Obestatin partially suppresses ghrelin stimulation of appetite in “high-responders” grass carp, Ctenopharyngodon idellus

Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa

Obestatin partially suppresses ghrelin stimulation of appetite in “high-responders” grass carp, Ctenopharyngodon idellus Xiaochen Yuan 1, Wenjing Cai 1, Xu-Fang Liang ⁎, Hang Su, Yongchao Yuan ⁎, Aixuan Li, Ya-Xiong Tao College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Wuhan, Hubei 430070, China Hubei Collaborative Innovation Center for Freshwater Aquaculture, Wuhan, Hubei 430070, China

a r t i c l e

i n f o

Article history: Received 22 September 2014 Received in revised form 1 January 2015 Accepted 23 February 2015 Available online 1 March 2015 Keywords: Food intake NPY CART CCK Interactions mRNA expression

a b s t r a c t Ghrelin and obestatin are two gastrointestinal peptides obtained by post-translational processing of a common precursor, preproghrelin. The effect of obestatin on food intake is still controversial. The aim of the present study was to investigate the effects of ghrelin and obestatin on food intake in grass carp, Ctenopharyngodon idellus. Fish received intraperitoneal (IP) injection of saline, ghrelin (100 ng g−1 BW), obestatin-like (25 ng g−1 BW) and ghrelin in combination with obestatin-like. Ghrelin stimulation of food intake varied considerably among individual fish with 70.8% eliciting a robust response. In these high-responders, food intake was significantly increased by IP ghrelin within 2 h. Co-administration of ghrelin and obestatin-like resulted in a decrease in food intake, indicating that obestatin was able to antagonize the effect of ghrelin. However, IP obestatin-like alone could not regulate food intake in grass carp. RT-PCR analysis demonstrated that IP ghrelin peptide led to a significant increase in mRNA abundance of NPY, Y8a and Y8b genes compared to saline injected fish, while in combination with obestatin-like peptide decreased ghrelin-induced gene expressions of these three genes. IP sole obestatin-like peptide did not modify the expression levels of NPY, Y8a, Y8b, CART and POMC compared to the control group. Therefore, IP administration of obestatin-like peptide, partially blocking the ghrelininduced appetite, investigated the possible involvement of obestatin as a mediator of the ghrelin stimulatory action on food intake, at least in “high-responders” grass carp. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Ghrelin and obestatin are two gastrointestinal peptides obtained by post-translational processing of a common precursor, preproghrelin (Hassouna et al., 2010). Ghrelin is the endogenous ligand for an orphan G-protein-coupled receptor, growth hormone secretagogue receptor (GHS-R) (Kojima et al., 1999; Nakazato et al., 2001). Mammalian ghrelin has been shown to be a major endocrine regulator of appetite, growth hormone secretion, energy homeostasis and adipogenesis (Kojima et al., 1999; Tschop et al., 2000; Nakazato et al., 2001). As in mammals, ghrelin is also involved in the regulation of a number of physiological functions, including regulation of pituitary hormone release and stimulation of food intake in fish (Kaiya et al., 2003a, 2003b; Unniappan and Peter, 2005). Obestatin was initially identified as an anorexigenic peptide cognate ligand of the orphan receptor, GPR39 (Zhang et al., 2005),

⁎ Corresponding authors at: College of Fisheries, Huazhong Agricultural University, No. 1, Shizishan Street, Hongshan District, Wuhan, Hubei 430070, China. Tel.: +86 27 8728 8255; fax: +86 27 8728 2114. E-mail addresses: [email protected] (X.-F. Liang), [email protected] (Y. Yuan). 1 These authors contributed equally to the study.

http://dx.doi.org/10.1016/j.cbpa.2015.02.019 1095-6433/© 2015 Elsevier Inc. All rights reserved.

but its effect on food intake and ability to activate GPR39 are still controversial (Holst et al., 2006; Lauwers et al., 2006; Chartrel et al., 2007; Annemie et al., 2009). Although several studies failed to reproduce the anorexigenic actions of obestatin (Seoane et al., 2006; Gourcerol et al., 2007; Mondal et al., 2008; Annemie et al., 2009), this peptide was revealed to be an interesting pharmacological tool to counteract the actions of ghrelin when co-administered with ghrelin in mammals (Zhang et al., 2005; Zizzari et al., 2007; Hassouna et al., 2012). Nothing is reported so far about the identification of teleostean obestatin, although possible existence has been proposed in seabream Acanthopagrus schlegeli (Yeung et al., 2006), Atlantic halibut Hippoglossus hippoglossus L. (Manning et al., 2008) and zebrafish Danio rerio (Li et al., 2009). The physiological function of fish obestatin and its interaction with ghrelin also remain poorly understood. Therefore, further studies are needed to elucidate the existence and potential role of fish obestatins. Grass carp (Ctenopharyngodon idellus), one of the major herbivorous cyprinid fish, are now widely cultivated in China as well as in many other countries as edible fish or as biological control agents for aquatic weeds. To date, there is a lack of basic information regarding the endocrine regulation of appetite in this economical and important species, although food intake is so much important to growth-enhance. Thus, defining the functions of synthetic ghrelin

