Occurrence and molecular characterization of enteric viruses in bivalve shellfish marketed in Vietnam

Food Control 108 (2020) 106828

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Occurrence and molecular characterization of enteric viruses in bivalve shellfish marketed in Vietnam

T

E. Suffredinia,∗,1, Q.H. Leb,1, S. Di Pasqualea, T.D. Phamb, T. Vicenzaa, M. Losardoa, K.A. Tob, D. De Medicia a b

Istituto Superiore di Sanità, Department of Food Safety, Nutrition and Veterinary Public Health, Viale Regina Elena 299, 00161, Rome, Italy Hanoi University of Science and Technology, School of Biotechnology and Food Technology, 1, Dai Co Viet Street, Hanoi, Viet Nam

ARTICLE INFO

ABSTRACT

Keywords: Enteric viruses Hepatitis A Norovirus Hepatitis E Astrovirus Aichi virus Shellfish Risk assessment Quantitative PCR

Viral contamination of bivalve molluscs is an extensively document food safety issue. Limited data are available, however, on the prevalence and quantitative levels of such viruses in countries, as Vietnam, with an important shellfish production, both for internal consumption and for export. The aim of this study was to evaluate both the occurrence and the quantitative levels of different viruses, including Norovirus (NoV genogroups I, II and IV), Hepatitis A (HAV), Hepatitis E (HEV), Astrovirus (AstV), and Aichi virus (AiV), in bivalve shellfish commercialized in Vietnam. A total of 121 samples (63 Pacific oysters and 58 white hard clams) were collected over nine months in two fish markets and two supermarkets in Hanoi, Vietnam. Norovirus was the most frequently detected virus (81.8% of samples) with viral loads ranging from below the quantification limit (LOQ) to 2.8 × 104 genome copies (g.c.)/g of shellfish digestive tissue and an average contamination of 3.8 × 103 g.c./g. HAV, HEV and AstV were detected in 1.7%, 11.6% and 12.4% of samples respectively (average concentrations: 1.3 × 102 g.c./g for HAV, 1.2 × 102 for HEV and 1.5 × 103 for AstV). AiV were also frequently detected (11.6% of samples), while NoV GIV was never observed. Contamination by at least one virus and by more than one virus was present in 83.5% and 52.9% of samples, respectively. Molecular characterization of NoV revealed circulation, over the observed period, of a wide variety of strains (four and nine genotypes for NoV GI and NoV GII respectively: GI.2, GI.4, GI.5, GI.6, GII.3, GII.4, GII.6, GII.7, GII.13, GII.14, GII.17, GII.18, GII.21). To our knowledge, this study is the first to provide quantitative information on the occurrence of enteric viruses in bivalve shellfish marketed in Vietnam, which will help outlining monitoring plans and setting appropriate control measures.

1. Introduction Bivalve shellfish are considered an important source of high-quality proteins and nutrients (Venugopal & Gopakumar, 2017). Molluscs, however, are filter-feeding animals that, as a part of their physiological nutrition process, may accumulate biological and chemical contaminants eventually present in their growing waters (Jorgensen, 1996). Production and harvesting areas located in proximity to the coast or close to possible pollution sources (as urban agglomerates or areas with intensive livestock production) may be subjected to accidental human and animal faecal contamination from untreated discharge waters as a consequence of extreme meteorological events, wastewater treatment plants failure/overflow or runoffs (Hata et al.,

2014; Rodriguez, Gundy, Rijal, & Gerba, 2012; Santo Domingo & Edge, 2010; WHO, 2012). In such instances, bivalve molluscs may concentrate viruses transmitted through the faecal-oral route, such as Hepatitis A and E viruses (HAV and HEV), Norovirus (NoV), and other viruses responsible for gastroenteritis (Campos et al., 2015; Campos & Lees, 2014; Griffin, Donaldson, Paul, & Rose, 2003; Grodzki et al., 2012; Mesquita et al., 2016; Romalde, Rivadulla, Varela, & Barja, 2018; Varela, Polo, & Romalde, 2016). The role of bivalve shellfish in foodborne transmission of viruses has been clearly established by the considerable number of outbreaks reported in literature (Bellou, Kokkinos, & Vantarakis, 2013). NoV is the most common etiological agent of viral gastroenteritis (Scallan et al., 2011). NoV foodborne outbreaks have been often reported, particularly

Corresponding author. Istituto Superiore di Sanità, viale Regina Elena, 299, 00161, Rome, Italy. E-mail addresses: [email protected], [email protected] (E. Suffredini). 1 These authors equally contributed to the work. ∗

https://doi.org/10.1016/j.foodcont.2019.106828 Received 30 June 2019; Received in revised form 14 August 2019; Accepted 17 August 2019 Available online 20 August 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.

Food Control 108 (2020) 106828

E. Suffredini, et al.

Table 1 Primers and probes used in the study for real-time RT-(q)PCR and nested RT-PCR of viral targets. Target

PCR

Primer/probe name and sequence (5′-3′)

Target region

Amplicon (bp)

Reference

NoV GI

real-time RTqPCR

ORF1-ORF2 junction

–

daSilva et al. (2007); Hoehne & Schreier (2006); Svraka et al. (2007)

NoV GII

real-time RTqPCR

ORF1-ORF2 junction

–

Kageyama et al. (2003); Loisy et al. (2005)

HAV

real-time RTqPCR

5′NCR

–

Costafreda et al. (2006)

HEV

real-time RTqPCR

ORF2-ORF3 junction

–

Garson et al. (2012); Jothikumar et al. (2006)

AstV

real-time RTqPCR

3′UTR

–

Le Cann et al. (2004)

