Reducing NO and N2O emission during aerobic denitrification by newly isolated Pseudomonas stutzeri PCN-1

Bioresource Technology 162 (2014) 80–88

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Reducing NO and N2O emission during aerobic denitrification by newly isolated Pseudomonas stutzeri PCN-1 Maosheng Zheng, Da He, Tao Ma, Qian Chen, Sitong Liu, Muhammad Ahmad, Mengyao Gui, Jinren Ni ⇑ Department of Environmental Engineering, Peking University, Key Laboratory of Water and Sediment Sciences, Ministry of Education, Beijing 100871, China

h i g h l i g h t s  High-efficient aerobic denitrifier with low NO and N2O production was isolated.  Coordinate expression of denitrification gene nirS, cnorB and nosZ was confirmed.  Efficient nitrate removal was reached in wide range O2 from 0% to 100%.  Lowest NO and N2O emission occurred at pH 7–9 with lower C/N ratio 4.  NO and N2O reduction and TN removal was achieved in bioaugmented activated sludge.

a r t i c l e

i n f o

Article history: Received 7 January 2014 Received in revised form 21 March 2014 Accepted 23 March 2014 Available online 1 April 2014 Keywords: NO and N2O emission Nitrogen removal Aerobic denitrification Pseudomonas stutzeri

a b s t r a c t As two obligatory intermediates of denitrification, both NO and N2O had harmful environmental and biological impacts. An aerobic denitrifying bacterial strain PCN-1 was newly isolated and identified as Pseudomonas stutzeri, which was capable of high efficient nitrogen removal under aerobic condition with maximal NO and N2O accumulation as low as 0.003% and 0.33% of removed NO 3 –N, respectively. Further experiment taking nitrite as denitrifying substrate indicated similar low NO and N2O emission of 0.006% and 0.29% of reduced NO 2 –N, respectively. Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed that the coordinate expression of denitrification gene nirS (for cytochrome cd1 nitrite reductase), cnorB (for NO reductase) and nosZ (for N2O reductase) was the fundamental reason of low NO and N2O accumulation. Activated sludge system bioaugmented by strain PCN-1 demonstrated a significant reduction of NO and N2O emission from wastewater during aerobic denitrification, implied great potential of PCN-1 in practical applications. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Biological nutrient removal is a widely used and cost-effective wastewater treatment process to avoid eutrophication of receiving waters. Conventional process for nitrogen removal proceed through oxidizing ammonium to nitrate aerobically (nitrification) by autotrophic nitrifying bacteria and then reducing nitrate stepwise to nitrite, nitric oxide (NO), nitrous oxide (N2O) and finally nitrogen (N2) under anoxic condition (denitrification) by heterotrophic denitrifying bacteria (Zumft, 1997). Consequently, efficient nitrogen removal relies on successively exposing wastewater under aerobic and anoxic condition, which makes it difficult to remove dissolved oxygen (DO) completely to assure sufficient

⇑ Corresponding author. Address: Ying Jie Communication Center 417N, Peking University, Beijing 100871, China. Tel.: +86 10 62751185; fax: +86 10 62756526. E-mail address: [email protected] (J. Ni). http://dx.doi.org/10.1016/j.biortech.2014.03.125 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.

anoxic condition. As a result, denitrifying activity of most denitrifying bacteria is suppressed by the insufficient anaerobiosis, resulting in decline of nitrogen removal efficiency and considerable emission of NO and N2O due to the sensitivity of NO and N2O reductase to O2 (Lu and Chandran, 2010; Wunderlin et al., 2012). Moreover, nitrifying bacteria would also produce more NO and N2O through nitrifier denitrification under the alternate DO condition (Kampschreur et al., 2008). As the intermediates and byproducts of biological nitrogen removal process, both NO and N2O can cause harmful consequences. NO is a hazardous atmospheric pollutant leading to the formation of acid rains and ground level ozone (Han et al., 2011). And NO is a highly reactive and freely diffusible molecule which is toxic for bacterial cells (Spiro, 2012). N2O is a well-known greenhouse gas and ozone depleting substance with global warming potential 320 times stronger than CO2, and the emission of N2O during wastewater treatment has a significant impact on the overall carbon footprint (IPCC, 2006). The toxic effect of N2O is to interact

81

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

with vitamin B12 which can cause inhibition of methionine synthase (Weimann, 2003). Aerobic denitrification process was introduced by isolated Paracoccus denitrificans (formerly Thiosphaera pantotropha), which was capable of respiring nitrate and oxygen simultaneously (Robertson and Kuenen, 1984). This property has drawn increasing attentions due to the intriguing physiological features and the related potential single-stage nitrogen removal process. Since then, more novel species belonging to the genera Alcaligenes, Pseudomonas, Achromobacter, Comamonas, and Bacillus have been isolated and most of them could perform good nitrate or nitrite removal under aerobic condition (Chen and Ni, 2011; Chen and Strous, 2013; Huang et al., 2013; Yang et al., 2011). As a result, aerobic denitrifiers offered a new biological resource for nitrogen removal without the requirement of strictly anoxic condition. In recent years, some researches have taken advantages of the prominent property of aerobic denitrifiers to improve nitrogen removal efficiency during biological wastewater treatment, but few researches paid attention to the NO and N2O emission reduction (Bouchez et al., 2009; Yang et al., 2011). There is a reason that, for most of aerobic denitrifiers, the final two steps of denitrification were still sensitive to O2 and considerable NO and N2O would be produced during the aerobic nitrate or nitrite reduction. For instance, cnorB gene expression (for NO reductase) of Pseudomonas mandelii was not expressed under aerobic conditions (Saleh-Lakha et al., 2008). Strain Alcaligenes faecalis TUD produced N2O accounting for 90% of denitrified nitrogen at 5% air saturation (Otte et al., 1996). The typical aerobic denitrifier P. denitrificans LMD 92.63 only produced N2O rather than N2 at 95% of air saturation (Arts et al., 1995). And another P. denitrificans strain JCM 20620 produced N2O as its denitrifying products as well whenever O2 existed (Miyahara et al., 2010). In the present study, strain PCN-1 performing excellent nitrogen removal with low NO and N2O production was newly isolated. Aerobic denitrifying behavior was interpreted by gene expression analysis. Effect of O2 concentration, carbon source, pH, and C/N ratio on nitrate removal and NO and N2O production was further determined. Bioaugmentation of activated sludge system was finally investigated targeting potential applications of strain PCN-1 for efficient nitrogen removal with reduction of NO and N2O emission during wastewater treatment.