X. Yuan et al. / Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149

and obestatin-like peptides in mediating grass carp appetite is needed. 2. Materials and methods 2.1. Ethics statement This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Veterinary and Quarantine Service. The protocol was approved by the Committee on the Ethics of Animal Experiments of the Huazhong Agricultural University. The experimental grass carp (initial body weight: 43.91 ± 0.46 g) were provided by Wuhan Academy of Agricultural Science & Technology. Prior to the initiation of the experiment, 500 grass carp were acclimated in 4 cylindrical plastic tanks (1000 L) to laboratory conditions for 3 weeks. 2.2. Solid phase peptide synthesis The 19-amino-acid n-octanoic acid grass carp ghrelin peptide GT[S (N-octanoyl)]FLSPAQKPQGRRPPRV and the 22-amino-acid carboxy-amidated grass carp fragment of obestatin-like peptide APFELSVSLSEAEYEKYGPVLQ-NH2 (GenBank accession no. KC432584) were synthesized by automated multiple solid-phase peptide synthesis (Syro, MultiSynTech, Bochum, Germany) by the orthogonal Fmoc/ tert-butyl strategy (Shanghai Apeptide CO., LTD. Pudong District, Shanghai, China). During synthesis, the hydroxyl group of the third residue (serine) was protected. This protection group was cleaved after synthesis by using 1% trifluoroacetic acid and dichloromethane, and the serine was then acylated with n-octanoic acid in the amino acid synthesizer. To obtain the peptide amide, the rink amide resin was used (30 mg, loading capacity 0.45 mmol/g). Fmoc-amino acids were dissolved in 0.5M HOBt/dimethylformaldehyde (DMF) and Fmoc-Phe-OH in 0.5M HOBt/N-methylpyrrolidone, respectively, and were coupled twice for 40 min each after activation with N,N′-diisopropylcarbodiimide (Dun et al., 2006). Amino acids and activation reagents were used in a 10-fold excess. The removal of the Fmoc group was carried out with 40% piperidine in DMF for 3 min and a second incubation with 20% piperidine in DMF within 10 min. For the removal of all acid labile protecting groups and the cleavage of the peptide from the resin, a mixture of trifluoroacetic acid (TFA)/thioanisole/p-thiocresol [90:5:5 (vol/vol)] was applied for 3 h. The peptide was precipitated from ice-cold diethyl ether, centrifuged at 4 °C, and the supernatant was decanted. The peptide was resuspended in fresh ether, centrifuged again four times, and was finally dissolved in water/tertbutanol [3:1 (vol/vol)] and lyophilized. 2.3. Purification and characterization of the peptides Purity of the peptides was more than 98% according to analytical reversed-phase HPLC on a kromasil C18-5 column (Vydac, 4.6 × 150 mm; 5 μm) eluted with a linear gradient of 25–75% B in A [A, 0.1% (vol/vol) TFA in water; B, 0.1% (vol/vol) TFA in acetonitrile] over 25 min and a flow rate of 1.0 mL/min. Identity of the peptides was proven by matrix-assisted laser desorption ionization mass spectrometry on a Voyager-DE RP workstation (Applied Biosystems, Darmstadt, Germany) (grass carp ghrelin theoretical mass, M + Hexp., 2205.57; grass carp fragment of obestatin-like theoretical mass, M + Hexp., 2455.75). 2.4. Effect of grass carp ghrelin and fragment of obestatin-like peptides on food intake A preliminary experiment using 12 fish intraperitoneal (IP) injection of ghrelin was conducted to verify that the synthesized grass carp ghrelin elicited food intake responses and to verify that ghrelin