AiV

real-time RTPCR

QNIF4 NV1LCR TM9 QNIF2 COG2R QNIFs HAV68 HAV240 HAV150 (−) JVHEVF JVHEVR JVHEVPmod AV1 AV2 AVs AiV-AB-F AiV-AB-R AiV-AB-TP Mon 4F 1790-r RING4 COG1F G1-SKR G1-SKF G1-SKR COG2F G2-SKR G2-SKF G2-SKR HAV 2897 HAV 3288 HAV 2949 HAV 3192 ORF1F ORF1R ORF1FN ORF1RN HE044 HE040 HE041 HE110-2mod AiV 6290 AiV 6602 AiV 6309 AiV 6488 AiV 6309 AiV R2mod AHAstVF1 AHAstVR1 AHAstVF2 AHAstVR2

VP0

–

Kitajima et al. (2013)

ORF1

–

Muscillo et al. (2013); Trujillo et al. (2006)

ORF2

1st cycle, 381 bp nested, 318 bp

Kageyama et al. (2003); Kojima et al. (2002)

ORF2

1st cycle, 387 bp nested, 344 bp

Kageyama et al. (2003); Kojima et al. (2002)

VP1/2A junction

1st cycle, 391 bp nested, 243 bp

Taffon et al. (2011)

5′ Met

1st cycle, 348 bp nested, 172 bp

Fogeda, Avellon, Cilla, & Echevarria (2009)

ORF2

1st cycle, 506 bp nested, 476 bp

La Rosa et al. (2011); Okamoto et al. (2001); Shrestha et al. (2003)

3C/D junction

1st cycle, 312 bp nested A, 179 bp nested B, 278 bp 1st cycle, 574 bp nested, 406 bp

Oh et al. (2006)Suffredini et al. (2019)

NoV GIV real-time RTPCR NoV GI

nested RTPCR

NoV GII

nested RTPCR

HAV

nested RTPCR

HEV

nested RTPCR

HEV

nested RTPCR

AiV

nested RTPCR

AstV

nested RTPCR

CGCTGGATGCGNTTCCAT CCTTAGACGCCATCATCATTTAC FAM-TGGACAGGAGATCGC-MGB ATGTTCAGRTGGATGAGRTTCTCWGA TCGACGCCATCTTCATTCACA FAM-AGCACGTGGGAGGGCGATCG-TAMRA TCACCGCCGTTTGCCTAG GGAGAGCCCTGGAAGAAAG FAM-CCTGAACCTGCAGGAATTAA-MGB GGTGGTTTCTGGGGTGAC AGGGGTTGGTTGGATGAA FAM-TGATTCTCAGCCCTTCGC-MGB CCGAGTAGGATCGAGGGT GCTTCTGATTAAATCAATTTTAA FAM-CTTTTCTGTCTCTGTTTAGATTATTTT–AATCACC-TAMRA GTCTCCACHGACACYAAYTGGAC GTTGTACATRGCAGCCCAGG FAM-TTYTCCTTYGTGCGTGC-MGB TTTGAGTCYATGTACAAGTGGATGC GTTGCCCGCACCATCCGYAG FAM-TGGGAGGGGGATCGCGATCT-BHQ CGYTGGATGCGNTTYCATGA CCAACCCARCCATTRTACA CTGCCCGAATTYGTAAATGA CCAACCCARCCATTRTACA CARGARBCNATGTTYAGRTGGATGAG CCRCCNGCATRHCCRTTRTACAT CNTGGAGGGCGATCGCAA CCRCCNGCATRHCCRTTRTACAT TATTCAGATTGCAAATTAYAAT AAYTTCATYATTTTCATGCTCCT TATTTGTCTGTYACAGAACAATCAG AGGRGGTGGAAGYACTTCATTTGA CCAYCAGTTYATHAAG GCT CC TACCAVCGCTGRACRTC CTC CTG GCRTYACWACTGC GGRTGRTTCCAIARVACYTC CAAGGHTGGCGYTCKGTTGAGAC CCCTTRTCCTGCTGAGCRTTCTC TTMACWGTCRGCTCGCCATTGGC GYTCKGTTGAGACCWCBGGBGT ACACTCCCACCTCCCGCCAGTA AGGATGGGGTGGATRGGGGCAGAG GTACAAGGACATGCGGCG CCTTCGAAGGTCGCGGCRCGGTA GTACAAGGACATGCGGCG GGGGCAGAGAATCCRCTC AATCACTCCATGGGAAGCTCCT CCTARCGCYTGCACDGG CAGAAGAGCAACTCCATCGCAT GTRCTYCCWGTAGCRTCCTTAAC

ORF1-ORF2 junction

Hata, Kitajima, Tajiri-Utagawa, & Katayama (2014)

FAM: 6-carboxyfluorescein; TAMRA: 6-carboxytetramethylrhodamine; MGB: minor groove binder/non-fluorescent quencher; BHQ: black hole quencher.

in association with oysters consumption (Cho et al., 2016; Le Guyader et al., 2006; Lodo, Veitch, & Green, 2014; Ng et al., 2005; Rajko-Nenow, Keaveney, Flannery, Mc, & Dore, 2014; Simmons, Garbutt, Hewitt, & Greening, 2007; Woods, Calci, Marchant-Tambone, & Burkhardt, 2016) and their detection in bivalve molluscs has been extensively described in studies from different countries (Brake, Ross, Holds, Kiermeier, & McLeod, 2014; Diez-Valcarce et al., 2012; Hansman et al., 2008; Kittigul et al., 2016; Ma et al., 2013; Montazeri et al., 2015; Pavoni et al., 2013; Pepe et al., 2012; Rajko-Nenow, Keaveney, Flannery, O'Flaherty, & Dore, 2012) including one instance in Vietnam (Nguyen et al., 2018). Hepatotropic viruses, as HAV and HEV, are less common in bivalve molluscs. Large HAV epidemics, however, have been described (e.g. outbreak in Shanghai, China in 1988 with more than 290.000 cases; Halliday et al., 1991), and HAV is occasionally detected in bivalves from production areas and markets, and is involved in shellfish-associated outbreaks (Bosch et al., 2001; Boxman et al., 2016; Croci et al.,

