Nucleotide Sequence of a cDNA Clone Encoding aCaenorhabditis elegansHomolog of Mammalian Alkyl-Dihydroxyacetonephosphate Synthase: Evolutionary Switching of Peroxisomal Targeting Signals

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.

242, 277–281 (1998)

RC977950

Nucleotide Sequence of a cDNA Clone Encoding a Caenorhabditis elegans Homolog of Mammalian AlkylDihydroxyacetonephosphate Synthase: Evolutionary Switching of Peroxisomal Targeting Signals1 Edwin C. J. M. de Vet, Hubertus C. M. T. Prinsen, and Henk van den Bosch2 Centre for Biomembranes and Lipid Enzymology, Institute for Biomembranes, Utrecht University, Utrecht, The Netherlands

Received November 26, 1997

The nucleotide sequence is reported of a cDNA clone encoding a Caenorhabditis elegans homolog of guinea pig and human alkyl-dihydroxyacetonephosphate synthase. The open reading frame encodes a protein of 597 amino acids which shows extensive homology with the mammalian enzymes (52% identical and about 76% similar in the overlapping region). In contrast to the mammalian enzymes, which carry a consensus peroxisomal targeting signal type 2 in a cleavable N-terminal presequence, this Caenorhabditis elegans homolog carries a consensus peroxisomal targeting signal type 1 (CKL) at its C-terminus. Expression of this protein in an in vitro transcription/translation system yielded a 65 kDa protein. Recombinant aenorhabditis elegans alkyl-DHAP synthase expressed in the yeast Pichia pastoris was enzymatically active. q 1998 Academic Press

Ether phospholipids are a special class of phospholipids. Most ether lipids carry either an alkyl or an alkenyl linkage at the sn-1 position of the glycerol backbone and an acyl linkage at the sn-2 position. The 1-alkenyl-2-acyl ether lipids are also known by their trivial name plasmalogens and are relatively abundant in mammalian tissues [1]. In mammals, the first two steps in the biosynthetic route for ether lipids are localized in the peroxisome. The process starts with the acylation of dihydroxyacetonephosphate (DHAP) by the enzyme dihydroxyacetonephosphate 1 The nucleotide sequence reported in this paper has been submitted to the GenBank/EMBL Data Bank with Accession Number AJ002686. 2 To whom correspondence should be addressed at Department Biochemistry of Lipids, Centre for Biomembranes and Lipid Enzymology, Padualaan 8, 3584 CH Utrecht, The Netherlands. Fax /3130-2537990. Abbreviations used: DHAP, dihydroxyacetonephosphate; PTS, peroxisomal targeting signal.

acyltransferase yielding acyl-DHAP ([2] for a recent review). This step is followed by the exchange of the acyl chain for a long chain fatty alcohol catalyzed by the enzyme alkyl-DHAP synthase. The cDNAs encoding this latter enzyme have recently been cloned from guinea pig [3] and human liver [4] and the enzyme appeared to be highly conserved between these two species. In both cases, the open reading frame encodes a precursor protein of 658 amino acids with a cleavable presequence of 58 amino acids containing a peroxisomal targeting signal type 2 (PTS2) motif, thereby disclosing alkyl-DHAP synthase as the second mammalian enzyme with this targeting signal next to the mammalian peroxisomal 3-ketoacyl-CoA thiolases [5]. Besides in mammals, ether lipids have also been found in many other organisms including the yeast Pullaria pullulans [6], protozoa like Tetrahymena pyriformis [7,8] and Trypanosoma brucei rhodesiense [9] and invertebrates including the nematodes Meloidogyne javanica [10], Turbatrix aceti [11], Eisenia foetida [12] and Caenorhabditis elegans [13]. Furthermore, in anaerobic eubacteria and archaebacteria ether lipids are major membrane constituents [14]. However, the biosynthetic route in these organisms has not been studied extensively. In bacteria it is clear that ether lipids are not synthesized via the DHAP pathway [15]. An organism outside the animal kingdom in which the DHAP pathway has been clearly demonstrated is Trypanosoma brucei. The glycosome of this organism contains a specific DHAP acyltransferase, an alkyl/acyl-DHAP oxidoreductase, an acyl-CoA reductase for the formation of long chain alcohols [16,17] and alkyl-DHAP synthase [18], the key enzyme that actually introduces the ether linkage. Since guinea pig and human alkyl-DHAP synthase are extremely homologous, comparison of both sequences gives only very little information on the importance of conserved residues for structure and activity of the enzyme. By searching the Expressed Sequence Tags data-

277

0006-291X/98 $25.00 Copyright q 1998 by Academic Press All rights of reproduction in any form reserved.