145

was biologically active. To determine the dose of ghrelin which elicits food intake responses, grass carp were IP injected with ghrelin at graded levels. Our preliminary experiments had shown that the dose of ≥ 100 ng g− 1 BW produced a marked effect on food intake compared with the values from saline after injection. Furthermore, our preliminary experiment showed that obestatin-like peptide at 25 ng g − 1 BW suppressed the ghrelin-induced high food intake responses under IP administration of ghrelin at 100 ng g− 1 BW in combination with obestatin at graded levels of obestatin-like peptide. So the doses of ghrelin at 100 ng g − 1 BW and obestatinlike at 25 ng g− 1 BW were chosen for the following experiments. After acclimation, 96 fish were anesthetized with MS-222 (1:10,000) and habituated to a single glass tank (100 L), which were divided into four groups that received IP injection, respectively ghrelin at 100 ng g− 1 BW, obestatin at 25 ng g− 1 BW and ghrelin at 100 ng g− 1 BW in combination with obestatin at 25 ng g− 1 BW, and one control group, which received IP injection of the same volume of teleost saline. Each fish was fed to apparent satiation with a commercial unified floating particle feed (Fulong Dietary Company, Wuhan, China), and the feed number was measured at 6 h after injection of the peptides. Uneaten feed and feces were siphoned out of each container 1.5 h after each feeding operation. The food intake was measured by directly observing and recording the number of diet pellets eaten by individual fish. Meanwhile, the unconsumed feed was separated and dried overnight at 50 °C until constant weight, which was deducted from the amount offered to determine food intake. We observed a high variability in the responses to ghrelin peptide injections in individual fish and only a proportion responded to stimulation by ghrelin. Based on these observations, we determined a threshold to classify ghrelin-treated fish into either highor low-responders. For food consumption, the threshold was defined as the mean value + 3 standard deviations (SD) measured during 0–6 h after saline injection (Hassouna et al., 2012). Then, the rest grass carp injected with 100 ng g− 1 BW ghrelin, 200 high food intake responders were selected to evaluate differential effect of ghrelin and obestatin-like peptides on food intake as the above method. These high-responders were distributed into 12 cylindrical plastic tanks (300 L) with 10 fish per tank for 2 weeks of acclimation. The high-responders were then randomly assigned to four triplicate tanks which received IP injection (at 11:00 am), respectively ghrelin at 100 ng g− 1 BW, obestatin at 25 ng g− 1 BW and ghrelin at 100 ng g− 1 BW in combination with obestatin at 25 ng g− 1 BW, and one control group, which received IP injection of the same volume of teleost saline. The fish were fed 3% of body weight over the course of before injection and 2 h, 4 h and 6 h after injection with the commercial unified floating particle feed purchased from Fulong Dietary Company. The food intake was also measured by directly observing and recording the number of diet pellets eaten by individual fish. 2.5. In vivo effects of grass carp ghrelin and fragment of obestatin-like peptides on appetite-regulating gene expressions In order to examine the effect of grass carp ghrelin and fragment of obestatin-like peptides on brain NPY, Y8a, Y8b, CART, POMC and CCK mRNA expressions, the high-responders received IP injection of ghrelin at 100 ng g−1 BW, obestatin at 25 ng g−1 BW, ghrelin at 100 ng g−1 BW in combination with obestatin at 25 ng g−1 BW, and teleost saline of same volume. Six fish per treatment were anesthetized with MS-222 (1:10,000) at 0, 0.5, 1, 3 and 6 h after injection, and brain tissue was rapidly excised from each fish, flash-frozen in liquid nitrogen, and stored at −80 °C. Total RNA of the brain was extracted separately from four individuals by SV Total RNA Isolation System kit (Promega, USA) following the manual, and then its purity and quantity were measured using protein and nucleic acid analyzer and agarose gel electrophoresis.

146

X. Yuan et al. / Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149

Then 1 μg of the RNA was reverse transcribed to cDNA using SuperScript™ II RT reverse transcriptase (Takara, Japan). Real-time PCR was applied to evaluate the expression level of gene expression assay using gene-specific primers as shown in Table 1. Beta-actin gene (GenBank: M25013.1), a housekeeping gene, was used as an endogenous reference to normalize the template amount. Real-time PCR assays were carried out in a quantitative thermal cycler (MyiQ™ 2 Two-Color Real-Time PCR Detection System, BIO-RAD, USA) with a 20 μL reaction volume containing 10 μL GoTaq® qPCR Master mix, 2 μL of cDNA, and 0.2 μM of each primer. The thermal program included 1 min at 95 °C, 40 cycles at 95 °C for 5 s, 57 °C for 10 s, and 72 °C for 30 s, and a melt curve step (from 95 °C, gradually reducing 0.5 °C·s − 1 to 57 °C, with acquisition data every 6 s). The amplification efficiencies of control and target genes were approximately equal and ranged from 97.0 to 103.2%. Gene expression levels were quantified relative to the expression of β-actin using the optimized comparative Ct (2− ΔΔCt ) value method (Livak and Schmittgen, 2001). All amplifications were performed in triplicate for each RNA sample. Data from three replicate RT-PCR samples were analyzed using iQ5 Optical System Software. The ΔCt (differences in the Ct value between target gene and β-actin) for each sample was subtracted from that of the calibrator, which was called ΔΔCt, gene expression levels were calculated using 2− ΔΔCt and the value represented an n-fold difference relative to the control. Modifications of gene expression are represented with respect to the calibrator, which is assumed to have the value of 1 A.U. (arbitrary unit). 2.6. Statistical analyses The data was analyzed for statistical significance using the SPSS16.0 for Windows (SPSS, Michigan Avenue, Chicago, IL, USA). Prior to statistical analysis, all data were tested for normality of distribution using the Kolmogorov–Smirnov test. The homogeneity of variances among the different tissues was tested using the Barlett's test. Then they were subjected to one-way ANOVA and Tukey's multiple range tests. Difference was considered significant at P b 0.05. 3. Results