2003; Manso & Romalde, 2013; Mesquita et al., 2011; Pontrelli et al., 2008; Shieh et al., 2007; Suffredini et al., 2017). With regard to HEV, involvement of seafood in virus transmission has been occasionally reported (Koizumi et al., 2004; Said et al., 2009) and has received increased attention recently (EFSA BIOHAZ Panel, 2017; King, Hewitt, & Perchec-Merien, 2018), particularly in relation to the evidence of a non-negligible occurrence of HEV in shellfish (Gao et al., 2015; La Rosa et al., 2018; Mesquita et al., 2016; O'Hara, Crossan, Craft, & Scobie, 2018; Romalde et al., 2018). Further to these viral hazards, several other enteric viruses have been described as contaminants in bivalve shellfish. Among these, both Astrovirus (AstV) and Aichi virus (AiV) were reported to occur with high prevalence and concentrations in sewage waters (Le Cann, Ranarijaona, Monpoeho, Le Guyader, & Ferre, 2004; Lodder, Rutjes, Takumi, & de Roda Husman, 2013; Pusch et al., 2005; Suffredini et al., 2019) therefore representing a potential risk for contamination of bivalve production areas. 2

Food Control 108 (2020) 106828

E. Suffredini, et al.

With an approximate 2.4 million tons of exported seafood per year (2013 FAOSTAT data; (FAO, FAOSTAT,)) and an equivalent value of 5.8 billion US dollars in 2015, the Socialist Republic of Vietnam is among the largest seafood exporters worldwide (WorldAtlas). Within this food category, bivalve shellfish represent a significant share (~4.6%) both for the international trade and the internal market (FAO). Nevertheless, and despite the evidences on viral contamination in bivalves, very little is known on the risk posed by the presence of viruses responsible for gastroenteritis or hepatic diseases in molluscs produced in Vietnam, persisting a substantial lack of data on their occurrence in such food. The aim of this study was to evaluate, through an intensive survey of molluscs marketed in Hanoi (Vietnam), both the occurrence and the quantitative levels of different viruses, including Norovirus (NoV genogroups I, II and IV), Hepatitis A virus (HAV), Hepatitis E virus (HEV), Astrovirus (AstV), and Aichi virus (AiV), in bivalve shellfish produced in Vietnam. In addition, molecular characterization of the detected viruses was performed to provide hindsight on the heterogeneity of circulating strains.

PCR inhibition was ruled out using external amplification controls (in vitro synthesized RNAs) and amplifications were considered acceptable if inhibition was ≤50%. Virus recovery from samples was assessed using the Mengovirus process control, according to Costafreda, Bosch, and Pinto (2006) with an extraction acceptability criterion of ≥1%. Samples that did not achieve the acceptable extraction efficiency underwent a second extraction process. Two negative PCR controls were included in each run. Analyses were performed on an ABI Prism 7700 SDS system (Applied Biosystems, Foster City, CA, US). 2.4. Sequencing and phylogenetic analysis Samples that were positive according to RT-(q)PCR underwent molecular typing by RT-nested-PCR followed by sequencing. Regions and primers used for molecular characterization are described in Table 1. Amplifications were carried out in a GeneAmp® PCR System 9600 (Applied Biosystems, US) and standard precautions were followed to prevent PCR contamination. Nested PCR products were visualized by gel electrophoresis (1.5% agarose gel) with Ethidium Bromide staining. All PCR products were purified using columns (BioLab, Italy) and were subjected to direct automated sequencing on both strands (BioFab Research, Italy). The raw forward and reverse ABI files were aligned and assembled into a consensus sequence using MEGA 7 software (Kumar, Stecher, & Tamura, 2016). The consensus sequences were submitted to BLAST analysis and, for NoV and HEV genotyping, to the corresponding RIVM Typing Tool (https://www.rivm.nl/mpf/ typingtool/norovirus/and https://www.rivm.nl/mpf/typingtool/hev/). For NoV sequences, phylogenetic relationship was inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model (Kimura, 1980) with Gamma distribution. The analysis involved 16 sequences from the study and 30 reference sequences for NoV GI, and 33 study sequences and 45 reference sequences for NoV GII. Sequences shorter than 200 bases (3 for NoV GI and 9 for NoV GII) were removed from the alignments. Codon positions in the analysis were 1st +2nd+3rd + noncoding and a total of 257 positions and 214 positions were included in NoV GI and NoV GII final datasets, respectively. Evolutionary analyses were conducted in MEGA 7 (Kumar et al., 2016). Nucleotide sequences obtained in this study were deposited in GenBank under the accession numbers MN122707-MN122725 and MN122777MN123746.