AID

BBRC 7950

/

6945$$$121

12-29-97 12:57:04

bbrcg

AP: BBRC

Vol. 242, No. 2, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

bases (dbEST) of the National Center for Biotechnology Information, Bethesda, USA, we identified two overlapping cDNA clones from the nematode Caenorhabditis elegans (yk29f12 and yk79c11 both in lambda ZAP II) that coded for a protein which showed extensive homology to mammalian alkyl-DHAP synthase (about 50% identical). Since this organism is known to contain ether phospholipids [13] we investigated the possibility that these clones both might represent the C. elegans homolog of mammalian alkyl-DHAP synthase by further characterization of these clones in our laboratory. We show here that this enzyme has switched targeting signals during evolution. While the mammalian enzymes contain a PTS2 motif in the N-terminal presequence, this C. elegans homolog carries a C-terminal PTS1 motif. MATERIALS AND METHODS Materials The clones yk29f12 and yk79c11, both in lambda ZAP II, were kindly provided by Dr. Y. Kohara at the National Institute of Genetics,

Mishima, Japan. Oligonucleo-tides were manufactured by Isogen, Maarssen, The Netherlands. The pET-15b and pET-17b vectors were from Novagen, Madison, WI. TnT Coupled Reticulocyte Lysate System is a product from Promega, Madison, WI. The Pichia pastoris expression kit was from Invitrogen, San Diego, CA.

Methods Cloning and nucleotide sequencing. To amplify clone yk79c11 by PCR, two primers were designed based on the sequences present in the Expressed Sequence Tags database at the National Center for Biotechnology Information. The nucleotide sequences of these two primers are TGCAACATATGTCGGCGTCCTATC (sense, introducing a NdeI site, underlined) and AAGCGGCCGCGAAACAATGATTATCTACAAC (antisense, introducing a NotI site, underlined), respectively. PCR was performed essentially as described before [3]. To minimize the risk of introducing errors, Pfu DNA polymerase (Stratagene), which possesses proofreading activity, was used. The fragment obtained was subcloned into the NdeI-NotI site of a pET17b bacterial expression vector using standard techniques [19]. The complete nucleotide sequence of this clone yk79c11 was determined with direct sequencing on the PCR product and with sequencing of several independent clones in the pET-17b. Nucleotide sequencing was done on a Applied Biosystems Inc. DNA sequencer model 373A

FIG. 1. Nucleotide sequence and derived amino acid sequence of the Caenorhabditis elegans homolog of mammalian alkyl-DHAP synthase. 278

AID

BBRC 7950

/

6945$$$121

12-29-97 12:57:04

bbrcg

AP: BBRC

Vol. 242, No. 2, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Alignment of guinea pig and Caenorhabditis elegans alkyl-DHAP synthase. A: guinea pig; B: C. elegans. The PTS2 signal in guinea pig alkyl-DHAP synthase is underlined, the PTS1 signal in C. elegans alkyl-DHAP synthase is in bold. Identical amino acids are indicated by a vertical line, similar amino acids by a colon. Similarity rules: GM; A;LV; Vfi*; I*fl;LYQ; K*; DL.

using dye-terminators and with a Pharmacia T7 sequencing kit using deaza G/A mixes.

translation reactions were done according to the manufacturers instructions, using 35S-methionine as label.

In vitro transcription/translation. The construct encoding Histagged mature guinea pig alkyl-DHAP synthase is described in [3]. To obtain a construct encoding human alkyl-DHAP synthase precursor, cloned downstream of a T7 promotor, the two overlapping clones described in [4] were combined to create the complete open reading frame in a pET-15b vector. The coupled T7 in vitro transcription/

Expression in the yeast Pichia pastoris. Expression of C. elegans alkyl-DHAP synthase in P. pastoris was done with the P. pastoris expression kit (Invitrogen) mainly according to the manufacturers instructions. The cDNA fragment encoding C. elegans alkyl-DHAP synthase was cloned into the pIC9 P. pastoris expression vector downstream of the alcohol oxidase promotor. This was achieved by

279

AID

BBRC 7950

/

6945$$$121

12-29-97 12:57:04

bbrcg

AP: BBRC

Vol. 242, No. 2, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. In vitro transcription/translation of constructs encoding alkyl-DHAP synthase. Lane 1: No DNA. Lane 2: His-tagged mature guinea pig alkyl-DHAP synthase. Lane 3: Human alkyl-DHAP synthase precursor. Lane 4: C. elegans alkyl-DHAP synthase.

excising this cDNA fragment with NdeI (filled in with Klenow fragment to obtain a blunt end) and NotI from the pET-17b vector and ligating this fragment into the BamHI (filled in with Klenow fragment to obtain a blunt end) and NotI sites of the pIC9 vector. Both the empty pIC9 vector and the pIC9-alkyl-DHAP synthase construct were linearized with StuI to allow insertion into the His4 locus of P. pastoris strain GS115 (Invitrogen). Transformation of both constructs was achieved by electroporation [20]. The resulting His4/ colonies were grown overnight on medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base, 411005% biotin and 100 mM potassium phosphate, pH 6.0) containing 1% glycerol as carbon source. To obtain induction of recombinant protein, cells were grown for another 28 h on the same medium except that 0.5% methanol was used as carbon source instead of 1% glycerol. Cells were harvested by centrifugation and lysed with glass beads in 0.25 M sucrose, 2 mM EDTA, 1 mM DTT and 10 mM Tris/HCl (pH 7.4).

