- Email: [email protected]
Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity
Biochemical and Biophysical Research Communications 478 (2016) 825e830
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity Zhongliang Shen a, 1, Yanfeng Liu b, 1, Mengjun Luo a, Wei Wang a, Jing Liu a, Wei Liu a, Shaokun Pan c, **, Youhua Xie a, * a Key Laboratory of Medical Molecular Virology (Ministry of Health and Ministry of Education), Institutes of Biomedical Sciences, Shanghai Medical College, Fudan University, Shanghai 200031, China b Department of Surgery, Huashan Hospital, Fudan University, Shanghai 200040, China c Shanghai Keybiomed Technology Co., Ltd., Shanghai 201206, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2016 Accepted 4 August 2016 Available online 5 August 2016
Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt 85 to 11 in eBHBV1 Cp was critical for the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt 64 to 50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt 58 to 54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt 21 to 17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. © 2016 Elsevier Inc. All rights reserved.
Keywords: Avihepadnavirus Core promoter Endogenous budgerigar hepadnavirus NF-Y Orthohepadnavirus
1. Introduction Infection of germ cells by viruses may lead to the insertion of partial and (or) whole viral genomes into the host chromosomes [1,2]. The integrated viral DNA known as endogenous viral elements (EVEs) can be inherited by host progeny. A large number of EVEs were identified in animal genomes in recent years by in silico screening and reveal complex evolutionary interplay between viruses and their hosts [3e8]. Most EVEs are the remnants of ancient retroviruses as a result of proviral DNA integration. EVEs of non-
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (S. Pan), [email protected] (Y. Xie). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.bbrc.2016.08.032 0006-291X/© 2016 Elsevier Inc. All rights reserved.
retroviral origins have also been found [9]. We previously identified in the budgerigar (Meloposittacus undulatus) genome two EVEs that had been inserted for 2.5e5 million years and contain the fulllength genomic sequence of an ancient budgerigar hepadnavirus (eBHBV) [8]. eBHBV1 is about 3.9 kb and comprises an overlength (1.3 copy) genome of the ancient hepadnavirus, whereas eBHBV2 is about 3.1 kb and composed of a single copy of the genome. The fulllength eBHBVs can be considered as the fossil records of ancient hepadanaviruses and are invaluable for the study of the origin and evolution of hepadnaviruses. Hepadnaviridae is a family of small enveloped viruses with a compact (3e3.2 kb), partially double-stranded circular DNA genome [10]. Extant hepadnaviruses fall into two genera: avihepadnaviruses of birds and orthohepadnaviruses of mammals. Duck hepatitis B virus (DHBV) and human hepatitis B virus (HBV) are the prototypes of these two genera respectively. After infection of a hepatocyte, viral relax circular DNA (rcDNA) is transported into the
826
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
nucleus and converted to covalently closed circular DNA (cccDNA) that serves as the template for viral RNA transcription (0.7, 2.1, 2.4 and 3.5 kb RNAs). The 3.5 kb pregenomic RNA (pgRNA) whose transcription is driven by the core promoter (Cp) is translated to produce core protein and polymerase that are essential for nucleocapsid formation and DNA replication. The activity of Cp is regulated by viral proteins and cellular transcription factors (TFs) directly and indirectly. Multiple cis-elements for ubiquitous and liver-enriched TFs have been identified within Cp [11]. The availability of the complete Cp sequences in eBHBV1 and eBHBV2 provides a unique opportunity to investigate the regulation of Cp from an evolutionary point of view. Nuclear factor Y (NF-Y) is a heterotrimeric protein complex, consisting of three subunits (NF-YA, NF-YB and NF-YC). The NF-YB and NF-YC form a dimer to serve as a platform for NF-YA docking and the resulting trimer can then bind to DNA with high specificity. All subunits are required for DNA-binding while NF-YA determines the sequence specificity of NF-Y [12]. NF-Y is a major CCAATbinding TF that specifically recognizes a consensus sequence CTGATTGGYYRR in eukaryotic promoters and has a strong preference for specific flanking sequences in addition to the requirement of the core binding site ‘ATTGG’ [13,14]. Other CCAAT-binding proteins include the CCAAT/enhancer binding protein (C/EBP), CCAAT-binding transcription factor or nuclear factor I (CTF/NF-I), and C repeat binding factor (CBF). Of all the CCAAT-binding proteins, NF-Y is the most ubiquitously distributed and regulates the expression of many eukaryotic genes [13]. Whether NF-Y regulates the activity of Cp of hepadnaviruses has not been reported. In this study, we were surprised to find that both eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt 85 to 11 appeared important for eBHBV1 Cp activity. Within this region an NF-Y core binding site (ATTGG, nt 58 to 54) was critical for the activity of eBHBV1 Cp. The same sites in eBHBV2 Cp and DHBV Cp were also functionally important. This NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of the orthohepadnaviruses. On the other hand, a putative NF-Y core binding site is located at nt 21 to 17 in the Cps of HBV and woolly monkey hepatitis B virus (WMHBV). Furthermore, NF-Y was recruited to eBHBV1 Cp to upregulate the promoter activity. Thus we have identified an evolutionary conserved and functionally critical cis-element in the Cps of avihepadnaviruses. 