trace elements solution (Yao et al., 2013). Basal denitrification medium (DM) was used for bacteria cultivation and performance evaluation (per liter): 8.45 g sodium succinate, 0.63 g NH4Cl; 0.61 g Na15NO3 (99 atom% abundance) or 0.39 g L1 NaNO2, 1.76 g K2HPO43H2O, 0.20 g MgSO47H2O, 0.02 g CaCl2, 0.005 g FeSO47H2O, 0.1 mL trace elements solution. All media were adjusted to pH 7.5 and autoclaved for sterility at 121 °C for 30 min before use. Ammonium nitrogen at initial concentration of 150 mg L1 in DM was supplemented for bacterial assimilation (Zumft, 1997). Na15NO3 labeled with isotopic 15N was used to ensure precise quantitation of produced N2 which could be easily contaminated by atmospheric N2. 2.2. Isolation and identification Bacterial strains were isolated from a lab-scale immobilized biological aerated filter for treating landfill leachate containing high nitrogen over 200 mg L1. Carrier cubes were taken out from the reactor and transferred to 200 mL EM in 500 mL Erlenmeyer flasks. After 2 days incubation in a rotary shaker at 150 rpm, 5 mL suspensions was transferred to another fresh EM and incubated under the same condition at 30 °C. These procedures were repeated three times. The enriched bacterial culture was gradient diluted and resultant suspensions with different concentrations were spread onto BTB medium agar plates. The plates were incubated at 30 °C for a couple of days. Resulting blue colonies were purified by streaking method and isolated for evaluation of aerobic nitrate removal capability through shake flask experiments (Chen and Ni, 2011; Yao et al., 2013). Morphological characteristic of selected strain was observed with scanning electron microscopy (Quanta 200FEG, FEI, USA). Total bacterial DNA was extracted from 1 mL culture suspension with genomic DNA extraction kit (TianGen, China). The gene encoding 16S rRNA were amplified by PCR using universal primer F27 and R1492 (Table 1) and sequenced in Invitrogen Inc. (Beijing, China). The sequence was analyzed and compared in the Basic Local Alignment Search Tool (BLAST). Finally, a neighbor-joining phylogenetic tree was constructed based on the 16S rRNA gene sequences of the isolate and some other related strains in MEGA 5.05 software with 1000 bootstrap replicates and the maximum composite likelihood model. 2.3. Sealed serum bottle experiments

2. Methods 2.1. Media preparation for bacterial enrichment and cultivation Composition of enrichment medium (EM) was as follows (per liter): 5.63 g sodium succinate, 0.61 g NaNO3, 0.44 g K2HPO43H2O, 0.20 g MgSO47H2O, 0.02 g CaCl2, 0.005 g FeSO47H2O, and 0.1 mL

To evaluate the aerobic denitrifying performance, isolated bacterial strain was precultured to late exponential growth phase and 10 mL preculture was harvested and washed twice with DD H2O followed by inoculating into 50 mL DM in 300 mL glass serum bottles with gas-impermeable rubber stoppers. When N2O was taken as denitrifying substrate, a gas-syringe was used to inject 1.2 mL

Table 1 PCR primers used for 16S rRNA gene sequencing and qPCR analysis. Gene name

Primer name

Primer sequence (50 –30 )

Amplified length

References

16S rRNA

F27 R1492 F341 R518 nirS cd3aF nirS R3cd cnorB Z1F cnorB Z1R nosZ 1527F nosZ 1773R

AGAGTTTGATCMTGGCTCAG TTGGYTACCTTGTTACGACT CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG GTSAACGTSAAGGARACSGG GASTTCGGRTGSGTCTTGA CGTCGGTCAGATCCTCTTCG GCGATGATCACGTAGAGCCA CGCTGTTCHTCGACAGYCA ATRTCGATCARCTGBTCGTT

1465

Yao et al. (2013)

177

Muyzer et al. (1993)

425

Throback et al. (2004)

V3 region of 16S rRNA nirS cnorBa nosZ a

Designed by primer designing tool in NCBI according to cnorB sequence of P. stutzeri A1501.

657 246

Throback et al. (2004)