food consumption, the threshold was defined as the mean value + 3 standard deviations (SD) measured during 0–6 h after saline injection. Seventy point eight percent of grass carp increased their food consumption over a threshold of 28.25 mg g−1 BW (high-responders) 6 h after ghrelin injection whereas 29.2% of fish did not (low-responders) response (Fig. 1). After administration of obestatin-like peptide, the profile of the distribution of the responses was similar to saline injection, and after co-administration of ghrelin and obestatin, the profile of the distribution of the responses was similar between high- and low-responders. The significant increases in food intake were observed at 2 h IP ghrelin and ghrelin in combination with obestatin-like compared to the control group (Fig. 2). As can be seen, food intake was significantly higher in ghrelin-treated fish at 2 h after treatment compared to ghrelin in combination with obestatin-like treatment (P b 0.05). The IP injection of obestatin-like peptide alone at 25 ng g−1 BW could not regulate food intake in grass carp. 3.2. Effects of IP administration of grass carp ghrelin and fragment of obestatin-like peptides on appetite-regulating gene expressions The expressions of selected genes representing feeding regulation were concurrently measured by RT-PCR technology after ghrelin and fragment of obestatin-like treatments. The IP application of ghrelin peptide led to a statistically significant (P b 0.05) increase in mRNA abundance in NPY, Y8a and Y8b genes in comparison with saline injected fish (Fig. 3), while in combination with obestatin-like peptide decreased ghrelin-induced gene expressions of these three genes. IP sole obestatin-like peptide did not modify the expression levels of NPY, Y8a, Y8b, CART and POMC compared to the control group. However, the obestatin-like peptide application significantly increased the CCK gene expression. The mRNA levels of CART and POMC in the brain were significantly decreased at 1 h and 0.5 h after ghrelin injection compared to that of the control group (P b 0.05). 4. Discussion The present study used molecular biology techniques to investigate the effects of ghrelin and obestatin on appetite in grass carp. Fish received saline, ghrelin, obestatin-like and ghrelin in combination

3.1. Effects of IP administration of grass carp ghrelin and fragment of obestatin-like peptides on food intake A high variability was presented in the responses to peptide injections in individual fish, and only a proportion responded to stimulation by ghrelin. Based on these observations, a threshold was determined to classify ghrelin-treated animals into either high- or low-responders. For Table 1 Primer sequences for the quantitative real-time PCR. Accession no.

Gene

Sequence 5′–3′

M25013

β-Actin

JQ951928

NPY

ESTs

Y8a

ESTs

Y8b

JF912411

CCK

ESTs

CART

FJ692322.1

POMC

β-Actin-F β-Actin-R NPY-F NPY-R Y8a-F Y8a-R Y8b-F Y8b-R CCK-F CCK-R CART-F CART-R POMC-F POMC-R

GGCTGTGCTGTCCCTGTATG GGTAGTCAGTCAGGTCACGGC CTTCCTCTTGTTCGCCTGCT CCTTTTGCCATACCTCTGCC AATGTGTGCCCTCCCTCTGT CGATGAGGATGTTGGTGACG GATTTTTGACTGGAACCACGAG CGGCATCTGGAAAGCAGTG GGAACACACACGCCACACC GGAGAGGAACTTCTGCGGTATG AGTTTTACCCAAAGGACCCG TGACCCTTTTCTGATGGCG CATGGAGCATTTCCGTTGGG AGTCGTCTTCGTTGGTTGCC

Fig. 1. Differential effect of ghrelin and obestatin-like peptide on food intake in high- and low-responders. Cumulative 0–6 h food intake in individual fish after intraperitoneal injection of ghrelin at 100 ng g−1 BW, obestatin at 25 ng g−1 BW and ghrelin at 100 ng g−1 BW in combination with obestatin at 25 ng g−1 BW (n = 24). 6 h after ghrelin injection, 70.8% of fish increased their food intake over a threshold of 28.25 mg g−1 BW (high-responders) whereas 29.2% of fish did not (low-responders) response. The dotted line represents the threshold for ghrelin response. Bar represents mean of data. ***(P b 0.001) vs saline.