2. Materials and methods 2.1. Plasmid constructs eBHBV1 Cp (nt 3505 to 4104), eBHBV2 Cp (nt 2545 to 3144), HBV Cp (nt 1643 to 1849) and DHBV Cp (nt 2172 to 2531) were amplified from eBHBV1 (JQ978775.1), eBHBV2 (JQ978781.1), pWT/HBV [15] and DHBV (K01834.1) respectively and inserted into pGL3-basic (Promega, China) to create peBHBV1-Cp, peBHBV2-Cp, pHBV-Cp and pDHBV-Cp reporter plasmids. Deletion mutants of eBHBV1 Cp were generated as shown in Fig. 2A. The first nucleotide of the preC/C open reading frame (ORF) was designated as the starting point and the immediate upstream nucleotide as 1. The putative NF-Y core binding site ‘ATTGG’ (nt 58/54 in eBHBV Cps and DHBV Cp, and nt 21/17 in HBV Cp) in peBHBV1-Cp, peBHBV2-Cp, pDHBV-Cp and pHBV-Cp were mutated to ‘AAAAA’, resulting in plasmids peBHBV1Cp-Ym, peBHBV2-Cp-Ym, pDHBV-Cp-Ym and pHBV-Cp-Ym respectively. All mutants were generated using KOD-Plus-Mutagenesis Kit (TOYOBO, Japan) according to the manufacturer's instructions. The Flag-tagged NF-YA expression plasmid was constructed on the pcDNA3.0 backbone (Invitrogen). For lentivirus mediated RNA interference of endogenous NF-YA expression, the DNA fragment
encoding the hairpin precursor targeting NF-YA (50 - ATCGTCTATCAACCAGTTA -30 ) was inserted into pLKO.1 (Addgene plasmid 10,879) to create siNF-YA. An irrelevant siRNA precursor with similar GC-content to siNF-YA was used to create siCtrl as a negative control. 2.2. Cell culture and DNA transfection Human embryonic kidney 293T (HEK293T), human hepatocellular carcinoma Huh7, chicken embryo fibroblast (CEF) and chicken hepatoma cell LMH cells were from the Cell Bank of Chinese Academy of Sciences at Shanghai and were cultured at 37 C and 5% CO2 in Dulbecco's modified Eagle medium (DMEM) (Invitrogen) containing 2 mM L-glutamine, 50 U/ml penicillin, and 10% fetal bovine serum (Invitrogen). DNA transfections were performed at 80%e90% cell confluence with TurboFect transfection reagent (Thermo Fisher) according to the manufacturer's instructions. 2.3. Dual luciferase assay Cells cultured in 24-well plate were transfected with 0.4 mg of a Cp reporter plasmid (expressing firefly luciferase) and 0.1 mg pRLTK (expressing renilla luciferase) (Promega, China) per well. At 48 h post-transfection, cells in each well were lysed in 100 ml lysis buffer (0.5% NP40, 1 mM EDTA, 50 mM NaCl, and 10 mM Tris-HCl [pH 7.9]) and luciferase activities were measured with Dual-Glo system (Promega, China) according to the manufacturer's instructions. 2.4. Transcription factor binding site prediction Transcription factor binding sites in the Cp sequences were analyzed online at http://www.genomatix.de/cgi-bin//eldorado/ main.pl. A cutoff of 90% matrix similarity was employed. 2.5. Chromatin immunoprecipitation and semi-quantitative PCR (ChIP-PCR) Chromatin immunoprecipitation (ChIP) was performed as previously described [16]. Anti-Flag (Sigma) or anti-NF-YA (Santa Cruz, sc-17753) was used to immunoprecipitate sonicated DNA from Huh7 cells and pre-immune IgG was used for specificity control. Five percent of each post-sonication sample was saved as the input control. DNA extracted from the precipitated sample was amplified with the primers for eBHBV1 Cp (forward/reverse: CTTGTGCGAACAATGCTTGAAG/AGTCGAAGTGGTACTTTTAAGG, amplicon spanning nt 150 to 1). 2.6. Western blot Proteins in cell lysate were subject to Western blot with anti-bactin (1:10,000, Sigma) or anti-NF-YA antibody (1:3000, Santa Cruz, sc-17753) as previously described [15,17]. 2.7. Statistical analysis Means and standard errors (SEM) from independently repeated experiments were plotted and subjected to student's t-test. Pvalue < 0.05 is considered statistically significant. 3. Results 3.1. eBHBV Cps are active in cells To assess the activity of eBHBV1 Cp and eBHBV2 Cp, Cp reporter plasmids were constructed and each was co-transfected with pRL-
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
TK into HEK293T, Huh7, CEF and LMH cells, respectively. Results of dual-luciferase reporter assays showed that both eBHBV1 Cp and eBHBV2 Cp were active in these cells (Fig. 1). eBHBV2 Cp displayed a higher activity than did eBHBV1 Cp in all the cell lines. 3.2. The region from nt 85 to 11 is important for eBHBV1 Cp activity To determine the region important for eBHBV1 Cp activity, several Cp deletion mutants were constructed and tested for the promoter activity in HEK293T, Huh7, CEF and LMH cells, respectively (Fig. 2A). All the mutants lost the promoter activity in Huh7 cells. Serial deletions from 385 to 86 did not abolish the promoter activity in HEK293T and CEF cells, but they gradually weakened it in LMH cells. Notably, the mutant bearing the deletion of nt 85 to 11 (eBHBV1 Cp_del-85/-11) lost at least 50% of the promoter activity in Huh7, HEK293T and CEF cells and 38% in LMH cells (Fig. 2B), suggesting that the region from nt 85 to 11 is generally required for eBHBV1 Cp activity in these cell lines.
827
regulate the activity of eBHBV1 Cp. A bioinformatic analysis of TF binding sites on this region, employing a cutoff of 90% matrix similarity, revealed 12 positive matches. NF-Y, predicted to bind to a putative site at nt 64 to 50 of eBHBV1 Cp, is ubiquitously distributed (Supplementary Table 1). We then mutated the core binding site of NF-Y (ATTGG, nt 58 to 54) in eBHBV1 Cp. The activity of the resulting NF-Y sitemutated eBHBV1-Cp (eBHBV1 Cp-Ym) was much lower than that of the wild type, down to a level comparable to that of eBHBV1 Cp_del-85/-11 (Fig. 3A). The putative NF-Y binding site exists at the same position (ATTGG, nt 58 to 54) in eBHBV2 Cp and DHBV Cp as well. Mutagenesis of these sites led to a significant reduction in the activity of eBHBV2 Cp and DHBV Cp, respectively (Fig. 3B and C). On the other hand, bioinformatic analysis revealed only one ATTGG site at nt 21 to 17 in HBV Cp. The activity of HBV Cp decreased dramatically when this site had been mutated (Fig. 3D). These results together indicate that the putative NF-Y binding sites are critical for eBHBV, DHBV and HBV Cp activities. 3.4. NF-Y directly regulates eBHBV1 Cp activity