82

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

pure N2O gas into the 250 mL headspace of serum bottles through the rubber stopper. The gas added was equivalent to initial nitrogen concentration of 40 mg L1 after normalizing into the liquid volume, which was lower than normal used concentration considering the biotoxicity of N2O (Chen and Ni, 2011; Guo et al., 2013; Weimann, 2003). The atmospheric air (approximately 21% O2) in the headspace was not replaced to ensure aerobic condition. To investigate the effect of O2 concentrations on aerobic denitrification performances and production of NO and N2O, 250 mL headspace of serum bottles was aerated with pure Helium followed by replacing a certain volume (0%, 10%, 20%, 50% and 100%) with pure O2 prior to inoculation (Bergaust et al., 2008). Initial DO was measured parallelly with wide-mouth jar during the initial period (0.5 h) of incubation. And the initial concentration of NH+4–N in DM was increased to 300 mg L1 (150 mg L1 in DM) to assure the sufficiency for bacterial assimilation. Other single-factor experiments were also conducted under different culturing conditions, including carbon source, initial pH, and C/N ratio. In carbon source experiment, succinate, citrate, acetate, glucose and sucrose were employed as sole carbon source under condition of C/N 10 and initial pH 8. In pH and C/N experiment, the initial pH was adjusted to 6, 7, 8, 9, 10 under C/N 10 and C/N ratio was adjusted to 2, 4, 6, 10, and 15 under initial pH 8, respectively, by adding acetate as carbon source. The atmospheric air in the headspace of serum bottles was not replaced except in the O2 concentrations experiment. To evaluate the potential application of the isolated strain in wastewater treatment, 7.5 mL and 15 mL preculture (OD600 = 1.053) were collected, centrifuged and resuspended in 2 mL DD H2O followed by inoculating to 50 mL washed activated sludge (MLVSS = 1208 mg L1) in 300 mL serum bottles. The inoculation dosage (v/v) was denoted as 15% and 30%, corresponding to strain PCN-1 concentration of 126 mg VSS L1 and 252 mg VSS L1, respectively. The activated sludge only group and 15% inoculation group was supplemented with a certain amount of concentrated activated sludge to equalize the total bacterial amount. Synthetic wastewater (SWW) was used for bioaugmentation capability evaluation (per liter): 0.68 g sodium acetate, 0.19 g NH4Cl, 0.44 g K2HPO43H2O, 0.20 g MgSO47H2O, 0.02 g CaCl2, 0.005 g FeSO47H2O, 0.1 mL trace element solution. When 0.39 g L1 NaNO2 was added to the SWW, the amount of sodium acetate was increased to 1.78 g L1 to keep C/N ratio equal to 4. The atmospheric air in the headspace was not replaced as well. All the serum bottles were incubated in a rotary shaker at 150 rpm and 30 °C. 100 lL gas samples were collected periodically using a gas-tight syringe for detection of N2O, O2 and N2 and 2 mL for NO detection. Simultaneously, 1 mL aliquots were withdrawn from the bottles by syringe and centrifuged at 8000 rpm for 5 min at 4 °C. The supernatant was obtained for NH+4–N, NO 2 –N and NO 3 –N analysis and the pellets were stored at 80 °C for RNA extraction as needed. Duplicate experiments were performed for all the serum bottle experiments. 2.4. Real-time PCR analysis The expression of denitrification genes was analyzed in the nitrate removal assays using two-step reverse transcription realtime PCR. Total RNA extraction and cDNA synthesis were carried out with RNAprep Bacteria Kit and FastQuant RT Kit (TianGen Biotech (Beijing) Co., Ltd., China), respectively. Real-time PCR was performed using SYBR green PCR Master Mix (Applied Biosystems) and designed nirS, cnorB, and nosZ primer (Table 1). V3 region of 16S rRNA was used as the internal standard to normalize for differences of cDNA added to each PCR tubes, which was proved to be an appropriate housekeeping gene (Bergaust et al., 2008). Standard curves were generated with gradient dilution of quantified plas-

mids which were amplified by transformed competent cells with purified PCR products of cDNA. Reactions were run in a real time PCR system (Applied Biosystems 7300) under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing and extension at 60 °C (nirS and nosZ) or 56 °C (cnorB) for 1 min. 2.5. Analytical methods and calculations The cell optical density was measured by a spectrophotometer (UV-1800, Shimadzu, Japan) at 600 nm (OD600). DO was measured  by a DO meter (550A, YSI, USA). NH+4–N, NO 2 –N and NO3 –N were analyzed by Discrete Auto Analyzer (Smartchem 200, AMS, Italy). O2 and N2O were detected by gas chromatography (GC) equipped with an electron capture detector (ECD). The isotope-labeled N2 was determined by gas chromatography-mass spectrometer (GC/ MS) with the charge–mass ratio of 30. Standard curves were prepared with pure O2, N2O and isotope-labeled N2 (99 atom% abundance). 2 mL gaseous sample was injected to a 2 liter Heliumfilled gasbag followed by detecting with NO–NO2–NOx analyzer (Model 42i, Thermo Fisher Scientific Inc., USA). Concentrations of NO, N2O and N2 were measured in volume concentration (ppm) followed by transforming into mass concentration (1 ppm NO = 0.56 lg L1 and 1 ppm N2O = 1.126 lg L1 at 30 °C and 1 bar). Dissolved N2O was calculated from solubility constant (Weiss and Price, 1984) and added to the total N2O concentration. The concentrations of NO, N2O and N2 in each serum bottle were normalized to the liquid volume (50 mL) for comparable units. Statistical differences were analyzed by one-way analysis of variance (ANOVA) combined with Tukey test (P < 0.05) by using SPSS 13.0 software in the single-factor experiments and bioaugmentation experiments. 3. Results and discussion 3.1. Isolation and identification of aerobic denitrifiers After three times transformation and acclimation, a total of 14 pure bacterial colonies were positive on BTB plate, indicating aerobic denitrification had taken place. At the following capability evaluation assays, strain PCN-1 demonstrated 100% nitrate removal efficiency during 12 h incubation. The strain was Gram-negative, rod-shaped, motile, polar flagellated and exists individually, in pairs or short chains with the size of (0.5–0.7) lm  (1.3–1.9) lm. The nucleotide sequence of nearly full-length 16S rRNA genes (1404 bp) were obtained via polymerase chain reaction (PCR) and submitted to Genbank nucleotide sequence database under the accession number KF589921. The constructed phylogenetic tree (Fig. 1) indicated strain PCN-1 showed high similarity to Pseudomonas stutzeri T1 (99%) and P. stutzeri NBRC 13596 (99%). Therefore, the present strain was identified as P. stutzeri PCN-1. 3.2. Aerobic nitrate removal performance of strain PCN-1 Nitrogen transformation and O2 consumption during incubation of strain PCN-1 was investigated when nitrate was used as denitrifying substrate (Fig. 2). After inoculation, the bacteria grew rapidly without time lag and got stationary phase after 12 h incubation. Nitrate was utilized immediately after inoculation and decreased quickly during the bacterial log phase and depleted at 8.5 h, corre1 1 sponding to average NO h . It 3 –N removal rate of 11.66 mg L was notable that O2 was still remained 9.77% in the headspace at 8.5 h, indicating strain PCN-1 performed co-respiration of NO 3 –N

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

83

Fig. 1. Phylogenetic tree based on 16S rRNA gene sequence of strain PCN-1 and other reference sequences.