2. Materials and methods 2.1. Sampling Bivalve shellfish samples were taken fortnightly over a nine months period (October 2015–June 2016) in four retail points, two fish markets and two supermarkets, in Hanoi, Vietnam. Whenever possible, at each sampling, one Pacific oyster (Crassostrea gigas) and one white hard clam (Meretrix lyrata) sample were collected, for a total of 63 oyster and 58 clam samples. Bivalve shellfish were shipped under refrigerated conditions to the laboratory where they underwent analysis within 24 h of collection. 2.2. Sample preparation and nucleic acids extraction Samples were prepared according to ISO 15216–1:2017 (ISO, 2017). Briefly, a minimum of 10 individuals were shucked with a sterile knife and digestive glands were dissected, cleaned and finely chopped. Aliquots of 2.0 g, spiked with 10 μl of titrated Mengovirus process control strain MC0 (1.6 × 104 TCID50/ml), were digested with 2 ml of proteinase K (0.1 mg/ml) at 37 °C for 60 min with shaking and then placed at 60 °C for 15 min. Finally, the samples were centrifuged at 3000×g for 5 min, the supernatant was collected and its volume was recorded. Nucleic acid extraction and purification were performed on 500 μl of supernatant using the NucliSens MiniMag extraction system (bioMérieux, France) following the manufacturer's instructions. RNA was eluted in 100 μl and stored at below −75 °C prior to real time RT(q)PCR analysis. A negative extraction control (molecular grade water) was added to each batch of sample extraction.

2.5. Statistical analysis Prevalence of target viruses was calculated for the samples as a whole and for separate groups (e.g. oysters vs. clams and supermarkets vs. fish markets). For the quantitative results, the average (mean value) of the positive samples was calculated. Values below the LOQ (2.3 × 102 genome copies [g.c.]/g for HAV, 1.4 × 102 for NoV GI, 1.3 × 102 for NoV GII, 2.8 × 102 for HEV and 2.2 × 102 for AstV) were included in the calculations without modifications. The Fisher's exact test and the chi-square test, and the Student's t-test were performed to compare significance of differences among prevalence values and means, respectively. All statistical calculations were done using the Excel add-in tool XlStat v 2019.1.1 (Addinsoft, Boston, US).

2.3. Real time RT-(q)PCR Virus detection was carried out using the RT-(q)PCR assays summarized in Table 1. For HAV, NoV GI and NoV GII, the conditions reported in ISO 15216–1:2017 annexes were applied (ISO, 2017). For HEV analysis, the primers and probes designed by Garson et al. (2012) and Jothikumar, Cromeans, Robertson, Meng, and Hill (2006) and the PCR conditions described by Di Pasquale et al. (2019) were used. AstV were tested according to Le Cann et al. (2004), while AiV and NoV GIV were detected using primers, probes and conditions described by Kitajima et al. (2013) and Muscillo et al. (2013) respectively. All reactions were prepared using the RNA UltraSense™ One-Step qRTPCR System (Life Technologies) and the average concentration of two replicate reactions were used for quantification for all targets excluding AiV and NoV GIV that were assessed qualitatively. Linearized plasmids containing the target sequence were used to generate standard curves (acceptability criteria: slope lying between −3.1 and −3.6 and a R2 ≥ 0.98).

3. Results The results of virus detection are reported in Table 2. Norovirus was the most frequently observed virus (81.8% of samples), with NoV GI and NoV GII detected in 50.4% and 79.3% of samples respectively. Detection of HEV, AstV and AiV also occurred in a considerable proportion of samples and approximately at the same rate (in detail, 11.6% for HEV, 12.4% for AstV and 11.6% for AiV), while, compared to the other viruses, prevalence of HAV was notably lower (1.7% of samples). Finally, NoV GIV was not found in the tested samples. Contamination by at least one virus was found in 83.5% of samples, while 52.9% of 3

Food Control 108 (2020) 106828

E. Suffredini, et al.

Table 2 Prevalence of enteric viruses in relation to bivalve shellfish species, sampling point and sampling season. N° of tested samples

Positive samples (%) HAV

NoVGI

NoVGII

NoVtot

HEV

AstV

AiV

NoVGIV

Species Crassostrea gigas Meretrix lyrata

63 58

0 (0.0) 2 (3.4)

33 (52.4) 28 (48.3)

47 (74.6) 49 (84.5)

49 (77.8) 50 (86.2)

6 (9.5) 8 (13.8)

5 (7.9) 10 (17.2)

2 (3.2) 12 (20.7)

0 (0.0) 0 (0.0)

Sampling point Fish market Supermarket

64 57

1 (1.6) 1 (1.8)

32 (50.0) 29 (50.9)

48 (75.0) 48 (84.2)

50 (78.1) 49 (86.0)

6 (9.4) 8 (14.0)

7 (10.9) 8 (14.0)

4 (6.3) 10 (17.5)

0 (0.0) 0 (0.0)

Sampling season Autumn Winter Spring

31 33 57

0 (0.0) 2 (6.1) 0 (0.0)

15 (48.4) 18 (54.5) 28 (49.1)

28 (90.3) 29 (87.9) 39 (68.4)

28 (90.3) 29 (87.9) 42 (73.7)

6 (19.4) 2 (6.1) 6 (10.5)

6 (19.4) 4 (12.1) 5 (8.8)

5 (16.1) 6 (18.2) 3 (5.3)

0 (0.0) 0 (0.0) 0 (0.0)

Total

121

2 (1.7%)

61 (50.4%)

96 (79.3%)

99 (81.8%)

14 (11.6%)

15 (12.4%)

14 (11.6%)

0 (0.0%)

NoVtot represents the total number of samples in which NoVGI and/or NoVGII were detected.