3.3. The putative NF-Y binding site within nt 64 to 50 is critical for eBHBV and DHBV Cp activities The general requirement of the region from nt 85 to 11 for eBHBV1 Cp activity in cell lines of human and chicken origins implies that certain ubiquitous TFs might bind to this region and
To examine whether NF-Y regulates eBHBV1 Cp activity, the NFYA expression plasmid was co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid, and pRL-TK into Huh7 cells and dual-luciferase reporter assays were performed. As shown in Fig. 4A, NF-YA was able to significantly upregulate eBHBV1 Cp
Fig. 1. eBHBV core promoter is active in cells. eBHBV1 Cp or eBHBV2 Cp reporter plasmid was co-transfected with pRL-TK into HEK293T (A), Huh7 (B), CEF (C) and LMH cells (D), respectively. At 48 h post-transfection, the cells were lysed and subjected to dual-luciferase reporter assay. Means and SEMs of relative luciferase activity data are plotted with the means of eBHBV1 Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
828
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
Fig. 2. The region from nt ¡85 to ¡11 is important for eBHBV1 Cp activity. (A). Schematic representation of eBHBV1 Cp deletion mutants. Internal deletions are depicted with dashed lines. The first nucleotide of the preC/C ORF is marked as 1 and the immediate upstream nucleotide as 1. (B). Each deletion mutant was co-transfected with pRL-TK into indicated cells. At 48 h posttransfection post-transfection, the cells were lysed and subjected to dual-luciferase reporter assay. Means and SEMs of relative luciferase activity data are plotted with the means of eBHBV1 Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
activity, but had no effect on eBHBV1 Cp-Ym activity, suggesting that NF-YA is recruited to the NF-Y binding site in eBHBV1 Cp to regulate the Cp activity. To test this hypothesis, eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid was co-transfected with the NFYA expression plasmid and ChIP-PCR assay was performed. The results showed that the level of NF-YA enrichment was markedly higher on eBHBV1 Cp than eBHBV1 Cp-Ym (Fig. 4B), indicating that NF-YA is indeed recruited to the NF-Y binding site in eBHBV1 Cp. Furthermore, to examine the role of endogenous NF-YA in the regulation of eBHBV1 Cp activity, an expression plasmid of NF-YA silencing shRNA (siNF-YA) or irrelevant shRNA (siCtrl) was cotransfected with eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid, and pRL-TK into Huh7 cells. The protein level of endogenous NF-YA was markedly reduced only in siNF-YA co-transfected cells (Fig. 4C, top). The results of dual-luciferase reporter assay showed that eBHBV1 Cp activity lost about 50% in siNF-YA co-transfected cells
compared to siCtrl co-transfected cells. In contrast, the activity of eBHBV1 Cp-Ym, which was about 20% of eBHBV1 Cp, was not affected by co-transfection of siNF-YA or siCtrl (Fig. 4C, bottom). Finally, ChIP-PCR results showed that endogenous NF-YA was enriched on eBHBV1 Cp but not on eBHBV1 Cp-Ym (Fig. 4D). These results suggest that endogenous NF-Y upregulates eBHBV1 Cp activity by binding to the NF-Y binding site. 3.5. The NF-Y binding site is conserved in the core promoters of avihepadnaviruses Sequence alignments demonstrated that all the other extant avihepadnaviruses, including the viruses of heron (HHBV), Ross's goose (RGHBV), snow goose (SGHBV), stork (STHBV), crane (CCHBV), ashy-headed sheldgoose (AGHBV) and parrot (PHBV), contain an NF-Y binding site at nt 64 to 50 in their Cps, of which
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
829
Fig. 3. The putative NF-Y site within nt ¡64 to ¡50 is critical for eBHBV and DHBV Cp activities. (AeC). The activity of Cp with the mutated NF-Y site (Cp-Ym, ATTGG to AAAAA, nt 58 to 54) was assessed in different cell lines and compared to that of the wild type Cp. (A) eBHBV1 Cp-Ym. The deletion mutant (eCp-del-85/-11) was tested alongside in comparison. (B). eBHBV2 Cp-Ym. (C). DHBV Cp-Ym. (D). The activity of HBV Cpm, in which the region from nt 21 to 17 was mutated (ATTGG to AAAAA), was examined in different cell lines. Means and SEMs of relative luciferase activity data are plotted with the means of the wild type Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
Fig. 4. NF-YA directly regulates eBHBV1 Cp activity. (A). Exogenous NF-YA upregulated eBHBV1 Cp activity. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV Cp-Ym (ATTGG to AAAAA, nt 58 to 54), the NF-YA expression plasmid or the pcDNA3.0-Flag vector, and pRL-TK. Means and SEMs of relative luciferase activity data are plotted. The means of the promoter activity from the cells co-transfected with eBHBV1 Cp and the vector was taken as 100%. (B). Exogenous NF-YA was recruited to eBHBV1 Cp. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym and the NF-YA expression plasmid. ChIP-PCR was performed with sonicated DNA immunoprecipitated by anti-Flag or preimmune IgG (control) with the primers amplifying the region from nt 150 to 1. (C). Endogenous NF-YA upregulated eBHBV1 Cp activity. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV Cp-Ym, siNF-YA or siCtrl (control), and pRL-TK. Endogenous NF-YA protein was detected with Western blot (top). Means and SEMs of relative luciferase activity data are plotted. The means of the promoter activity from the cells co-transfected with eBHBV1 Cp and the vector was taken as 100%. (D). Endogenous NF-YA was recruited to eBHBV1 Cp. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym and siNF-YA or siCtrl. ChIP-PCR was performed with sonicated DNA immunoprecipitated by anti-NFYA or pre-immune IgG (control) with the primers amplifying the region from nt 150 to 1. **, p < 0.01; ***, p < 0.001; ns, not significant.