Fig. 2. Aerobic nitrate removal performances of strain PCN-1. Symbols: (a): w, O2;  q, OD600; (b): j, NO 3 –N; d, NO2 –N; , N2; (c): N, NO–N; 5, N2O–N.

and O2 during the incubation. The obligatory denitrifying intermediates (NO 2 , NO, N2O) and final products (N2) were detected at 2 h, the first sampling point after inoculation, which demonstrated that four denitrification reductases were synthesized and functioned soon after the inoculation. Accompanied with reduction of nitrate, 1 NO at 6 h and then de2 –N accumulated to maximum 49.10 mg L creased rapidly to zero at 12 h. NO and N2O accumulation exhibited the same trend and increased to maximal concentration 3.33 lg L1 and 0.33 mg L1 at 8.5 h after a fluctuation, accounting for only 0.003% and 0.33% of denitrified NO 3 –N, respectively. The relatively high concentration at 2 h probably resulted from the stress of new incubation condition (Kester et al., 1997). After the

depletion of nitrate and nitrite, both NO and N2O decreased rapidly to undetectable level. Finally, the level of N2 kept at approximately 100 mg L1, corresponding to complete recovery of initial NO 3 –N. It was notable that some aerobic denitrifiers could perform heterotrophic nitrification simultaneously, which also induced NO, N2O and N2 production (Otte et al., 1996; Zhang et al., 2012). In this study, these gaseous products was not produced by the present strain when NH+4–N (provided by 15NH4Cl) was taken as the sole nitrogen source (data not shown), so it could be inferred that the detected gases NO, N2O and N2 were only derived from aerobic denitrification. The nitrogen balance during aerobic denitrification was investigated and relevant results were listed in Table 2. The lost N probably resulted from measurement errors of quantifying different forms of nitrogen. The nitrate removal and nitrogen transformation conducted by strain PCN-1 indicated not only nitrate and nitrite reduction but also NO and N2O reduction were not inhibited by O2 existence. NO and N2O produced by several aerobic denitrifiers were previously investigated, but usually much larger than those produced by strain PCN-1. For instance, strain Alcaligenes eutrophus LMD 82.41 and P. stutzeri LMAU P12 were reported to start denitrify below 1% air saturation and two strains accumulated NO at 0.39% and 0.13% of reduced NO 3 –N respectively (Kester et al., 1997), which were much higher than 0.003% of strain PCN-1. During aerobic nitrate removal by the typical strain P. denitrificans LMD 92.63, N2O accounted for 95.79% of final gaseous products at 20% of air saturation, and this value even increased to 100% at 95% of air saturation (Arts et al., 1995). And P. denitrificans strain JCM 20620 produced N2O as its final denitrifying product prior to O2 depletion at initial 3% O2 concentration (Miyahara et al., 2010). In recent years, more aerobic denitrifiers were isolated but few investigated NO and N2O production during aerobic denitrification (Wan et al., 2011; Yang et al., 2011; Yao et al., 2013). N2O produced by Bacillus methylotrophicus L7 was clearly observed when nitrate or nitrite was used as denitrifying substrate, although the amount was not quantified (Zhang et al., 2012). As a result, the present strain with prominent performance of aerobic denitrification and low NO and N2O production offered a new microbial resource for nitrogen removal and reduction of greenhouse gases emission during wastewater treatment. 3.3. Aerobic nitrite and N2O removal by strain PCN-1 Aerobic denitrification capabilities of strain PCN-1 were also evaluated when nitrite and N2O was used as denitrifying

84

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

Table 2 Nitrogen balance during aerobic nitrate removal by strain PCN-1 in 20 h.a

a b c

Time (h)

NH+4–N

NO 3 –N

NO 2 –N

NO–N

N2O–N

N2

Organic N

0 20

154.34 (1.68) 53.24 (1.22)

99.14 (4.45) 0

0 0

0 0

0 0

0 100.32 (2.91)

– 101.10 (2.90)

b

Lost N

c

– 1.18 (1.53)

Numbers in bracket are standard deviations. Units of all forms of nitrogen are mg L1. Organic N was calculated by subtracting NH+4–N at 20 h from NH+4–N at 0 h. Lost N was calculated by subtracting TN at 20 h from TN at 0 h. TN was calculated by summing all forms of nitrogen.

