., Ma, T., and Li, C.: Heterotrophic nitrification and aerobic denitrification at low temperature by a newly isolated bacterium, Acinetobacter sp. HA2, Bioresour. Technol., 139, 80e86 (2013).
NITROGEN REMOVAL AND ASSIMILATION BY AD-1
7
23. Gupta, A. B. and Gupta, S. K.: Simultaneous carbon and nitrogen removal from high strength domestic wastewater in an aerobic RBC biofilm, Water Res., 35, 1714e1722 (2001). 24. Chen, P., Li, J., Li, Q. X., Wang, Y., Li, S., Ren, T., and Wang, L.: Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24, Bioresour. Technol., 116, 266e270 (2012). 25. Wan, C. L., Yang, X., Lee, D. J., Du, M. A., Wan, F., and Chen, C.: Aerobic denitrification by novel isolated strain using NO2e-N as nitrogen source, Bioresour. Technol., 102, 7244e7248 (2011). 26. Guo, L. Y., Chen, Q. K., Fang, F., Hu, Z. X., Wu, J., Miao, A. J., Xiao, L., Chen, X. F., and Yang, L. Y.: Application potential of a newly isolated indigenous aerobic denitrifier for nitrate and ammonium removal of eutrophic lake water, Bioresour. Technol., 142, 45e51 (2013). 27. Zhao, B., He, Y. L., and Zhang, X. F.: Nitrogen removal capability through simultaneous heterotrophic nitrification and aerobic denitrification by Bacillus sp. LY, Environ. Technol., 31, 409e416 (2010). 28. Chen, Q. and Ni, J. R.: Heterotrophic nitrification-aerobic denitrification by novel isolated bacteria, J. Ind. Microbiol. Biotechnol., 38, 1305e1310 (2011). 29. Liu, Y., Ai, G. M., Miao, L. L., and Liu, Z. P.: Marinobacter strain NNA5, a newly isolated and highly efficient aerobic denitrifier with zero N2O emission, Bioresour. Technol., 206, 9e15 (2016). 30. van Niel, E. W. J.: Nitrification by heterotrophic denitrifiers and its relationship to autotrophic nitrification, Ph.D. thesis, Delft University, https://repository. tudelft.nl/islandora/object/uuid:274fb0bb-e4cb-4af1-bc93-1630bf36d850/ datastream/OBJ (1991) (in Chinese). 31. Zhao, B., He, Y. L., Huang, J., Taylor, S., and Hughes, J.: Heterotrophic nitrogen removal by Providencia rettgeri strain YL, J. Ind. Microbiol. Biotechnol., 37, 609e616 (2010). 32. Padhi, S. K., Tripathy, S., Sen, R., Mahapatra, A. S., Mohanty, S., and Maiti, N. K.: Characterisation of heterotrophic nitrifying and aerobic denitrifying Klebsiella pneumoniae CF-S9 strain for bioremediation of wastewater, Int. Biodeterior. Biodegradation, 78, 67e73 (2013). 33. van Niel, E. W. J., Braber, K. J., Robertson, L. A., and Kuenen, J. G.: Heterotrophic nitrification and aerobic denitrification in Alcaligenes faecafis strain TUD, Antonie van Leeuwenhoek, 62, 231e237 (1992). 34. Oh, J. and Silverstein, J.: Acetate limitation and nitrite accumulation during denitrification, J. Environ. Eng., 125, 234e242 (1999). 35. Du, R., Peng, Y. Z., Cao, S. B., Li, B. K., Wang, S. Y., and Niu, M.: Mechanisms and microbial structure of partial denitrification with high nitrite accumulation, Appl. Microbiol. Biotechnol., 100, 2011e2021 (2016). 36. Kim, J. K., Park, K. J., Cho, K. S., Nam, S. W., Park, T. J., and Bajpai, R.: Aerobic nitrification-denitrification by heterotrophic Bacillus strains, Bioresour. Technol., 96, 1897e1906 (2005). 37. Burgin, A. J. and Hamilton, S. K.: Have we overemphasized the role of denitrification in aquatic ecosystems A review of nitrate removal pathways, Front. Ecol. Environ., 5, 89e96 (2007). 38. Nakano, M., Inagaki, T., Okunishi, S., Tanaka, R., and Maeda, H.: Effect of salinity on denitrification under limited single carbon source by Marinobacter sp. isolated from marine sediment, J. Basic Microbiol., 50, 285e289 (2010). 39. Zhang, Q. L., Liu, Y., Ai, G. M., Miao, L. L., Zheng, H. Y., and Liu, Z. P.: The characteristics of a novel heterotrophic nitrification-aerobic denitrification bacterium, Bacillus methylotrophicus strain L7, Bioresour. Technol., 108, 35e44 (2012). 40. Her, J. J. and Huang, J. S.: Influences of carbon source and C/N ratio on nitrate/ nitrite denitrification and carbon breakthrough, Bioresour. Technol., 54, 45e51 (1995). 41. Li, C. N., Yang, J. S., Wang, X., Wang, E. T., Li, B. Z., He, R. X., and Yuan, H. I.: Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a phosphate accumulating bacterium Pseudomonas stutzeri YG-24, Bioresour. Technol., 182, 18e25 (2015). 42. Joo, H. S., Hirai, M., and Shoda, M.: Piggery wastewater treatment using Alcaligenes faecalis strain No. 4 with heterotrophic nitrification and aerobic denitrification, Water Res., 40, 3029e3036 (2006). 43. Zeng, Q. W., Liang, Y. X., and Ge, X. Y.: Screening of denitrobacteria and preliminary study about its denitrification properties, Hua Zhong Nong Ye Da Xue Xue Bao, 27, 616e620 (2008) (in Chinese).
Please cite this article in press as: Qing, H., et al., Novel heterotrophic nitrogen removal and assimilation characteristic of the newly isolated bacterium Pseudomonas stutzeri AD-1, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.010