830
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
the core binding site ATTGG is located at nt 58 to 54, like eBHBVs and DHBV (Supplementary Fig. 1A). The Cp sequences of different HBV genotypes (A-H) and nonhuman orthohepadnaviruses of woolly monkey (WMHBV), woodchuck (WHV), ground squirrel (GSHV) and Arctic squirrel (ASHV) were also analyzed. Unlike avihepadnaviruses, a single ATTGG site is located at nt 21 to 17 in HBV Cp, which is conserved in the Cps of all HBV genotypes (A-H) and WMHBV (Supplementary Fig. 1B). No ATTGG site was found in the Cps of WHV, GSHV, and ASHV (data not shown). 4. Discussion Most EVEs are unable to produce endogenous viral proteins due to the accumulation of nonsense mutations in ORFs and (or) mutations in promoters [4,5,18]. We report here that eBHBV1 Cp and eBHBV2 Cp are active in several human and chicken cell lines (Fig. 1). This observation together with the fact that there are no nonsense mutations in eBHBV1 core ORF suggests that eBHBV1 has the potential to produce an intact ‘core’ protein [8]. Indeed, we have observed eBHBV transcripts in the liver tissues of budgerigar with Northern blot (data not shown). However, it is unclear whether the expression of any of the transcripts is driven by eBHBV1 Cp because the pattern of the eBHBV transcripts is quite different from that of HBV or DHBV, probably owing to eBHBV insertions in the chromosomes. Sequence analysis of these transcripts needs to be carried out. The region from nt 85 to 11 is essential for eBHBV1 Cp activity (Fig. 2). An NF-Y core binding site is located at nt 58 to 54 (Supplementary Table 1) and is critical for eBHBV1 Cp activity (Fig. 3A). The same sites in eBHBV2 Cp and DHBV Cp are also functionally important (Fig. 3B and C) and highly conserved in the Cps of extant avihepadnaviruses (Supplementary Fig. 1A). The results are in agreement with the phylogenetic and molecular dating analyses that indicate a common ancestor shared by eBHBVs and extant avihepadnaviruses [8]. This NF-Y core binding site (ATTGG at nt 58 to 54) is thus a specific molecular characteristic for avihepadnaviruses. We performed experiments using human NF-YA expression plasmid in Huh7 cells that support HBV and DHBV replication and gene expression [19]. NF-Y is evolutionary conserved [12] and composed of three subunits, NF-YA, NF-YB and NF-YC. Our data demonstrate that both exogenous and endogenous NF-YA could upregulate eBHBV1 Cp activity, most likely by directly binding to the NF-Y binding site in Cp (Fig. 4). The NF-Y core binding site at nt 58 to 54 in avihepadnaviral Cps is not present in orthohepadnavirus Cps (Supplementary Fig. 1B). Nevertheless, an ‘ATTGG’ motif is located at nt 21 to 17 in HBV Cp and WMHBV Cp. Previous reports have shown several cis-elements in HBV Cp interact with Sp1, chicken ovalbumin upstream promoter transcription factor (COUP-TF1), hepatocyte nuclear factor 3 (HNF-3), HNF-4, peroxisome proliferator activated receptor a (PPARa), TATA binding protein (TBP) and CCAAT/enhancer binding protein (C/EBP) [20e22]. Bioinformatic analysis has failed to pick up any TFs that might recognize the ‘ATTGG’ motif at nt 21 to 17 in HBV Cp, due to the flanking sequences to ‘ATTGG’ are not preferred by known CCAAT-binding transcription factors. Nevertheless, this motif is functionally essential for HBV Cp activity (Fig. 3D). The fact that it is only present in the Cps of HBV and WMHBV, but not in the Cps of WHV, GSHV and ASHV (Fig. 4B), suggests that it occurs later in the evolution of orthohepadnaviruses [8]. The nature of the factor that interacts with this motif and its contribution to the regulation of HBV Cp activity warrants further study. In conclusion, although the eBHBVs had been inserted in the budgerigar genome for 2.5e5 million years [8], we found the Cps of
eBHBV1 and eBHBV2 still active in cells and have identified an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. Acknowledgement This work was supported by National Key Project for Infectious Diseases (2012ZX10002-006, 2012ZX10004-503, 2012ZX10002012003), National Basic Research Program (2012CB519002), and Natural Science Foundation of China (31071143, 81472226, 81461130019, 81572832). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.08.032. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2016.08.032. References [1] M.R. Patel, M. Emerman, H.S. Malik, Paleovirology e ghosts and gifts of viruses past, Curr. Opin. Virol. 1 (2011) 304e309. [2] M. Emerman, H.S. Malik, Paleovirologyemodern consequences of ancient viruses, PLoS Biol. 8 (2010) e1000301. [3] R.J. Gifford, A. Katzourakis, M. Tristem, et al., A transitional endogenous lentivirus from the genome of a basal primate and implications for lentivirus evolution, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 20362e20367. [4] A. Katzourakis, M. Tristem, O.G. Pybus, et al., Discovery and analysis of the first endogenous lentivirus, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 6261e6265. [5] J. Cui, E.C. Holmes, Endogenous lentiviruses in the ferret genome, J. Virol. 86 (2012) 3383e3385. [6] C. Gilbert, D.G. Maxfield, S.M. Goodman, et al., Parallel germline infiltration of a lentivirus in two Malagasy lemurs, PLoS Genet. 5 (2009) e1000425. [7] W. van der Loo, J. Abrantes, P.J. Esteves, Sharing of endogenous lentiviral gene fragments among leporid lineages separated for more than 12 million years, J. Virol. 83 (2009) 2386e2388. [8] W. Liu, S. Pan, H. Yang, et al., The first full-length endogenous hepadnaviruses: identification and analysis, J. Virol. 86 (2012) 9510e9513. [9] A. Katzourakis, R.J. Gifford, Endogenous viral elements in animal genomes, PLoS Genet. 6 (2010) e1001191. [10] C. Seeger, W.S. Mason, Hepatitis B virus biology, Microbiol. Mol. Biol. Rev. 64 (2000) 51e68. [11] N. Moolla, M. Kew, P. Arbuthnot, Regulatory elements of hepatitis B virus transcription, J. Viral Hepat. 9 (2002) 323e331. [12] R. Mantovani, The molecular biology of the CCAAT-binding factor NF-Y, Gene 239 (1999) 15e27. [13] T. Laloum, S. De Mita, P. Gamas, et al., CCAAT-box binding transcription factors in plants: Y so many? Trends Plant Sci. 18 (2013) 157e166. [14] K. Matuoka, C.K. Yu, Nuclear factor Y (NF-Y) and cellular senescence, Exp. Cell Res. 253 (1999) 365e371. [15] R. Hong, W. Bai, J. Zhai, et al., Novel recombinant hepatitis B virus vectors efficiently deliver protein and RNA encoding genes into primary hepatocytes, J. Virol. 87 (2013) 6615e6624. [16] Y. Liu, X. Ye, J.B. Zhang, et al., PROX1 promotes hepatocellular carcinoma proliferation and sorafenib resistance by enhancing beta-catenin expression and nuclear translocation, Oncogene 34 (2015) 5524e5535. [17] X. Zhao, Y. Wu, J. Duan, et al., Quantitative proteomic analysis of exosome protein content changes induced by hepatitis B virus in Huh-7 cells using SILAC labeling and LC-MS/MS, J. Proteome Res. 13 (2014) 5391e5402. [18] C. Gilbert, D.G. Maxfield, S.M. Goodman, et al., Parallel germline infiltration of a lentivirus in two Malagasy lemurs, PLoS Genet. 5 (2009) e1000425. [19] J. Kock, C. Rosler, J.J. Zhang, et al., Generation of covalently closed circular DNA of hepatitis B viruses via intracellular recycling is regulated in a virus specific manner, PLoS Pathog. 6 (2010) e1001082. [20] X. Yu, J.E. Mertz, Distinct modes of regulation of transcription of hepatitis B virus by the nuclear receptors HNF4alpha and COUP-TF1, J. Virol. 77 (2003) 2489e2499. [21] X. Yu, J.E. Mertz, Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated, J. Virol. 70 (1996) 8719e8726. [22] J. Li, J.H. Ou, Differential regulation of hepatitis B virus gene expression by the Sp1 transcription factor, J. Virol. 75 (2001) 8400e8406.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity Zhongliang Shen a, 1, Yanfeng Liu b, 1, Mengjun Luo a, Wei Wang a, Jing Liu a, Wei Liu a, Shaokun Pan c, **, Youhua Xie a, * a Key Laboratory of Medical Molecular Virology (Ministry of Health and Ministry of Education), Institutes of Biomedical Sciences, Shanghai Medical College, Fudan University, Shanghai 200031, China b Department of Surgery, Huashan Hospital, Fudan University, Shanghai 200040, China c Shanghai Keybiomed Technology Co., Ltd., Shanghai 201206, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2016 Accepted 4 August 2016 Available online 5 August 2016
Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt 85 to 11 in eBHBV1 Cp was critical for the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt 64 to 50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt 58 to 54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt 21 to 17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. © 2016 Elsevier Inc. All rights reserved.