samples were contaminated by more than one virus (data not shown). Virus detection was more frequent in white hard clams (Meretrix lyrata) than in Pacific oysters (Crassostrea gigas) and in samples collected from supermarkets compared to samples from fish markets, though the differences were not statistically significant (Fisher's exact test p > 0.05) for all comparisons with the exclusion of AiV occurrence, that was significantly higher in white hard clams (p = 0.003). Differences in virus detection depending on sampling period (autumn, winter or spring) were also not statistically significant (chi-square test p > 0.05) with the only exception of NoV GII, whose prevalence was higher in autumn (chi-square = 7.89, p = 0.019). Molecular characterization of the positive samples provided a total of 19 and 40 sequences for the capsid region of NoV GI and NoV GII respectively, 3 sequences for the ORF1 (methyltransferase gene) of HEV, 6 for human AstV and 15 for AiV (10 with nested protocol A and 5 with both nested protocol A and B). No sequence could be obtained for either HAV or ORF2 (capsid) of HEV. NoV analysis revealed the presence, during the sampling period, of at least four genotypes for NoV GI: GI.2 (n = 2 sequences), GI.4 (n = 1), GI.5 (n = 11) and GI.6 (n = 5). Nine genotypes were instead identified for NoV GII: GII.3 (n = 21), GII.4 (n = 4, three of which subtyped as the Sydney_2012 variant), GII.6 (n = 1), GII.7 (n = 1), GII.13 (n = 3), GII.14 (n = 1), GII.17 (n = 3, all matching with the Kawasaki 2014 variant), and GII.21 (n = 1), plus the swine genotype GII.18 (n = 6). The phylogenetic tree based on the partial ORF2 region of the sequenced samples is shown in Fig. 1 panel A (NoV GI) and panel B (NoV GII). With regard to the other viruses, all the three HEV-positive samples were typed as G3, though subtyping could not be achieved due to the lack of amplification in ORF2, while the six AstV-positive samples were all typed as Human Astrovirus 1 (HAstV-1) with high nucleotide identity (≥99.5%) with two GenBank sequences (MK108183 and MH318028) from clinical specimens collected in central Russia. Three AiV-1 (human Aichi virus) genotype A sequences were obtained using the nested protocol A; all the remaining amplifications obtained with the same protocol were related to viruses with variable levels of identity to Canine Kobuviruses (94.9%–99.3% nt identity) or Feline Kobuviruses (93.9%–95.5% nt identity). Further studies are needed to clarify the significance of these viruses and of their high prevalence in bivalve shellfish. Viral loads in the tested samples were highly variable depending on virus of interest (Table 3). Overall, hepatotropic viruses showed the lowest virus concentrations, HAV-positive samples being on average 1.3 × 102 g.c./g (range < LOQ - 2.3 × 102 g.c./g) and HEV-positive samples 1.2 × 102 g.c./g (range < LOQ - 7.3 × 102 g.c./g). On the contrary, both NoV and AstV were present at significant concentrations. The average amount of total NoV (NoV GI plus NoV GII) in positive samples was 3.8 × 103 g.c./g, ranging from values < LOQ to 2.8 × 104 g.c./g, and AstV were detected at an average concentration of 1.5 × 103 g.c./g (range < LOQ - 8.4 × 103 g.c./g). In NoV-positive

samples, the prevalent contribution to the viral load was provided by NoV GII, whose values were higher than for NoV GI in the vast majority of samples (Fig. 2). Similarly to prevalence results, statistically significant differences were not found in the average viral load depending on shellfish species and sampling point (t Student test p > 0.05 for all comparisons), while a significant difference was found between the levels of NoV detected in autumn and spring (t Student test p = 0.020 for NoV GII and p = 0.025 for total NoV). 4. Discussion Viral contamination of bivalve molluscs is an extensively document food safety issue. Dispersion of viruses in shellfish production environments may happen following discharge of untreated or inappropriately treated sewage and persistence of viruses through the depuration treatments applied to bivalves (McLeod, Polo, Le Saux, & Le Guyader, 2017; Polo et al., 2014) may lead to commercialization of contaminated products. Management of the risk associated to the presence of viral contaminants in shellfish requires proper knowledge of viruses’ occurrence in the product and of their temporal and geographic variability and fluctuation, in order to set up appropriate monitoring systems and control measures. Additionally, outlining viral prevalence and predictable viral loads is of paramount importance to define appropriate pathogens reduction objectives in industrial thermal treatments (EFSA BIOHAZ Panel, 2015; Messens et al., 2017) applied to products, as pre-cooked shellfish, of interest for international trade. In this study, the prevalence and loads of several important viral pathogens were investigated in bivalve molluscs commercialized in Vietnam. The occurrence of enteric viruses was relevant and consistent during the observed period, with 83.5% of samples showing contamination by at least one virus and 52.9% of samples contaminated by more than one viral type. NoV represented the most important viral contaminant, being present in 81.8% of the tested samples. According to available reports, prevalence of NoV in bivalve molluscs lies within the range of 0%–95.6% depending on country (Razafimahefa, Ludwig-Begall, & Thiry, 2019), with significant variations among and within the different continents. Studies performed in the United States, for example, provided an estimate of NoV prevalence in bivalve shellfish of 3.9% at retail level (DePaola et al., 2010), while highly divergent values were reported in surveys on production areas in Oceania, with a less than 2% prevalence in Australia (Torok et al., 2018) and 29.7% in New Zealand (Greening & McCoubrey, 2010). Similarly, a significant variability of NoV prevalence is reported in the European area. High prevalences are indeed found in Nordic countries (95.6% and 76.2% in production areas in Ireland and UK, respectively, and 68.7% in UK at market level) (Lowther, Gustar, Powell, Hartnell, & Lees, 2012; Lowther, Gustar, 4

Food Control 108 (2020) 106828

E. Suffredini, et al.

Fig. 1. Phylogenetic tree of the partial ORF2 sequence of NoV positive samples The phylogenetic trees of NoV GI (panel A) and NoV GII (panel B) were inferred by using the Maximum Likelihood method based on the Kimura 2-parameter model with Gamma distribution. The analysis involved 46 nucleotide sequences for NoV GI and 78 for NoV GII. Codon positions included were 1st+2nd +3rd + noncoding; a total of 257 positions and 214 positions were respectively included in NoV GI and NoV GII final datasets. Evolutionary analyses were conducted in MEGA 7.