DHAP synthase and include a downstream stop codon. It was concluded from these data that clone yk79c11 contained the complete open reading frame and two PCR primers were designed for amplification and introduction of the appropriate restriction sites for subcloning this cDNA in a bacterial expression vector (see ‘‘Methods’’ section). The sense primer is directed against the region around the start codon by incorporating this start codon, through changing the preceding three nucleotides, into a NdeI site. The antisense primer is directed to the region around the stop codon and creates a NotI site. The PCR fragment obtained, containing the complete open reading frame (approximately 1800 bp in size, results not shown), was subcloned into a pET-17b expression vector. The open reading frame encodes a protein of 597 amino acids (fig.1). Figure 2 shows a sequence alignment of guinea pig alkyl-DHAP synthase and the C. elegans homolog reported in this paper. In the overlapping region, the sequence is 52% identical and about 76% similar. Unlike mammalian alkyl-DHAP synthase, this protein lacks a N-terminal consensus peroxisomal targeting signal (PTS) type 2 (underlined in fig.2) but has a PTS1 motif (CKL) [24] at its C-terminus instead. This is a rather rare example of a protein that has a PTS1 in one species, while it contains the other characterized

Analytical Procedures SDS-PAGE was done as described by Laemmli [21]. Alkyl-DHAP synthase activity assay was performed as described before [22]. Protein was determined according to Bradford [23] with bovine serum albumin as standard.

RESULTS AND DISCUSSION The 5* sequence of clone yk79c11 includes the codes for a stretch of amino acids homologous to amino acids 90-101 of both guinea pig and human alkyl-DHAP synthase. Since this sequence contains 60 nucleotides upstream an in frame ATG preceded immediately by an in frame TAA stop codon, we conclude that this ATG represents the start codon. The 3* ends of clones yk79c11 and yk29f12 contain identical sequences that both code for a stretch of amino acids homologous to the C-terminal end of guinea pig and human alkyl-

FIG. 4. Expression of C. elegans alkyl-DHAP synthase in the yeast Pichia pastoris as analyzed by SDS–PAGE. The gel was stained with Coomassie brilliant blue. M, molecular weight markers; Lane 1 and 2, homogenates of two independent P. pastoris clones transformed by an empty pIC9 vector. Alkyl-DHAP synthase activities measured in these homogenates are 1.1 (S.D.1.7) and 0.0 (S.D. 1.1) pmol/min/mg, respectively. Lane 3 and 4, homogenates of two independent P. pastoris clones transformed by pIC9-alkyl-DHAP synthase (C. elegans) construct. Alkyl-DHAP synthase activities measured in these homogenates are 125.4 (S.D.13.5) and 83.4 (S.D.7.3) pmol/min/mg, respectively. The arrow indicates the expressed protein.

280

AID

BBRC 7950

/

6945$$$121

12-29-97 12:57:04

bbrcg

AP: BBRC

Vol. 242, No. 2, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

peroxisomal targeting signal (i.e. PTS2) in other species. Alkyl-DHAP synthase apparently has switched targeting signals during evolution. The protein was expressed in Escherichia coli strain BL21(DE3) in a similar way as described for guinea pig alkyl-DHAP synthase [3] (data not shown). Despite a good expression of the protein, we could not detect any alkyl-DHAP synthase activity in E. coli lysates expressing this protein. This is most likely due to the complete insolubility of this protein in E. coli. We have previously found [3] that only soluble recombinant guinea pig alkyl-DHAP synthase expressed in E. coli is enzymatically active and that the protein recovered in inclusion bodies is likewise inactive. Expression of the C. elegans alkyl-DHAP synthase construct in a coupled in vitro transcription/translation system, yielded a protein which runs at a molecular weight of 65 kDa on SDS-PAGE (lane 4, fig.3). This is in good agreement with the size calculated from the deduced amino acid sequence (fig.1), i.e. 66.5 kDa. Unfortunately, no alkyl-DHAP synthase activity could be detected in the corresponding reaction mixtures performed in the absence of radioactive label, irrespective of whether the mature guinea pig enzyme, the human precursor or the C. elegans homolog was expressed. This could either be due to too low expression levels of the proteins or to misfolding of proteins in this system yielding inactive enzymes. The C. elegans homolog of mammalian alkyl-DHAP synthase was therefore expressed in the yeast P. pastoris as described in Methods. This expression host has the advantage of being a eukaryote containing peroxisomes. A clearly detectable expression product with a molecular weight of 65 kDa was observed on a Coomassie stained polyacrylamide gel (lane 3 and 4, fig.4). Clearly, alkyl-DHAP synthase activity could be measured in homogenates of P. pastoris cells expressing this protein (see legend fig.4), whereas homogenates of P. pastoris cells transformed with an empty pIC9 vector did not contain any significant activity. Furthermore, the activity measured in the cells expressing C. elegans alkyl-DHAP synthase was completely dependent on the presence of the substrate palmitoyl-DHAP in the assay (data not shown). These results provide convincing proof that this clone really represents the C. elegans homolog of mammalian alkyl-DHAP synthase. Collectively, the data provide an interesting example of a peroxisomal protein that has switched in the use of the two well characterized peroxisomal targeting signals.