Keywords: Avihepadnavirus Core promoter Endogenous budgerigar hepadnavirus NF-Y Orthohepadnavirus
1. Introduction Infection of germ cells by viruses may lead to the insertion of partial and (or) whole viral genomes into the host chromosomes [1,2]. The integrated viral DNA known as endogenous viral elements (EVEs) can be inherited by host progeny. A large number of EVEs were identified in animal genomes in recent years by in silico screening and reveal complex evolutionary interplay between viruses and their hosts [3e8]. Most EVEs are the remnants of ancient retroviruses as a result of proviral DNA integration. EVEs of non-
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (S. Pan), [email protected] (Y. Xie). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.bbrc.2016.08.032 0006-291X/© 2016 Elsevier Inc. All rights reserved.
retroviral origins have also been found [9]. We previously identified in the budgerigar (Meloposittacus undulatus) genome two EVEs that had been inserted for 2.5e5 million years and contain the fulllength genomic sequence of an ancient budgerigar hepadnavirus (eBHBV) [8]. eBHBV1 is about 3.9 kb and comprises an overlength (1.3 copy) genome of the ancient hepadnavirus, whereas eBHBV2 is about 3.1 kb and composed of a single copy of the genome. The fulllength eBHBVs can be considered as the fossil records of ancient hepadanaviruses and are invaluable for the study of the origin and evolution of hepadnaviruses. Hepadnaviridae is a family of small enveloped viruses with a compact (3e3.2 kb), partially double-stranded circular DNA genome [10]. Extant hepadnaviruses fall into two genera: avihepadnaviruses of birds and orthohepadnaviruses of mammals. Duck hepatitis B virus (DHBV) and human hepatitis B virus (HBV) are the prototypes of these two genera respectively. After infection of a hepatocyte, viral relax circular DNA (rcDNA) is transported into the
826
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
nucleus and converted to covalently closed circular DNA (cccDNA) that serves as the template for viral RNA transcription (0.7, 2.1, 2.4 and 3.5 kb RNAs). The 3.5 kb pregenomic RNA (pgRNA) whose transcription is driven by the core promoter (Cp) is translated to produce core protein and polymerase that are essential for nucleocapsid formation and DNA replication. The activity of Cp is regulated by viral proteins and cellular transcription factors (TFs) directly and indirectly. Multiple cis-elements for ubiquitous and liver-enriched TFs have been identified within Cp [11]. The availability of the complete Cp sequences in eBHBV1 and eBHBV2 provides a unique opportunity to investigate the regulation of Cp from an evolutionary point of view. Nuclear factor Y (NF-Y) is a heterotrimeric protein complex, consisting of three subunits (NF-YA, NF-YB and NF-YC). The NF-YB and NF-YC form a dimer to serve as a platform for NF-YA docking and the resulting trimer can then bind to DNA with high specificity. All subunits are required for DNA-binding while NF-YA determines the sequence specificity of NF-Y [12]. NF-Y is a major CCAATbinding TF that specifically recognizes a consensus sequence CTGATTGGYYRR in eukaryotic promoters and has a strong preference for specific flanking sequences in addition to the requirement of the core binding site ‘ATTGG’ [13,14]. Other CCAAT-binding proteins include the CCAAT/enhancer binding protein (C/EBP), CCAAT-binding transcription factor or nuclear factor I (CTF/NF-I), and C repeat binding factor (CBF). Of all the CCAAT-binding proteins, NF-Y is the most ubiquitously distributed and regulates the expression of many eukaryotic genes [13]. Whether NF-Y regulates the activity of Cp of hepadnaviruses has not been reported. In this study, we were surprised to find that both eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt 85 to 11 appeared important for eBHBV1 Cp activity. Within this region an NF-Y core binding site (ATTGG, nt 58 to 54) was critical for the activity of eBHBV1 Cp. The same sites in eBHBV2 Cp and DHBV Cp were also functionally important. This NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of the orthohepadnaviruses. On the other hand, a putative NF-Y core binding site is located at nt 21 to 17 in the Cps of HBV and woolly monkey hepatitis B virus (WMHBV). Furthermore, NF-Y was recruited to eBHBV1 Cp to upregulate the promoter activity. Thus we have identified an evolutionary conserved and functionally critical cis-element in the Cps of avihepadnaviruses. 2. Materials and methods 2.1. Plasmid constructs eBHBV1 Cp (nt 3505 to 4104), eBHBV2 Cp (nt 2545 to 3144), HBV Cp (nt 1643 to 1849) and DHBV Cp (nt 2172 to 2531) were amplified from eBHBV1 (JQ978775.1), eBHBV2 (JQ978781.1), pWT/HBV [15] and DHBV (K01834.1) respectively and inserted into pGL3-basic (Promega, China) to create peBHBV1-Cp, peBHBV2-Cp, pHBV-Cp and pDHBV-Cp reporter plasmids. Deletion mutants of eBHBV1 Cp were generated as shown in Fig. 2A. The first nucleotide of the preC/C open reading frame (ORF) was designated as the starting point and the immediate upstream nucleotide as 1. The putative NF-Y core binding site ‘ATTGG’ (nt 58/54 in eBHBV Cps and DHBV Cp, and nt 21/17 in HBV Cp) in peBHBV1-Cp, peBHBV2-Cp, pDHBV-Cp and pHBV-Cp were mutated to ‘AAAAA’, resulting in plasmids peBHBV1Cp-Ym, peBHBV2-Cp-Ym, pDHBV-Cp-Ym and pHBV-Cp-Ym respectively. All mutants were generated using KOD-Plus-Mutagenesis Kit (TOYOBO, Japan) according to the manufacturer's instructions. The Flag-tagged NF-YA expression plasmid was constructed on the pcDNA3.0 backbone (Invitrogen). For lentivirus mediated RNA interference of endogenous NF-YA expression, the DNA fragment