substrates as depicted in Fig. 3 (initial 150 mg L1 NH+4–N was supplemented for bacterial assimilation as well). When incubation commenced, nitrite was reduced immediately and consumed completely within 7 h, corresponding to average NO 2 –N removal rate of 12.80 mg L1 h1, which was much higher than 0.76 mg L1 h1 and 0.24 mg L1 h1 achieved by Pseudomonas sp. yy7 and B. methylotrophicus L7 respectively (Wan et al., 2011; Zhang et al., 2012). Moreover, it was known that high nitrite concentration would interfere with bacterial O2 respiration and repress denitrifying enzymes (Bergaust et al., 2008; Wan et al., 2011). Nevertheless, stain PCN-1 demonstrated well bacterial growth and unrepressed denitrification. The maximal accumulation of NO and N2O was 5.19 lg L1 and 0.26 mg L1, accounting for only 0.006% and 0.29% of reduced NO 2 –N, which was comparable with that derived from nitrate reduction. In contrast, Pseudomonas sp. yy7 grew poor 1 at initial NO and finally reduced 2 –N concentration of 50 mg L  only approximately 46% of initial NO2 –N (Wan et al., 2011). Strain Agrobacterium tumefaciens C58 produced as much as 40 lM NO (78.26% of reduced NO 2 –N) due to severe suppress of NO reductase activities under initial 2 mM nitrite and 7% O2 concentration (Bergaust et al., 2008). When N2O was taken as denitrifying substrate under initial atmospheric O2 concentration, strain PCN-1 could remove 98.13% of initial 39.42 mg L1 N2O–N within 4 h, corresponding to average nitrogen removal rate of 9.67 mg L1 h1. It was interesting that the removal rate was comparable to that when nitrate or nitrite

was taken as denitrifying substrate, indicating the N2O reduction could be conducted without suppression just like nitrate and nitrite reduction. It was known that the copper center (CuZ) of N2O reductase could be easily inactivated by O2, resulting in the interruption of electron relay to N2O (Pomowski et al., 2011). N2O reduction was immediately stopped and high N2O emitted during aerobic denitrification of strain A. faecalis TUD when incubation condition was switched from anaerobic condition to 25% air saturation (Otte et al., 1996). And N2O could not be taken as denitrifying substrate by P. denitrificans JCM 20620 until O2 was depleted (Miyahara et al., 2010). In contrast, strain PCN-1 demonstrated successful N2O reduction under air saturation condition, which further suggested the potential of reducing N2O emission during biological nitrogen removal.

Fig. 3. Aerobic nitrite (a) and N2O (b) removal performances by strain PCN-1. Symbols: w, O2; q, OD600; d, NO 2 –N; N, NO–N; 5, N2O–N.

Fig. 4. Expression of nirS, cnorB and nosZ relative to 16S rRNA when nitrate was taken as denitrifying substrate of strain PCN-1. Symbols: j, nirS; s, cnorB; 4, nosZ.

3.4. Expression of denitrification genes The expression of denitrification gene nirS, cnorB and nosZ was investigated by RT-PCR during aerobic nitrate removal process to further interpret the denitrification features. As depicted in Fig. 4, expression of nirS became significant rapidly and kept stable at 4–8.5 h, which was concomitant with the high accumulated nitrite concentration. As the continued transcription of nirS required presence of nitrate or nitrite (Hartig and Zumft, 1999), the depletion of nitrite at 12 h resulted in a rapid decrease in nirS expression, although it did not decline to undetectable level as incubation progressed. Expression of cnorB reached highest level between 6 and 8.5 h as high NO was accumulated. This result implies that NO plays an indispensable role in the regulations of denitrification genes expression and coordination of its own production and consumption to avoid its accumulation to toxic levels (Spiro, 2012). Fig. 4 showed that the expression amount of cnorB was approximately an order of magnitude higher than that of nirS, which assured sufficient NO reductase enzyme synthesis to keep NO accumulation at a low level. Expression of nosZ, catalyzing the final step of denitrification, was also detected at 2 h, which was

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

coincident with the N2 production at the first sample point after inoculation. After that, nosZ expression increased gradually and reached a peak at 8.5 h, which was consistent with the calculated highest N2 production rate at this time. The successful expressions of denitrification genes suggested nirS, cnorB and nosZ were involved in aerobic denitrification of strain PCN-1. In contrast, there was no expression of denitrification genes of strain Pseudomonas fluorescens C7R12 under aerobic condition confirmed by RT-PCR (Philippot et al., 2001). Likewise, cnorB gene expression of P. mandelii was not detected under aerobic condition (Saleh-Lakha et al., 2008). It was interesting to notice that the expression of nirS, cnorB, and nosZ showed a similar pattern during the incubation, all of which were detectable at 2 h and increased to a high level during nitrogen oxide reduction process and finally decreased to a low level at 12 h. The decline of both expression of cnorB and nosZ was probably due to fewer molecules inducing mRNA synthesis and instability for bacterial mRNA, such as a half-life of 13 min was determined for mRNA in denitrifying cells of P. stutzeri (Hartig and Zumft, 1999; Philippot et al., 2001). In addition, this result suggested expression of the three denitrification genes was coordinately regulated, which induced the synchronous reduction of nitrite, NO and N2O and finally low accumulation of NO and N2O. This coordinate expression of denitrification genes by strain PCN-1 was in agreement with previous claim that the nir, nor and nos gene of P. stutzeri formed a supercluster on the chromosome (Zumft, 1997). 3.5. Effect of different factors on denitrification and NO and N2O production Considering its key role in denitrification, the effect of O2 concentration on denitrifier PCN-1 was investigated. Initial O2 concentrations in the headspace were 0%, 10%, 20%, 50%, and 100% (Fig. 5a), and the corresponding DO concentrations of the initial inoculated media were 0.03, 3.26, 4.18, 8.29, and 18.39 mg L1,