X. Yuan et al. / Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149

Fig. 2. The effects of intraperitoneal injection of ghrelin at 100 ng g−1 BW, obestatin at 25 ng g−1 BW and ghrelin at 100 ng g−1 BW in combination with obestatin at 25 ng g−1 BW on food intake in high-responders before injection and 2 h, 4 h and 6 h after injection. Data represent means ± S.E. (n = 6). Significance level is marked with different letters (P b 0.05), compared with the values from saline injected grass carp at each time point.

with obestatin-like. The synthetic obestatin-like peptide partially suppresses ghrelin stimulation of appetite in grass carp. Indeed, only 70.8% of ghrelin-treated fish responded to ghrelin's action on food intake. To our knowledge, this is the first report showing that IP ghrelin does not always lead to a major increase in food consumption in fish. Actually, in 2012, Hassouna et al. (2012) explored the action of obestatin in mammals, 41% of ghrelin-treated mice failed to increase their food consumption. As the effects of obestatin could only be observed in mice high-responders, inter-individual heterogeneity in ghrelin responses might explain why several studies in rodents failed to see any inhibitory action of obestatin on ghrelin-induced food intake (Nogueiras et al., 2006; Seoane et al., 2006). Although there is still no study on physiological function of obestatin in fish, controversial results in mammals concerning the physiological significance or pharmacological actions of obestatin cannot be ignored (Zhang et al., 2005; Nogueiras et al., 2006; Seoane et al., 2006; Chartrel et al., 2007; Annemie et al., 2009). Therefore, this research method in the present study, eliminating inter-individual heterogeneity in ghrelin responses in the first place, can ensure the experimental results with more rationality. In the present study, IP injection obestatin-like peptide sole failed to show a suppressive effect on food intake. No difference was discovered in food intake between IP obestatin-like peptide alone at 25 ng g−1 BW and saline-infused group within 6 h after treatment. The initial report by Zhang et al. (2005) reported that obestatin has suppressive effects on food intake in rat and mouse after peripheral and central administration. After that, some experimenters managed to reproduce the food-suppressive effects of the obestatin peptide after IP administration, whereas many other studies yielded negative results (Seoane et al., 2006; Gourcerol et al., 2007; Mondal et al., 2008; Annemie et al., 2009). Consistent with the majority of published articles, we did not succeed in confirming the suppressive effects of obestatin on food intake in grass carp. Moreover, to examine whether obestatin exerted any effect on hypothalamic energy balance control circuits, we assessed the mRNA expressions of several neuropeptides involved in the regulation of food intake. There were no differences in hypothalamic gene expressions of NPY, Y8a, Y8b, CART or POMC between acute IP obestatin

Fig. 3. The expressions of neuropeptide Y (NPY), and its receptors (Y8a and Y8b), cocaine and amphetamine regulated transcript (CART), proopiomelanocortin (POMC) and cholecystokinin (CCK) genes in the brain after intraperitoneal injection of ghrelin at 100 ng g−1 BW, obestatin at 25 ng g−1 BW and ghrelin at 100 ng g−1 BW in combination with obestatin at 25 ng g−1 BW in high-responders (0–6 h). Data represent means ± S.E. (n = 6). Significance level is marked with different letters (P b 0.05), compared with the values from saline injected grass carp at each time point.