encoding the hairpin precursor targeting NF-YA (50 - ATCGTCTATCAACCAGTTA -30 ) was inserted into pLKO.1 (Addgene plasmid 10,879) to create siNF-YA. An irrelevant siRNA precursor with similar GC-content to siNF-YA was used to create siCtrl as a negative control. 2.2. Cell culture and DNA transfection Human embryonic kidney 293T (HEK293T), human hepatocellular carcinoma Huh7, chicken embryo fibroblast (CEF) and chicken hepatoma cell LMH cells were from the Cell Bank of Chinese Academy of Sciences at Shanghai and were cultured at 37 C and 5% CO2 in Dulbecco's modified Eagle medium (DMEM) (Invitrogen) containing 2 mM L-glutamine, 50 U/ml penicillin, and 10% fetal bovine serum (Invitrogen). DNA transfections were performed at 80%e90% cell confluence with TurboFect transfection reagent (Thermo Fisher) according to the manufacturer's instructions. 2.3. Dual luciferase assay Cells cultured in 24-well plate were transfected with 0.4 mg of a Cp reporter plasmid (expressing firefly luciferase) and 0.1 mg pRLTK (expressing renilla luciferase) (Promega, China) per well. At 48 h post-transfection, cells in each well were lysed in 100 ml lysis buffer (0.5% NP40, 1 mM EDTA, 50 mM NaCl, and 10 mM Tris-HCl [pH 7.9]) and luciferase activities were measured with Dual-Glo system (Promega, China) according to the manufacturer's instructions. 2.4. Transcription factor binding site prediction Transcription factor binding sites in the Cp sequences were analyzed online at http://www.genomatix.de/cgi-bin//eldorado/ main.pl. A cutoff of 90% matrix similarity was employed. 2.5. Chromatin immunoprecipitation and semi-quantitative PCR (ChIP-PCR) Chromatin immunoprecipitation (ChIP) was performed as previously described [16]. Anti-Flag (Sigma) or anti-NF-YA (Santa Cruz, sc-17753) was used to immunoprecipitate sonicated DNA from Huh7 cells and pre-immune IgG was used for specificity control. Five percent of each post-sonication sample was saved as the input control. DNA extracted from the precipitated sample was amplified with the primers for eBHBV1 Cp (forward/reverse: CTTGTGCGAACAATGCTTGAAG/AGTCGAAGTGGTACTTTTAAGG, amplicon spanning nt 150 to 1). 2.6. Western blot Proteins in cell lysate were subject to Western blot with anti-bactin (1:10,000, Sigma) or anti-NF-YA antibody (1:3000, Santa Cruz, sc-17753) as previously described [15,17]. 2.7. Statistical analysis Means and standard errors (SEM) from independently repeated experiments were plotted and subjected to student's t-test. Pvalue < 0.05 is considered statistically significant. 3. Results 3.1. eBHBV Cps are active in cells To assess the activity of eBHBV1 Cp and eBHBV2 Cp, Cp reporter plasmids were constructed and each was co-transfected with pRL-
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
TK into HEK293T, Huh7, CEF and LMH cells, respectively. Results of dual-luciferase reporter assays showed that both eBHBV1 Cp and eBHBV2 Cp were active in these cells (Fig. 1). eBHBV2 Cp displayed a higher activity than did eBHBV1 Cp in all the cell lines. 3.2. The region from nt 85 to 11 is important for eBHBV1 Cp activity To determine the region important for eBHBV1 Cp activity, several Cp deletion mutants were constructed and tested for the promoter activity in HEK293T, Huh7, CEF and LMH cells, respectively (Fig. 2A). All the mutants lost the promoter activity in Huh7 cells. Serial deletions from 385 to 86 did not abolish the promoter activity in HEK293T and CEF cells, but they gradually weakened it in LMH cells. Notably, the mutant bearing the deletion of nt 85 to 11 (eBHBV1 Cp_del-85/-11) lost at least 50% of the promoter activity in Huh7, HEK293T and CEF cells and 38% in LMH cells (Fig. 2B), suggesting that the region from nt 85 to 11 is generally required for eBHBV1 Cp activity in these cell lines.
827
regulate the activity of eBHBV1 Cp. A bioinformatic analysis of TF binding sites on this region, employing a cutoff of 90% matrix similarity, revealed 12 positive matches. NF-Y, predicted to bind to a putative site at nt 64 to 50 of eBHBV1 Cp, is ubiquitously distributed (Supplementary Table 1). We then mutated the core binding site of NF-Y (ATTGG, nt 58 to 54) in eBHBV1 Cp. The activity of the resulting NF-Y sitemutated eBHBV1-Cp (eBHBV1 Cp-Ym) was much lower than that of the wild type, down to a level comparable to that of eBHBV1 Cp_del-85/-11 (Fig. 3A). The putative NF-Y binding site exists at the same position (ATTGG, nt 58 to 54) in eBHBV2 Cp and DHBV Cp as well. Mutagenesis of these sites led to a significant reduction in the activity of eBHBV2 Cp and DHBV Cp, respectively (Fig. 3B and C). On the other hand, bioinformatic analysis revealed only one ATTGG site at nt 21 to 17 in HBV Cp. The activity of HBV Cp decreased dramatically when this site had been mutated (Fig. 3D). These results together indicate that the putative NF-Y binding sites are critical for eBHBV, DHBV and HBV Cp activities. 3.4. NF-Y directly regulates eBHBV1 Cp activity
3.3. The putative NF-Y binding site within nt 64 to 50 is critical for eBHBV and DHBV Cp activities The general requirement of the region from nt 85 to 11 for eBHBV1 Cp activity in cell lines of human and chicken origins implies that certain ubiquitous TFs might bind to this region and