ACKNOWLEDGMENTS We thank Dr. Y. Kohara, Mishima, Japan for his kind gift of cDNA clones yk79c11 and yk29f12. Cees Sagt is acknowledged for expert technical assistence with the Pichia pastoris expression system. These investigations were carried out under the auspices of the Netherlands Foundation for Chemical Research (S.O.N.) with financial aid from the Netherlands Organization for Scientific Research (N.W.O.).

REFERENCES 1. Horrocks, L. A., and Sharma, M. (1982) in New Comprehensive Biochemistry. (Hawthorne, J. N., and Ansell, G. S., Eds), Vol. 4, pp. 51–93. Elsevier Biomedical, Amsterdam. 2. Hajra, A. K. (1995) Prog. Lipid Res. 34, 343–364. 3. De Vet, E. C. J. M., Zomer, A. W. M., Lahaut, G. J. H. T. J., and van den Bosch, H. (1997) J. Biol. Chem. 272, 798–803. 4. De Vet, E. C. J. M., van den Broek, B. T. E., and van den Bosch, H. (1997) Biochim. Biophys. Acta 1346, 25–29. 5. Swinkels, B. W., Gould, S. J., Bodnar, A. G., Rachubinski, R. A., and Subramani, S. (1991) EMBO J. 10, 3255–3262. 6. Goni, F. M., Dominguez, J. B., and Uruburu, F. (1978) Chem. Phys. Lipids 22, 79–81. 7. Gerhardt, B. (1987) Methods Enzymol. 148, 516–525. 8. Fukushima, H., Watanabe, T., and Nozawa, Y. (1976) Biochim. Biophys. Acta 436, 249–259. 9. Venkatesan, S., and Ormerod, W. E. (1976) Comp. Biochem. Physiol. 53B, 481–487. 10. Chitwood, D. J., and Krusberg, L. R. (1981) J. Nematol. 13, 105– 111. 11. Chitwood, D. J., and Krusberg, L. R. (1981) Comp. Biochem. Physiol. 69B, 115–120. 12. Sugiura, T., Yamashita, A., Kudo, N., Fukuda, T., Miyamoto, T., Cheng, N., Kishimoto, S., Waku, K., Tanaka, T., Tsukatani, H., and Tokumura, A. (1995) Biochim. Biophys. Acta 1258, 19–26. 13. Satouchi, K., Hirano, K., Sakaguchi, M., Takehara, H., and Matsuura, F. (1993) Lipids 28, 837–840. 14. Goldfine, H., and Langworthy, T. A. (1988) Trends Biochem. Sci. 13, 217–220. 15. Prins, R. A., and van Golde, L. M. G. (1976) FEBS Lett. 63, 107– 111. 16. Opperdoes, F. R. (1990) Biochem. Soc. Trans. 18, 729–731. 17. Opperdoes, F. R. (1988) Trends Biochem. Sci. 13, 255–260. 18. Zomer, A. W. M., Opperdoes, F. R., and van den Bosch, H. (1995) Biochim. Biophys. Acta 1257, 167–173. 19. Sambrook, J., Fritsch, J., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 20. Scorer, C. A., Clare, J. J., McCombie, W. R., Romanos, M. A., and Sreekrishna, K. (1994) Biotechnology 12, 181–184. 21. Laemmli, U. K. (1970) Nature 227, 680–685. 22. Zomer, A. W. M., de Weerd, W. F. C., Langeveld, J., and van den Bosch, H. (1993) Biochim. Biophys. Acta 1170, 189–193. 23. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254. 24. De Hoop, M., and Ab, G. (1992) Biochem. J. 286, 657–669.

281

AID

BBRC 7950

/

6945$$$121

12-29-97 12:57:04

bbrcg

AP: BBRC