Powell, O'Brien, & Lees, 2018; Rajko-Nenow et al., 2012). Slightly lower figures are reported in production areas from the Iberian peninsula, where NoV were detected in 49.4% and 52.4% of samples from Galicia (Manso & Romalde, 2013; Polo, Varela, & Romalde, 2015) and in 37% of batches in Portugal (Mesquita et al., 2011), and in production areas from the Mediterranean basin (51.5% in Italy, 48% in Montenegro and 35% in Tunisia; Elamri, Aouni, Parnaudeau, & Le Guyader, 2006; Ilic et al., 2017; Suffredini et al., 2014). A low prevalence (9%) was instead found in oysters marketed in France (Schaeffer, Le Saux, Lora, Atmar, & Le Guyader, 2013). Interestingly, a recently performed harmonized European baseline survey on NoV in oysters showed that, at least in this bivalve species, NoV prevalence is lower than previously reported in most of the national studies (34.5% in production areas, 10.8% at dispatch center level; EFSA, 2019). In Asian countries, NoV detection in bivalve shellfish has been reported at variable rates: 0% in

Fig. 1. (continued)

5

Food Control 108 (2020) 106828

E. Suffredini, et al.

Table 3 Viral loads expressed as the average of positive samples in relation to bivalve shellfish species, sampling point and sampling season. Average concentration of enteric viruses [range minimum – maximum] (genome copies/g)

Species Crassostrea gigas Meretrix lyrata Sampling point Fish market Supermarket Sampling season Autumn Winter Spring Total

HAV

NoVGI

NoVGII

NoVtot

HEV

AstV

– 1.3 × 102 [ < LOQ - 2.3 × 102]

5.0 × 102 [ < LOQ - 4.5 × 103] 4.3 × 102 [ < LOQ - 3.2 × 103]

3.7 × 103 [ < LOQ - 2.8 × 104] 3.4 × 103 [ < LOQ - 1.9 × 104]

3.9 × 103 [ < LOQ - 2.8 × 104] 3.6 × 103 [ < LOQ - 2.0 × 104]

8.9 × 101 [ < LOQ - 3.1 × 102] 1.5 × 102 [ < LOQ - 7.3 × 102]

9.0 × 102 [ < LOQ - 1.8 × 103] 1.8 × 103 [ < LOQ - 8.4 × 103]

2.3 × 102 – 3.6 × 101 –

7.0 × 102 [ < LOQ - 4.5 × 103] 2.2 × 102 [ < LOQ - 1.0 × 103]

2.8 × 103 [ < LOQ - 1.9 × 104] 4.4 × 103 [ < LOQ - 2.8 × 104]

3.1 × 103 [ < LOQ - 2.0 × 104] 4.4 × 103 [ < LOQ - 2.8 × 104]

1.6 × 102 [ < LOQ - 7.3 × 102] 9.4 × 101 [ < LOQ - 3.1 × 102]

9.6 × 102 [ < LOQ - 2.2 × 103] 2.1 × 103 [1.9 × 102–8.4 × 103]

–

3.5 × 102 [ < LOQ - 3.2 × 103] 3.1 × 102 [ < LOQ - 9.5 × 102] 6.4 × 102 [ < LOQ - 4.5 × 103]

5.7 × 103 [ < LOQ - 2.8 × 104] 3.5 × 103 [ < LOQ - 1.9 × 104] 2.1 × 103 [ < LOQ - 1.3 × 104]

5.9 × 103 [ < LOQ - 2.8 × 104] 3.7 × 103 [ < LOQ - 2.0 × 104] 2.4 × 103 [ < LOQ - 1.3 × 104]

2.2 × 102 [ < LOQ - 7.3 × 102] 3.8 × 101 [ < LOQ] 4.5 × 101 [ < LOQ]

1.0 × 103 [ < LOQ - 3.1 × 103] 1.3 × 103 [7.4 × 102–2.1 × 103] 2.5 × 103 [2.9 × 102–8.4 × 103]

4.7 × 102 [ < LOQ - 4.5 × 103]

3.8 × 103 [ < LOQ - 2.8 × 104]

3.8 × 103 [ < LOQ - 2.8 × 104]

1.2 × 102 [ < LOQ - 7.3 × 102]

1.5 × 103 [ < LOQ - 8.4 × 103]

1.3 × 102 [ < LOQ - 2.3 × 102] – 1.3 × 102 [ < LOQ - 2.3 × 102]

NoVtot represents the sum of NoVGI and NoVGII viral loads detected in each sample. LOQ values (g.c./g) were as follows: 2.3 × 102 for HAV, 1.4 × 102 for NoV GI, 1.3 × 102 for NoV GII, 2.8 × 102 for HEV and 2.2 × 102 for AstV.