To examine whether NF-Y regulates eBHBV1 Cp activity, the NFYA expression plasmid was co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid, and pRL-TK into Huh7 cells and dual-luciferase reporter assays were performed. As shown in Fig. 4A, NF-YA was able to significantly upregulate eBHBV1 Cp
Fig. 1. eBHBV core promoter is active in cells. eBHBV1 Cp or eBHBV2 Cp reporter plasmid was co-transfected with pRL-TK into HEK293T (A), Huh7 (B), CEF (C) and LMH cells (D), respectively. At 48 h post-transfection, the cells were lysed and subjected to dual-luciferase reporter assay. Means and SEMs of relative luciferase activity data are plotted with the means of eBHBV1 Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
828
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
Fig. 2. The region from nt ¡85 to ¡11 is important for eBHBV1 Cp activity. (A). Schematic representation of eBHBV1 Cp deletion mutants. Internal deletions are depicted with dashed lines. The first nucleotide of the preC/C ORF is marked as 1 and the immediate upstream nucleotide as 1. (B). Each deletion mutant was co-transfected with pRL-TK into indicated cells. At 48 h posttransfection post-transfection, the cells were lysed and subjected to dual-luciferase reporter assay. Means and SEMs of relative luciferase activity data are plotted with the means of eBHBV1 Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
activity, but had no effect on eBHBV1 Cp-Ym activity, suggesting that NF-YA is recruited to the NF-Y binding site in eBHBV1 Cp to regulate the Cp activity. To test this hypothesis, eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid was co-transfected with the NFYA expression plasmid and ChIP-PCR assay was performed. The results showed that the level of NF-YA enrichment was markedly higher on eBHBV1 Cp than eBHBV1 Cp-Ym (Fig. 4B), indicating that NF-YA is indeed recruited to the NF-Y binding site in eBHBV1 Cp. Furthermore, to examine the role of endogenous NF-YA in the regulation of eBHBV1 Cp activity, an expression plasmid of NF-YA silencing shRNA (siNF-YA) or irrelevant shRNA (siCtrl) was cotransfected with eBHBV1 Cp or eBHBV1 Cp-Ym reporter plasmid, and pRL-TK into Huh7 cells. The protein level of endogenous NF-YA was markedly reduced only in siNF-YA co-transfected cells (Fig. 4C, top). The results of dual-luciferase reporter assay showed that eBHBV1 Cp activity lost about 50% in siNF-YA co-transfected cells
compared to siCtrl co-transfected cells. In contrast, the activity of eBHBV1 Cp-Ym, which was about 20% of eBHBV1 Cp, was not affected by co-transfection of siNF-YA or siCtrl (Fig. 4C, bottom). Finally, ChIP-PCR results showed that endogenous NF-YA was enriched on eBHBV1 Cp but not on eBHBV1 Cp-Ym (Fig. 4D). These results suggest that endogenous NF-Y upregulates eBHBV1 Cp activity by binding to the NF-Y binding site. 3.5. The NF-Y binding site is conserved in the core promoters of avihepadnaviruses Sequence alignments demonstrated that all the other extant avihepadnaviruses, including the viruses of heron (HHBV), Ross's goose (RGHBV), snow goose (SGHBV), stork (STHBV), crane (CCHBV), ashy-headed sheldgoose (AGHBV) and parrot (PHBV), contain an NF-Y binding site at nt 64 to 50 in their Cps, of which
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
829
Fig. 3. The putative NF-Y site within nt ¡64 to ¡50 is critical for eBHBV and DHBV Cp activities. (AeC). The activity of Cp with the mutated NF-Y site (Cp-Ym, ATTGG to AAAAA, nt 58 to 54) was assessed in different cell lines and compared to that of the wild type Cp. (A) eBHBV1 Cp-Ym. The deletion mutant (eCp-del-85/-11) was tested alongside in comparison. (B). eBHBV2 Cp-Ym. (C). DHBV Cp-Ym. (D). The activity of HBV Cpm, in which the region from nt 21 to 17 was mutated (ATTGG to AAAAA), was examined in different cell lines. Means and SEMs of relative luciferase activity data are plotted with the means of the wild type Cp measurements taken as 100%. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
Fig. 4. NF-YA directly regulates eBHBV1 Cp activity. (A). Exogenous NF-YA upregulated eBHBV1 Cp activity. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV Cp-Ym (ATTGG to AAAAA, nt 58 to 54), the NF-YA expression plasmid or the pcDNA3.0-Flag vector, and pRL-TK. Means and SEMs of relative luciferase activity data are plotted. The means of the promoter activity from the cells co-transfected with eBHBV1 Cp and the vector was taken as 100%. (B). Exogenous NF-YA was recruited to eBHBV1 Cp. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym and the NF-YA expression plasmid. ChIP-PCR was performed with sonicated DNA immunoprecipitated by anti-Flag or preimmune IgG (control) with the primers amplifying the region from nt 150 to 1. (C). Endogenous NF-YA upregulated eBHBV1 Cp activity. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV Cp-Ym, siNF-YA or siCtrl (control), and pRL-TK. Endogenous NF-YA protein was detected with Western blot (top). Means and SEMs of relative luciferase activity data are plotted. The means of the promoter activity from the cells co-transfected with eBHBV1 Cp and the vector was taken as 100%. (D). Endogenous NF-YA was recruited to eBHBV1 Cp. Huh7 cells were co-transfected with eBHBV1 Cp or eBHBV1 Cp-Ym and siNF-YA or siCtrl. ChIP-PCR was performed with sonicated DNA immunoprecipitated by anti-NFYA or pre-immune IgG (control) with the primers amplifying the region from nt 150 to 1. **, p < 0.01; ***, p < 0.001; ns, not significant.