85

respectively. Nitrate reduction commenced immediately after inoculation under all the O2 concentrations except a 6 h lag in the 100% O2 treatment. Although a certain degree of inhibition of nitrate reduction by increased O2 was observed during the initial incubation period, nitrate and accumulated nitrite was completely reduced within 12 h except in the 100% O2 treatment (Fig. 5b and c). It was notable that the average NO 3 –N removal rate was still 5.45 mg L1 h1 under 100% O2 condition for strain PCN-1, which was higher than most of the other aerobic denitrifiers performed under air saturation (21%) condition (Chen et al., 2012; Guo et al., 2013), indicating the high tolerance to O2 of the present strain. NO accumulation was obviously decreased with increasing O2 concentration (Fig. 5d), which implied NO reductase was more activated under higher O2. It was reported all members of the heme-copper oxygen reductases could reduce nitric oxide, which made it possible to respire O2 and reduce NO synergistically (Chen and Strous, 2013). Moreover, a wide distributed globin called flavohemoglobin would bind NO avidly and converted it to nitrate to detoxify NO under aerobic conditions (Poole and Hughes, 2000). As a result, NO could be reduced through various pathways under aerobic condition, which made it an intrinsic advantages of aerobic denitrifiers. The accumulated amount of N2O increased with increasing O2 concentration from 0% to 100% (Fig. 5e). However, the maximal accumulated N2O was still negligible (lower than 1.12% of total denitrified NO 3 –N) when O2 concentration was below 50%. In pure O2 condition, N2O accumulated to maximal 22.58 mg L1, accounting for 25.90% of denitrified NO 3 –N. The considerable accumulation of N2O probably resulted from the severe inhibition of N2O reductase by extremely high O2 concentration (Pomowski et al., 2011). Another possibility was that the rapid O2 respiratory rate at high O2 concentration gave rise to reactive free radicals and further resulted in oxidative damage to DNA, RNA, and proteins of the bacterial cells (Cabiscol et al., 2000). This view was supported by the stopped consumption of 42.71% O2 and

Fig. 5. Influence of O2 concentrations on aerobic nitrate removal and NO and N2O production of strain PCN-1. Symbols: h, 0% O2; d, 10% O2; 4, 20% O2; ., 50% O2; }, 100% O2 (right axis for N2O in 100% O2).

86

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

Table 3 Aerobic nitrate removal and maximal NO–N and N2O–N production during 12 h incubation under different carbon sources, pH values and C/N ratios.* Factors

*

OD600

NO 3 –N removal efficiency (%)

Maximal NO–N production (lg L1)

Maximal N2O–N production (mg L1)

Carbon source

Succinate Citrate Acetate Glucose Sucrose

0.82 1.01 0.77 0.47 0.24

(0.01) (0.01) (0.01) (0.02) (0.00)

a b c d e

100.00 (0.00) a 100.00 (0.00) a 100.00 (0.00) a 76.78 (2.93) b 10.94 (0.55) c

3.20 (0.28) a 3.07 (0.28) a 2.61 (0.37) a 85.46 (0.18) b 0.00 (0.00) c

0.29 2.63 0.22 3.35 0.04

(0.09) a (0.15) b (0.11) a (0.18) c (0.01) a

pH value

6 7 8 9 10

0.23 0.85 0.88 0.87 0.86

(0.00) (0.02) (0.01) (0.00) (0.00)

a b b b b

3.97 (0.95) a 99.20 (1.13) b 100.00 (0.00) b 100.00 (0.00) b 100.00 (0.00) b

0.59 8.17 6.01 4.51 4.44

(0.28) (0.65) (1.29) (0.28) (0.18)

a b bc c c

0.01 0.01 0.04 0.08 0.18

(0.00) (0.00) (0.01) (0.01) (0.05)

a a a a b

C/N ratio

2 4 6 10 15

0.77 0.93 0.91 0.88 0.85

(0.01) (0.02) (0.00) (0.01) (0.01)

a b bc cd d

88.67 (0.22) a 100.00 (0.00) b 100.00 (0.00) b 100.00 (0.00) b 100.00 (0.00) b

4.90 4.64 4.25 6.01 4.77

(0.09) (1.57) (0.09) (1.29) (1.20)

a a a a a

0.58 0.06 0.05 0.04 0.04

(0.04) (0.00) (0.00) (0.01) (0.00)

a b b b b

Numbers in bracket are standard deviations. Within one column (per factor), means marked with the same letter are not significantly different (Tukey test, P < 0.05).

107.83 mg L1 NH+4–N at 16 h (Fig. 5a). Finally, the recoveries of N atoms in N2 were 97.46%, 96.80%, 94.89%, 97.76% and 84.63% of consumed NO 3 –N, respectively at five O2 conditions (Fig. 5f). It was notable that the 100% O2 concentration was hardly met in real wastewater treatment, so there was no need to worry about the N2O emission under this extreme condition. Besides O2, the influence of carbon source, pH and C/N on aerobic denitrification of PCN-1 were also investigated (Table 3). Bacterial growth and aerobic denitrification of strain PCN-1 showed significant differences among the tested carbon sources (P < 0.05). Succinate, citrate, and acetate supported well bacterial growth and 100% nitrate removal, and succinate and acetate had no differences in NO and N2O production while citrate produced more N2O. When glucose was served as carbon source, bacterial growth and nitrate removal was poor and NO and N2O production was much higher, especially for NO, which was probably derived

from dismutation of HNO2 (Zweier et al., 1995). Herein, NO 2 –N was accumulated to 43.11 mg L1 and pH decreased to 6.5 after 12 h incubation because of bacterial metabolism of glucose. Sucrose was found not a good carbon source either for supporting bacterial growth or nitrogen removal. Hence, succinate and acetate were the best carbon sources for strain PCN-1 and acetate was employed in the following experiments. Strain PCN-1 could not grow and denitrify at acidic condition. At initial pH 7–10, strain PCN-1 showed no significant difference in bacterial growth and nitrate removal (P < 0.05). NO production was not much affected at pH 7–9 (P > 0.05), and more N2O would be produced at pH 10 than that at pH 7–9 probably due to inhibition of nosZ expression and N2O reductase. Therefore, neutral and slightly alkaline environment was favorable for strain PCN-1. At C/N 2, carbon source was insufficient for strain PCN-1 to complete denitrification, leading to much higher accumulation of

Fig. 6. TN removal enhancement and reduction of NO and N2O emission after inoculation of strain PCN-1 when ammonium (a, b and c) and nitrite (d, e, and f) was taken as main pollutant. Symbols: j, TN, NO–N and N2O–N in activated sludge only group; d, TN, NO–N and N2O–N in 15% inoculated group; N, TN, NO–N and N2O–N in 30%   inoculated group; h, NO 2 –N in activated sludge only group; s, NO2 –N in 15% inoculated group; 4, NO2 –N in 30% inoculated group.