147

148

X. Yuan et al. / Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149

treatment and saline-infused controls. NPY acts as an orexigenic factor in both mammals (Chee and Colmers, 2008; Perboni et al., 2013) and fish (Lopez-Patino et al., 1999; Silverstein and Plisetskaya, 2000; Kiris et al., 2007; Yokobori et al., 2012). NPY injections increase feeding in grass carp, and Y8a and Y8b are also involved in the feeding regulation (Zhou et al., 2013). In grass carp, stimulus to appetite is presumably mediated by NPY receptor Y8a and Y8b (He et al., 2013). Our data showed that sole obestatin injection cannot regulate food intake through stimulating the expression of NPY, Y8a or Y8b genes. CART acts as an anorexigenic factor in mammals (Larsen and Hunter, 2006), birds (Larsen and Hunter, 2006) and fish, including goldfish, Carassius auratus (Volkoff and Peter, 2000, 2001), common carp, Cyprinus carpio (Wan et al., 2012), zebrafish (Nishio et al., 2012), red-bellied piranha, Pygocentrus nattereri (Volkoff, 2014), cunner, Tautogolabrus adspersus (Babichuk and Volkoff, 2013), Atlantic salmon, Salmo salar (Valen et al., 2011) and channel catfish, Ictalurus punctatus (Peterson et al., 2012). Besides, the precursor protein, proopiomelanocortin (POMC), produces many biologically active peptides in the different hypothalamic and extra-hypothalamic sites involved with feeding in the central nervous system, which could lead to subtle variations in the anorexic signal being transmitted (Millington, 2007). In the present work, the expression of CART and POMC was consistent with the inability of obestatin to suppress appetite. That obestatin is unable to cross the blood–brain barrier and rapidly degraded in the circulation might be the reason for the unchanged central orexigenic/anorexigenic genes expressions (Pan et al., 2006; Vergote et al., 2008). CCK, as an anorexinergic gastrointestinal tract hormone, coordinates digestion and is associated with inhibition of food intake via vagal nerve stimulation (Crawley et al., 1991; Crawley and Corwin, 1994). In mammals, obestatin injected peripherally did not inhibit the feeding response to a fast and influence CCK satiety signaling in both rats and mice, and there was yet no interaction between obestatin and CCK known to induce satiety signaling through vagal pathways when both peptides were injected (Gourcerol et al., 2007; Gourcerol and Tache, 2007). Thus, the desired results of CCK's expression in this study would be unchanged after IP obestatin administration like CART. But, obestatin significantly stimulated CCK expression at 1 h after injection in our grass carp, which is very different from mammals. The increase of CCK gene expression might be due to an unclear interaction between obestatin and CCK in grass carp intestine, and then transmit to brain through vagal pathways after IP injection with obestatin-like. Therefore, the further study that the regulation of food intake medicated by peripheral co-injection obestatin with CCK, possible interaction between CCK and obestatin in fish satiety signaling should be considered. On the other hand, IP administration of obestatin-like peptide partially blocked the ghrelin-induced appetite in our grass carp. Co-administration of ghrelin and obestatin resulted in a decrease in food intake, indicating that obestatin was able to antagonize the effect of ghrelin. The results investigated the possible involvement of obestatin-like peptide as a mediator of the ghrelin stimulatory action on food intake. In the absence of an identified obestatin receptor and adequate tools to study obestatin function (agonists or antagonists), the mechanism of interaction of obestatin and ghrelin in the central nervous system has remained poorly understood (Hassouna et al., 2012). We thus tested whether obestatin could modulate ghrelin's effects by acting on orexigenic and anorexigenic genes. In the present study, obestatin injection partially decreased the expressions of ghrelin-induced orexigenic genes, like NPY, and its receptors, while increased CART and POMC mRNA levels. The results indicated that obestatin-like peptide partially regulated the ghrelin-mediated orexigenic/anorexigenic genes in grass carp. A plausible explanation could be that obestatin has in vivo powerful effects at gastrointestinal level, suppressing gastric emptying activity, thus antagonizing the ghrelin effect (Seoane et al., 2006). These facts may help to understanding why food intake of grass carp under obestatin injection partially