830
Z. Shen et al. / Biochemical and Biophysical Research Communications 478 (2016) 825e830
the core binding site ATTGG is located at nt 58 to 54, like eBHBVs and DHBV (Supplementary Fig. 1A). The Cp sequences of different HBV genotypes (A-H) and nonhuman orthohepadnaviruses of woolly monkey (WMHBV), woodchuck (WHV), ground squirrel (GSHV) and Arctic squirrel (ASHV) were also analyzed. Unlike avihepadnaviruses, a single ATTGG site is located at nt 21 to 17 in HBV Cp, which is conserved in the Cps of all HBV genotypes (A-H) and WMHBV (Supplementary Fig. 1B). No ATTGG site was found in the Cps of WHV, GSHV, and ASHV (data not shown). 4. Discussion Most EVEs are unable to produce endogenous viral proteins due to the accumulation of nonsense mutations in ORFs and (or) mutations in promoters [4,5,18]. We report here that eBHBV1 Cp and eBHBV2 Cp are active in several human and chicken cell lines (Fig. 1). This observation together with the fact that there are no nonsense mutations in eBHBV1 core ORF suggests that eBHBV1 has the potential to produce an intact ‘core’ protein [8]. Indeed, we have observed eBHBV transcripts in the liver tissues of budgerigar with Northern blot (data not shown). However, it is unclear whether the expression of any of the transcripts is driven by eBHBV1 Cp because the pattern of the eBHBV transcripts is quite different from that of HBV or DHBV, probably owing to eBHBV insertions in the chromosomes. Sequence analysis of these transcripts needs to be carried out. The region from nt 85 to 11 is essential for eBHBV1 Cp activity (Fig. 2). An NF-Y core binding site is located at nt 58 to 54 (Supplementary Table 1) and is critical for eBHBV1 Cp activity (Fig. 3A). The same sites in eBHBV2 Cp and DHBV Cp are also functionally important (Fig. 3B and C) and highly conserved in the Cps of extant avihepadnaviruses (Supplementary Fig. 1A). The results are in agreement with the phylogenetic and molecular dating analyses that indicate a common ancestor shared by eBHBVs and extant avihepadnaviruses [8]. This NF-Y core binding site (ATTGG at nt 58 to 54) is thus a specific molecular characteristic for avihepadnaviruses. We performed experiments using human NF-YA expression plasmid in Huh7 cells that support HBV and DHBV replication and gene expression [19]. NF-Y is evolutionary conserved [12] and composed of three subunits, NF-YA, NF-YB and NF-YC. Our data demonstrate that both exogenous and endogenous NF-YA could upregulate eBHBV1 Cp activity, most likely by directly binding to the NF-Y binding site in Cp (Fig. 4). The NF-Y core binding site at nt 58 to 54 in avihepadnaviral Cps is not present in orthohepadnavirus Cps (Supplementary Fig. 1B). Nevertheless, an ‘ATTGG’ motif is located at nt 21 to 17 in HBV Cp and WMHBV Cp. Previous reports have shown several cis-elements in HBV Cp interact with Sp1, chicken ovalbumin upstream promoter transcription factor (COUP-TF1), hepatocyte nuclear factor 3 (HNF-3), HNF-4, peroxisome proliferator activated receptor a (PPARa), TATA binding protein (TBP) and CCAAT/enhancer binding protein (C/EBP) [20e22]. Bioinformatic analysis has failed to pick up any TFs that might recognize the ‘ATTGG’ motif at nt 21 to 17 in HBV Cp, due to the flanking sequences to ‘ATTGG’ are not preferred by known CCAAT-binding transcription factors. Nevertheless, this motif is functionally essential for HBV Cp activity (Fig. 3D). The fact that it is only present in the Cps of HBV and WMHBV, but not in the Cps of WHV, GSHV and ASHV (Fig. 4B), suggests that it occurs later in the evolution of orthohepadnaviruses [8]. The nature of the factor that interacts with this motif and its contribution to the regulation of HBV Cp activity warrants further study. In conclusion, although the eBHBVs had been inserted in the budgerigar genome for 2.5e5 million years [8], we found the Cps of
eBHBV1 and eBHBV2 still active in cells and have identified an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. Acknowledgement This work was supported by National Key Project for Infectious Diseases (2012ZX10002-006, 2012ZX10004-503, 2012ZX10002012003), National Basic Research Program (2012CB519002), and Natural Science Foundation of China (31071143, 81472226, 81461130019, 81572832). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.08.032. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2016.08.032. References [1] M.R. Patel, M. Emerman, H.S. Malik, Paleovirology e ghosts and gifts of viruses past, Curr. Opin. Virol. 1 (2011) 304e309. [2] M. Emerman, H.S. Malik, Paleovirologyemodern consequences of ancient viruses, PLoS Biol. 8 (2010) e1000301. [3] R.J. Gifford, A. Katzourakis, M. Tristem, et al., A transitional endogenous lentivirus from the genome of a basal primate and implications for lentivirus evolution, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 20362e20367. [4] A. Katzourakis, M. Tristem, O.G. Pybus, et al., Discovery and analysis of the first endogenous lentivirus, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 6261e6265. [5] J. Cui, E.C. Holmes, Endogenous lentiviruses in the ferret genome, J. Virol. 86 (2012) 3383e3385. [6] C. Gilbert, D.G. Maxfield, S.M. Goodman, et al., Parallel germline infiltration of a lentivirus in two Malagasy lemurs, PLoS Genet. 5 (2009) e1000425. [7] W. van der Loo, J. Abrantes, P.J. Esteves, Sharing of endogenous lentiviral gene fragments among leporid lineages separated for more than 12 million years, J. Virol. 83 (2009) 2386e2388. [8] W. Liu, S. Pan, H. Yang, et al., The first full-length endogenous hepadnaviruses: identification and analysis, J. Virol. 86 (2012) 9510e9513. [9] A. Katzourakis, R.J. Gifford, Endogenous viral elements in animal genomes, PLoS Genet. 6 (2010) e1001191. [10] C. Seeger, W.S. Mason, Hepatitis B virus biology, Microbiol. Mol. Biol. Rev. 64 (2000) 51e68. [11] N. Moolla, M. Kew, P. Arbuthnot, Regulatory elements of hepatitis B virus transcription, J. Viral Hepat. 9 (2002) 323e331. [12] R. Mantovani, The molecular biology of the CCAAT-binding factor NF-Y, Gene 239 (1999) 15e27. [13] T. Laloum, S. De Mita, P. Gamas, et al., CCAAT-box binding transcription factors in plants: Y so many? Trends Plant Sci. 18 (2013) 157e166. [14] K. Matuoka, C.K. Yu, Nuclear factor Y (NF-Y) and cellular senescence, Exp. Cell Res. 253 (1999) 365e371. [15] R. Hong, W. Bai, J. Zhai, et al., Novel recombinant hepatitis B virus vectors efficiently deliver protein and RNA encoding genes into primary hepatocytes, J. Virol. 87 (2013) 6615e6624. [16] Y. Liu, X. Ye, J.B. Zhang, et al., PROX1 promotes hepatocellular carcinoma proliferation and sorafenib resistance by enhancing beta-catenin expression and nuclear translocation, Oncogene 34 (2015) 5524e5535. [17] X. Zhao, Y. Wu, J. Duan, et al., Quantitative proteomic analysis of exosome protein content changes induced by hepatitis B virus in Huh-7 cells using SILAC labeling and LC-MS/MS, J. Proteome Res. 13 (2014) 5391e5402. [18] C. Gilbert, D.G. Maxfield, S.M. Goodman, et al., Parallel germline infiltration of a lentivirus in two Malagasy lemurs, PLoS Genet. 5 (2009) e1000425. [19] J. Kock, C. Rosler, J.J. Zhang, et al., Generation of covalently closed circular DNA of hepatitis B viruses via intracellular recycling is regulated in a virus specific manner, PLoS Pathog. 6 (2010) e1001082. [20] X. Yu, J.E. Mertz, Distinct modes of regulation of transcription of hepatitis B virus by the nuclear receptors HNF4alpha and COUP-TF1, J. Virol. 77 (2003) 2489e2499. [21] X. Yu, J.E. Mertz, Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated, J. Virol. 70 (1996) 8719e8726. [22] J. Li, J.H. Ou, Differential regulation of hepatitis B virus gene expression by the Sp1 transcription factor, J. Virol. 75 (2001) 8400e8406.