India (Umesha, Bhavani, Venugopal, Karunasagar, & Krohne, 2008), ~20% in South Korea and China (Seo et al., 2014; Tao et al., 2018), 25%–54% in Japan (Hansman et al., 2008; Phan et al., 2007) and up to 38% in Thailand (Kittigul, Pombubpa, Sukonthalux, Rattanatham, & Utrarachkij, 2011). To our knowledge, no data were previously available for NoV prevalence in marketed bivalve shellfish in Vietnam. In the present study NoV GII was detected more often than GI (79.3% versus 50.4%). This result is in line with those reported by other Authors (Bigoraj, Kwit, Chrobocinska, & Rzezutka, 2014; Ilic et al., 2017; Le Guyader et al., 2009; Loutreul et al., 2014; Mesquita et al., 2011; Rodriguez-Manzano et al., 2014; Suffredini et al., 2014; Tao et al., 2018) although other studies reported higher prevalence of NoV GI in bivalve shellfish (Gentry, Vinje, Guadagnoli, & Lipp, 2009; Kittigul et al., 2011, 2016; Lowther et al., 2012, 2018) or reversed proportions depending on sampling sites or sampling years (RajkoNenow et al., 2012; Romalde et al., 2018). These variations may likely reflect the shifting equilibrium between the periodical fluctuations of NoV in the human population, in which NoV GII is usually predominant

(Cannon et al., 2017; van Beek et al., 2018), the genotype and strain specific stability (Pogan, Schneider, Reimer, Hansman, & Uetrecht, 2018; Samandoulgou, Hammami, Morales Rayas, Fliss, & Jean, 2015) in the widely changing environmental conditions of seawater, and the differential bioaccumulation of NoV genotypes in bivalves based on ligands expression in shellfish (Le Guyader, Atmar, & Le Pendu, 2012; Maalouf et al., 2010). Interestingly, our results revealed circulation of a wide variety of NoV, including the global-spread and re-emerging GII.4 Sydney_2012 (Cannon et al., 2017; Ruis et al., 2017; van Beek et al., 2018) and the novel GII.17 Kawasaki 2014 variant (Chan et al., 2017; de Graaf et al., 2015) previously occasionally described in bivalve shellfish (La Rosa et al., 2017; Pu et al., 2016; Rasmussen, Schultz, Uhrbrand, Jensen, & Fischer, 2016), as well as genotype GII.3 that, with the aforementioned GII.4, has been frequently detected in recent years in the pediatric population in Vietnam (Hoa-Tran et al., 2017). Further to these, other genotypes were detected as GII.7, GII.14 and GII.21 that, according to molecular surveillance systems running in Europe and United States,

Fig. 2. Boxplot distribution of viral concentrations in positive samples. 6

Food Control 108 (2020) 106828

E. Suffredini, et al.

are overall uncommon in human cases (Cannon et al., 2017; van Beek et al., 2018). These data may indicate a characteristic epidemiology of NoV genotypes in Vietnam, with circulation in the human population (and consequently discharge in surface and sea-waters) of NoV genotypes that are not frequent in other countries, and whose introduction in largely susceptible populations may pose an increased risk for foodborne outbreaks, secondary transmission or infection of vulnerable individuals (elderly, children, etc.). In addition to the above mentioned human genotypes, a relevant number of sequences (n = 6) showed the presence in bivalve shellfish of the NoV swine genotype GII.18. This result points toward the release in shellfish production areas of slurries from livestock production settlements and requires further study for confirmation. Concerning the quantitative levels of NoV, this study confirmed that NoV GII concentrations in bivalve shellfish are usually higher than those of NoV GI (Lowther et al., 2012; Suffredini et al., 2014). The overall NoV contamination levels herein observed (average 3.8 × 103 g.c./g, range from < LOQ to 2.8 × 104 g.c./g) are comparable with those from European countries (Li, Stals, Tang, & Uyttendaele, 2014; Lowther et al., 2012; Polo et al., 2015; Suffredini et al., 2014), and Asian countries as Japan (Nishida et al., 2003) and China (Ma et al., 2013; Tan et al., 2018), though other studies provided lower (Benabbes et al., 2013; Le Guyader et al., 2009; Montazeri et al., 2015; Schaeffer et al., 2013) or higher (up to 106 g.c./g) estimates of NoV loads maximum concentrations in bivalves (Tao et al., 2018). With regard to the other viral contaminants, HAV prevalence (1.7%) is in line with the values (ranging between 0.9% and 3.8%) reported in studies from Italy and Thailand (Kittigul et al., 2010; Namsai et al., 2011; Suffredini et al., 2015) and significantly lower than those reported in other countries with intermediate endemicity (Elamri et al., 2006; Manso & Romalde, 2013; Mesquita et al., 2011). As seroprevalence studies carried on in the ‘90 (Hau et al., 1999; Katelaris et al., 1995) provided evidence of high circulation of HAV in rural areas of Vietnam (more than 95% of 5year-olds were anti HAV IgG positive), such a low virus prevalence in bivalve shellfish may reflect a shift of Vietnam towards a lower endemicity, as previously reported for other fast-growing Asian economies (Jacobsen & Koopman, 2004), and as hinted by a recent cohort study on febrile episodes in children in different Asian countries, in which HAV was not detected in Vietnam (Capeding et al., 2013). Quantitative analysis of positive samples, also provided a clear indication toward a low HAV contamination in bivalve shellfish, being the viral loads ≤2.3 × 102 g.c./ g. On the contrary, detection of HEV in 11.6% of samples placed molluscs marketed in Vietnam in the upper bound of reported prevalence data, whose values range from 0% to 17.5% (Gao et al., 2015; Grodzki et al., 2014; La Rosa et al., 2018; Mesquita et al., 2016; Namsai et al., 2011; O'Hara et al., 2018). In particular, prevalence of HEV in Vietnamese bivalve molluscs appears to be notably higher compared to the results of surveys conducted on shellfish in other Asian countries as Thailand and South Korea, where HEV was not detected (Namsai et al., 2011; Seo et al., 2014), and approaches that reported for bivalves from Bohai gulf in China (Gao et al., 2015). Despite a low viral load in positive samples (average contamination 1.2 × 102 g.c./g), the high prevalence and the molecular characterization data, showing that all typeable samples belonged to the G3 genotype, support the hypothesis of a widespread circulation of HEV in the environment, either in relation to HEV endemicity (Berto et al., 2018) or as a consequence of pig farming activities. As far as AstV and AiV are concerned, both viruses displayed a relevant prevalence (12.4% and 11.6%, respectively). To our knowledge, this is the first evidence of the presence of these viruses in a food product in South-East Asia. Interestingly, AstV loads (on average 1.5 × 103 g.c./g, with peaks up to 8.4 × 103 g.c./g) were in the same order of those observed for NoV, indicating a significant presence of these viruses in marine waters, in agreement with the considerable circulation of this group of viruses in Vietnam, where it represents the second most relevant cause of acute gastroenteritis in children (13.9% of cases) (Nguyen et al., 2008). A relation between results obtained in shellfish and epidemiological picture in the population was also present