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88 1 NO ) and N2O–N (0.58 mg L1). When C/N in2 –N (79.91 mg L creased to 4, nitrate and nitrite were completely converted with negligible accumulation of NO and N2O. Although optimal C/N ratio was reported 8 or 20 for other aerobic denitrifiers (Guo et al., 2013; Zhang et al., 2012), our experiments demonstrated further increase of C/N to 6–15 showed almost no difference (P > 0.05) for strain PCN-1, which implied lower C/N 4 would meet requirement of denitrification by strain PCN-1 in practical wastewater treatment.

3.6. Potential applications of strain PCN-1 Considering the excellent performance of its aerobic denitrification and low production of NO and N2O, strain PCN-1 was further applied to modify activated sludge system conventionally for domestic wastewater treatment. Taking ammonium as sole nitrogen source, the total nitrogen removal rate and efficiency were obviously enhanced (Fig. 6a). More importantly, NO 2 –N accumulation in the PCN-1 modified system was only about 5% of the activated sludge system before modification (Fig. 6a). Consequently, NO and N2O emission was significantly reduced in the inoculated group (P < 0.05; Fig. 6b and c). Inoculation amount might have greater influence on N2O than NO accumulation. As the incubation amount was increased from 15% to 30%, N2O accumulation was further decreased in the inoculated group (P < 0.05), while no apparent change was observed in NO accumulation and TN removal efficiency (P > 0.05). Although the conventional activated sludge system would continuously produce N2O, strain PCN-1 incorporated into the system would efficiently reduce the exogenous N2O to N2 (discussed in Section 3.3), which demonstrated a general synergetic system for practical applications. Considering the important role of nitrite in NO and N2O emission (Alinsafi et al., 2008; Wunderlin et al., 2012), high NO2 N (80 mg L1) was added in the systems mentioned above. As shown in Fig. 6d, nitrite removal showed a lag phase in activated sludge only group due to O2 inhibition, while the process commenced immediately and nitrite decreased quickly after strain PCN-1 was inoculated. Finally, the total nitrogen removal efficiency reached 97.65% and 96.65% respectively in 15% and 30% inoculation group, much higher than that of 68.60% in the group without inoculation. Correspondingly, NO and N2O emission after inoculation was also significantly reduced (P < 0.05; Fig. 6e and f). Overall, strain PCN-1 demonstrated great potential in practical applications owing to its excellent nitrogen performance and negligible NO and N2O emission in wastewater treatment.

4. Conclusions In this study, P. stutzeri PCN-1 capable of aerobic denitrification with low NO and N2O production was successfully isolated. The strain could utilize nitrate, nitrite and N2O as good denitrification substrate with average nitrogen removal rate of 11.66, 12.80 and 9.67 mg L1 h1 in synthetic wastewater, respectively. The coordinate expression of denitrification gene nirS, cnorB, and nosZ resulted in the low NO and N2O production. Significant TN removal enhancement and reduction of NO and N2O emission were simultaneously achieved in the activated sludge system bioaugmented by the present strain, suggesting a new alternative for practical wastewater treatment. Acknowledgements Financial support from National Natural Science Foundation of China (Grant No. 21261140336/B070302) is very much appreci-