blocked the ghrelin-induced food intake, according to the present work. Moreover, the suppressive effect on the ghrelin-induced food intake was observed within the first hour following the injection, suggesting that the inhibitory action of obestatin on the ghrelininduced food intake occurred immediately. In conclusion, our study shows that obestatin is barely a physiological regulator of food intake, but it partially blocks the ghrelin-induced appetite in grass carp. It remains to be clarified whether the peptide could have other physiological functions in fish such as effects on memory and anxiety (Carlini et al., 2007), satiety signaling (Gourcerol and Tache, 2007), and gastrointestinal motor function (Zhang et al., 2005) as has been reported in mammals. Acknowledgments This work was financially supported by the National Basic Research Program of China (2014CB138601), the National Natural Science Foundation of China (31172420 and 31272641), the Key Projects in the National Science & Technology Pillar Program (2012BAD25B04) and the National Nature Science Foundation of China (NSFC) Grant (31302203). References Annemie, V.D., Debby, V.D., Valentijn, V., Bart, D.S., Walter, L., Liliane, S., Peter, P.D.D., 2009. Central administration of obestatin fails to show inhibitory effects on food and water intake in mice. Regul. Pept. 156, 77–82. Babichuk, N.A., Volkoff, H., 2013. Changes in expression of appetite-regulating hormones in the cunner (Tautogolabrus adspersus) during short-term fasting and winter torpor. Physiol. Behav. 120, 54–63. Carlini, V.P., Schioth, H.B., Debarioglio, S.R., 2007. Obestatin improves memory performance and causes anxiolytic effects in rats. Biochem. Biophys. Res. Commun. 352, 907–912. Chartrel, N., Alvear-Perez, R., Leprince, J., Iturrioz, X., Goazigo, A.R.L., Audinot, V., 2007. Comment on “obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake”. Science 315, 766. Chee, M.J., Colmers, W.F., 2008. Y eat? Nutrition 24, 869–877. Crawley, J.N., Corwin, R.L., 1994. Biological actions of cholecystokinin. Peptides 15, 731–755. Crawley, J.N., Fiske, S.M., Durieux, C., Derrien, M., Roques, B.P., 1991. Centrally administered cholecystokinin suppresses feeding through a peripheral-type receptor mechanism. J. Pharmacol. Exp. Ther. 257, 1076–1080. Dun, S.L., Brailoiu, G.C., Brailoiu, E., Yang, J., Chang, J.K., Dun, N.J., 2006. Distribution and biological activity of obestatin in the rat. Endocrinology 191, 481–489. Gourcerol, G., Tache, Y., 2007. Obestatin a ghrelin associated peptide that does not hold its promise to suppress food intake and motility. Neurogastroenterol. Motil. 19, 161–165. Gourcerol, G., St-Pierre, D.H., Tache, Y., 2007. Lack of obestatin effects on food intake: should obestatin be renamed ghrelin-associated peptide (GAP)? Regul. Pept. 141, 1–7. Hassouna, R., Zizzari, P., Tolle, V., 2010. The ghrelin/obestatin balance in the physiological and pathological control of growth hormone secretion, body composition and food intake. J. Neuroendocrinol. 22, 793–804. Hassouna, R., Zizzari, P., Viltart, O., Yang, S.K., Gardette, R., Videau, C., Badoer, E., Epelbaum, J., Tolle, V., 2012. A natural variant of obestatin, Q90L, inhibits ghrelin's action on food intake and GH secretion and targets NPY and GHRH neurons in mice. PLoS ONE 7, e51135. He, S., Liang, X.F., Li, L., Sun, J., Shen, D., 2013. Differential gut growth, gene expression and digestive enzyme activities in young grass carp (Ctenopharyngodon idella) fed with plant and animal diets. Aquaculture 410, 18–24. Holst, B., Egerod, K.L., Schild, E., Vickers, S.P., Cheetham, S., Gerlach, L.O., Storjohann, L., Stidsen, C.E., Jones, R., Beck-Sickinger, A.G., Schwartz, T.W., 2006. GPR39 signaling is stimulated by zinc ions but not by obestatin. Endocrinology 148, 13–20. Kaiya, H., Kojima, M., Hosoda, H., Riley, L.G., Hirano, T., Grau, E.G., Kangawa, K., 2003a. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. J. Endocrinol. 176, 415–423. Kaiya, H., Kojima, M., Hosoda, H., Riley, L.G., Hirano, T., Grau, E.G., Kangawa, K., 2003b. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comp. Biochem. Physiol. B 135, 421–429. Kiris, G.A., Kumlu, M., Dikel, S., 2007. Stimulatory effects of neuropeptide Y on food intake and growth of Oreochromis niloticus. Aquaculture 264, 383–389. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402, 656–660. Larsen, P.J., Hunter, R.G., 2006. The role of CART in body weight homeostasis. Peptides 27, 1981–1986. Lauwers, E., Landuyt, B., Arckens, L., Schoofs, L., Luyten, W., 2006. Obestatin does not activate orphan G protein-coupled receptor GPR39. Biochem. Biophys. Res. Commun. 351, 21–25.

X. Yuan et al. / Comparative Biochemistry and Physiology, Part A 184 (2015) 144–149 Li, X., He, J., Hu, W., Yin, Z., 2009. The essential role of endogenous ghrelin in growth hormone expression during zebrafish adenohypophysis development. Endocrinology 150, 2767–2774. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lopez-Patino, M.A., Guijarro, A.I., Isorna, E., Delgado, M.J., Alonso-Bedate, M., de Pedro, N., 1999. Neuropeptide Y has a stimulatory action on feeding behavior in goldfish (Carassius auratus). Eur. J. Pharmacol. 377, 147–153. Manning, A.J., Murray, H.M., Gallant, J.W., Matsuoka, M.P., Radford, E., Douglas, S.E., 2008. Ontogenetic and tissue-specific expression of preproghrelin in the Atlantic halibut, Hippoglossus hippoglossus L. J. Endocrinol. 196, 181–192. Millington, G.W., 2007. The role of proopiomelanocortin (POMC) neurones in feeding behavior. Nutr. Metab. 4, 18. Mondal, M.S., Toshinai, K., Ueno, H., Koshinaka, K., Nakazato, M., 2008. Characterization of obestatin in rat and human stomach and plasma, and its lack of acute effect on feeding behavior in rodents. J. Endocrinol. 198, 339–346. Nakazato, M., Murakami, N., Date, Y., Kojima, M., Matsuo, H., Kangawa, K., Matsukura, S., 2001. A role for ghrelin in the central regulation of feeding. Nature 409, 194–198. Nishio, S.I., Gibert, Y., Berekelya, L., Bernard, L., Brunet, F., Guillot, E., Le Bail, J.C., Sánchez, J.A., Galzin, A.M., Triqueneaux, G., Laudet, V., 2012. Fasting induces CART downregulation in the zebrafish nervous system in a cannabinoid receptor dependent manner. Mol. Endocrinol. 26, 1316–1326. Nogueiras, R., Pfluger, P., Tovar, S., Arnold, M., Mitchell, S., Morri, A., Perez-Tilve, D., Vázquez, M.J., Wiedmer, P., Castañeda, T.R., DiMarchi, R., Tschöp, M., Schurmann, A., Joost, H.G., Williams, L.M., Langhans, W., Diéguez, C., 2006. Effects of obestatin on energy balance and growth hormone secretion in rodents. Endocrinology 148, 21–26. Pan, W., Tu, H., Kastin, A.J., 2006. Differential BBB interactions of three ingestive peptides: obestatin, ghrelin, and adiponectin. Peptides 27, 911–916. Perboni, S., Vignoni, M., Inui, A., 2013. Chapter 154 — NPY. In: Kastin, A.J. (Ed.), Handbook of Biologically Active Peptides, Second edition Academic Press, Boston, pp. 1143–1148. Peterson, B.C., Waldbieser, G.C., Riley, J.L.G., Upton, K.R., Kobayashi, Y., Small, B.C., 2012. Pre- and postprandial changes in orexigenic and anorexigenic factors in channel catfish (Ictalurus punctatus). Gen. Comp. Endocrinol. 176, 231–239. Seoane, L.M., Al-Massadi, O., Pazos, Y., Pagotto, U., Casanueva, F.F., 2006. Central obestatin administration does not modify either spontaneous or ghrelin-induced food intake in rats. J. Endocrinol. Investig. 29, RC13–RC15. Silverstein, J.T., Plisetskaya, E.M., 2000. The effects of NPY and insulin on food intake regulation in fish. Am. Zool. 40, 296–308.

149

Tschop, M., Smiley, D.L., Heiman, M.L., 2000. Ghrelin induces adiposity in rodents. Nature 407, 908–913. Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions of ghrelin in fish. Comp. Biochem. Physiol. A 140, 396–408. Valen, R., Jordal, A.E., Murashita, K., Ronnestad, I., 2011. Postprandial effects on appetiterelated neuropeptide expression in the brain of Atlantic salmon, Salmo salar. Gen. Comp. Endocrinol. 171, 359–366. Vergote, V., Van Dorpe, S., Peremans, K., Burvenich, C., De Spiegeleer, B., 2008. In vitro metabolic stability of obestatin: kinetics and identification of cleavage products. Peptides 29, 1740–1748. Volkoff, H., 2014. Appetite regulating peptides in red-bellied piranha, Pygocentrus nattereri: cloning, tissue distribution and effect of fasting on mRNA expression levels. Peptides 56C, 116–124. Volkoff, H., Peter, R.E., 2000. Effects of CART peptides on food consumption, feeding and associated behaviors in the goldfish, Carassius auratus: actions on neuropeptide Yand orexin A-induced feeding. Brain Res. 887, 125–133. Volkoff, H., Peter, R.E., 2001. Characterization of two forms of cocaine- and amphetamineregulated transcript (CART) peptide precursors in goldfish: molecular cloning and distribution, modulation of expression by nutritional status, and interactions with leptin. Endocrinology 142, 5076–5088. Wan, Y., Zhang, Y., Ji, P., Li, Y., Xu, P., Sun, X., 2012. Molecular characterization of CART, AgRP, and MC4R genes and their expression with fasting and re-feeding in common carp (Cyprinus carpio). Mol. Biol. Rep. 39, 2215–2223. Yeung, C.M., Chan, C.B., Woo, N.Y., Cheng, C.H., 2006. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. J. Endocrinol. 189, 365–379. Yokobori, E., Azuma, M., Nishiguchi, R., Kang, K.S., Kamijo, M., Uchiyama, M., Matsuda, K., 2012. Neuropeptide Y stimulates food intake in the Zebrafish, Danio rerio. J. Neuroendocrinol. 24, 766–773. Zhang, J.V., Ren, P.-G., Avsian-Kretchmer, O., Luo, C.-W., Rauch, R., Klein, C., Hsueh, A.J.W., 2005. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science 310, 996–999. Zhou, Y., Liang, X.-F., Yuan, X., Li, J., He, Y., Fang, L., Guo, X.Z., Liu, L.W., Li, B., Shen, D., 2013. Neuropeptide Y stimulates food intake and regulates metabolism in grass carp, Ctenopharyngodon idellus. Aquaculture 380–383, 52–61. Zizzari, P., Longchamps, R., Epelbaum, J., Bluet-Pajot, M.T., 2007. Obestatin partially affects ghrelin stimulation of food intake and growth hormone secretion in rodents. Endocrinology 148, 1648–1653.