87

ated. Support from Collaborative Innovation Center for Regional Environmental Quality is also acknowledged. References Alinsafi, A., Adouani, N., Beline, F., Lendormi, T., Limousy, L., Sire, O., 2008. Nitrite effect on nitrous oxide emission from denitrifying activated sludge. Process Biochem. 43, 683–689. Arts, P.A.M., Robertson, L.A., Kuenen, J.G., 1995. Nitrification and denitrification by Thiosphaera pantotropha in aerobic chemostat cultures. FEMS Microbiol. Ecol. 18, 305–316. Bergaust, L., Shapleigh, J., Frostegard, A., Bakken, L., 2008. Transcription and activities of NOx reductases in Agrobacterium tumefaciens: the influence of nitrate, nitrite and oxygen availability. Environ. Microbiol. 10, 3070–3081. Bouchez, T., Patureau, D., Delgenes, J.P., Moletta, R., 2009. Successful bacterial incorporation into activated sludge floc using alginate. Bioresour. Technol. 100, 1031–1032. Cabiscol, E., Tamarit, J., Ros, J., 2000. Oxidative stress in bacteria and protein damage by reactive oxygen species. Int. Microbiol. 3, 3–8. Chen, J.W., Strous, M., 2013. Denitrification and aerobic respiration, hybrid electron transport chains and co-evolution. Biochim. Biophys. Acta 1827, 136–144. Chen, Q., Ni, J.R., 2011. Heterotrophic nitrification–aerobic denitrification by novel isolated bacteria. J. Ind. Microbiol. Biotechnol. 38, 1305–1310. Chen, P.Z., Li, J., Li, Q.X., Wang, Y.C., Li, S.P., Ren, T.Z., Wang, L.G., 2012. Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24. Bioresour. Technol. 116, 266–270. Guo, L.Y., Chen, Q.K., Fang, F., Hu, Z.X., Wu, J., Miao, A.J., Xiao, L., Chen, X.F., Yang, L.Y., 2013. Application potential of a newly isolated indigenous aerobic denitrifier for nitrate and ammonium removal of eutrophic lake water. Bioresour. Technol. 142, 45–51. Han, S.Q., Bian, H., Feng, Y.C., Liu, A., Li, X.J., Zeng, F., Zhang, X.L., 2011. Analysis of the Relationship between O3, NO and NO2 in Tianjin, China. Aerosol Air Qual. Res. 11, 128–139. Hartig, E., Zumft, W.G., 1999. Kinetics of nirS expression (cytochrome cd1 nitrite reductase) in Pseudomonas stutzeri during the transition from aerobic respiration to denitrification: evidence for a denitrification-specific nitrateand nitrite-responsive regulatory system. J. Bacteriol. 181, 161–166. Huang, X.F., Li, W.G., Zhang, D.Y., Qin, W., 2013. Ammonium removal by a novel oligotrophic Acinetobacter sp. Y16 capable of heterotrophic nitrification–aerobic denitrification at low temperature. Bioresour. Technol. 146, 44–50. IPCC, 2006. 2006 IPCC Guidelines for National Greenhouse Gas Inventories. IGES, Japan. Kampschreur, M.J., Tan, N.C., Kleerebezem, R., Picioreanu, C., Jetten, M.S., Van Loosdrecht, M.C., 2008. Effect of dynamic process conditions on nitrogen oxides emission from a nitrifying culture. Environ. Sci. Technol. 42, 429–435. Kester, R.A., De Boer, W., Laanbroek, H.J., 1997. Production of NO and N2O by pure cultures of nitrifying and denitrifying bacteria during changes in aeration. Appl. Environ. Microbiol. 63, 3872–3877. Lu, H., Chandran, K., 2010. Factors promoting emissions of nitrous oxide and nitric oxide from denitrifying sequencing batch reactors operated with methanol and ethanol as electron donors. Biotechnol. Bioeng. 106, 390–398. Miyahara, M., Kim, S.W., Fushinobu, S., Takaki, K., Yamada, T., Watanabe, A., Miyauchi, K., Endo, G., 2010. Potential of aerobic denitrification by Pseudomonas stutzeri TR2 to reduce nitrous oxide emissions from wastewater treatment plants. Appl. Environ. Microbiol. 76, 4619–4625. Muyzer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695–700. Otte, S., Grobben, N.G., Robertson, L.A., Jetten, M.S., Kuenen, J.G., 1996. Nitrous oxide production by Alcaligenes faecalis under transient and dynamic aerobic and anaerobic conditions. Appl. Environ. Microbiol. 62, 2421–2426. Philippot, L., Mirleau, P., Mazurier, S., Siblot, S., Hartmann, A., Lemanceau, P., Germon, J.C., 2001. Characterization and transcriptional analysis of Pseudomonas fluorescens denitrifying clusters containing the nar, nir, nor and nos genes. Biochim. Biophys. Acta 1517, 436–440. Pomowski, A., Zumft, W.G., Kroneck, P.M.H., Einsle, O., 2011. N2O binding at a [4Cu:2S] copper–sulphur cluster in nitrous oxide reductase. Nature 477, 234– 237. Poole, R.K., Hughes, M.N., 2000. New functions for the ancient globin family: bacterial responses to nitric oxide and nitrosative stress. Mol. Microbiol. 36, 775–783. Robertson, L.A., Kuenen, J.G., 1984. Aerobic denitrification: a controversy revived. Arch. Microbiol. 139, 351–354. Saleh-Lakha, S., Shannon, K.E., Goyer, C., Trevors, J.T., Zebarth, B.J., Burton, D.L., 2008. Nitric oxide reductase gene expression and nitrous oxide production in nitrategrown Pseudomonas mandelii. Appl. Environ. Microbiol. 74, 6876–6879. Spiro, S., 2012. Nitrous oxide production and consumption: regulation of gene expression by gas-sensitive transcription factors. Phil. Trans. R. Soc. B 367, 1213–1225. Throback, I.N., Enwall, K., Jarvis, A., Hallin, S., 2004. Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. FEMS Microbiol. Ecol. 49, 401–417. Weiss, R.F., Price, B.A., 1984. Nitrous oxide solubility in water and seawater. Mar. Chem. 8, 347–359.

88

M. Zheng et al. / Bioresource Technology 162 (2014) 80–88

Wan, C.L., Yang, X., Lee, D.J., Du, M.A., Wan, F., Chen, C., 2011. Aerobic denitrification by novel isolated strain using NO 2 –N as nitrogen source. Bioresour. Technol. 102, 7244–7248. Weimann, J., 2003. Toxicity of nitrous oxide. Best Pract. Res. Clin. Anaesthesiol. 17, 47–61. Wunderlin, P., Mohn, J., Joss, A., Emmenegger, L., Siearist, H., 2012. Mechanisms of N2O production in biological wastewater treatment under nitrifying and denitrifying conditions. Water Res. 46, 1027–1037. Yang, X.P., Wang, S.M., Zhang, D.W., Zhou, L.X., 2011. Isolation and nitrogen removal characteristics of an aerobic heterotrophic nitrifying–denitrifying bacterium, Bacillus subtilis A1. Bioresour. Technol. 102, 854–862.

Yao, S., Ni, J.R., Ma, T., Li, C., 2013. Heterotrophic nitrification and aerobic denitrification at low temperature by a newly isolated bacterium, Acinetobacter sp. HA2. Bioresour. Technol. 139, 80–86. Zhang, Q.L., Liu, Y., Ai, G.M., Miao, L.L., Zheng, H.Y., Liu, Z.P., 2012. The characteristics of a novel heterotrophic nitrification-aerobic denitrification bacterium, Bacillus methylotrophicus strain L7. Bioresour. Technol. 108, 35–44. Zweier, J.L., Wang, P., Samouilov, A., Kuppusamy, P., 1995. Enzyme-independent formation of nitric oxide in biological tissues. Nat. Med. 1, 804–809. Zumft, W.G., 1997. Cell biology and molecular basis of denitrification. Microbiol. Mol. Biol. Rev. 61, 533–616.