for AiV, in which three positive samples were characterized as AiV-1 genotype A, corresponding to the only genotype detected in clinical specimens from Vietnam in a previous study (Pham et al., 2007). In the present work, the comparison of occurrence and viral loads in different species showed slightly higher values in clams (Meretrix lyrata) compared to oysters (Crassostrea gigas), though the differences were significant only when considering AiV contamination. As Crassostrea gigas are usually consumed raw, comparable prevalence and contamination levels represent a relatively higher risk in oysters than in clams. Further studies are also needed to confirm the uneven distribution of AiV among different shellfish species and the molecular mechanisms behind it. As for species, sampling point (either supermarket or fish market) showed no considerable impact on virus presence. This is in agreement with the concept of shellfish being typically contaminated during primary production (FAO/ WHO, 2008), while subsequent stages of the product distribution, if performed following hygiene criteria, should not alter significantly virus occurrence and levels. Notably, statistical analysis on sampling season (autumn, winter or spring) showed a significant difference between occurrence and levels of NoV in autumn and in spring, in agreement with the results of studies conducted in Europe on seasonal fluctuation of NoV contamination (Lowther et al., 2012, 2018; Suffredini et al., 2012). This result obtained for the “winter vomiting disease” (as NoV was referred to) is interesting considering that limited temperature variations are registered along the year in Vietnam (up to 15 °C in the North and less than 4 °C in South; source: Timeanddate.com), while other environmental factors (e.g. rain precipitations) may play an important role and contribute to seasonal fluctuations of NoV in the environment in Vietnam. In conclusion, this is the first study to provide quantitative information on the occurrence of several enteric viruses in bivalve shellfish marketed in Vietnam and to genetically characterize the detected strains. These data will help outlining monitoring plans on production areas and marketed products and will support setting up of appropriate control measures. Acknowledgements This research was financially supported by the Ministry of Science and Technology of Vietnam (grant no. 06/2014/HĐ-NĐT) and the Italian Ministry of Foreign Affairs and International Cooperation (Project PGR00159). References van Beek, J., de Graaf, M., Al-Hello, H., Allen, D. J., Ambert-Balay, K., Botteldoorn, N., et al. (2018). Molecular surveillance of norovirus, 2005-16: An epidemiological analysis of data collected from the NoroNet network. The Lancet Infectious Diseases. https://doi.org/10.1016/S1473-3099(18)30059-8. Bellou, M., Kokkinos, P., & Vantarakis, A. (2013). Shellfish-borne viral outbreaks: A systematic review. Food and Environmental Virology, 5(1), 13–23. https://doi.org/10. 1007/s12560-012-9097-6. Benabbes, L., Ollivier, J., Schaeffer, J., Parnaudeau, S., Rhaissi, H., Nourlil, J., et al. (2013). Norovirus and other human enteric viruses in moroccan shellfish. Food and Environmental Virology, 5(1), 35–40. https://doi.org/10.1007/s12560-012-9095-8. Berto, A., Pham, H. A., Thao, T. T. N., Vy, N. H. T., Caddy, S. L., Hiraide, R., et al. VIZIONS consortium. (2018). Hepatitis E in southern Vietnam: Seroepidemiology in humans and molecular epidemiology in pigs. Zoonoses Public Health, 65(1), 43–50. https:// doi.org/10.1111/zph.12364. Bigoraj, E., Kwit, E., Chrobocinska, M., & Rzezutka, A. (2014). Occurrence of norovirus and hepatitis A virus in wild mussels collected from the Baltic Sea. Food and Environmental Virology, 6(3), 207–212. https://doi.org/10.1007/s12560-014-9153-5. Bosch, A., Sánchez, G., Le Guyader, F., Vanaclocha, H., Haugarreau, L., & Pintó, R. M. (2001). Human enteric viruses in Coquina clams associated with a large hepatitis A outbreak. Water Science and Technology, 43(12), 61–65. Boxman, I. L., Verhoef, L., Vennema, H., Ngui, S. L., Friesema, I. H., Whiteside, C., et al. (2016). International linkage of two food-borne hepatitis A clusters through traceback of mussels, The Netherlands, 2012. Euro Surveillance, 21(3), 30113. https://doi. org/10.2807/1560-7917.es.2016.21.3.30113. Brake, F., Ross, T., Holds, G., Kiermeier, A., & McLeod, C. (2014). A survey of Australian oysters for the presence of human noroviruses. Food Microbiology, 44, 264–270. https://doi.org/10.1016/j.fm.2014.06.012. Campos, C. J., Avant, J., Gustar, N., Lowther, J., Powell, A., Stockley, L., et al. (2015). Fate of human noroviruses in shellfish and water impacted by frequent sewage

7

Food Control 108 (2020) 106828

E. Suffredini, et al. pollution events. Environmental Science and Technology, 49(14), 8377–8385. https:// doi.org/10.1021/acs.est.5b01268. Campos, C. J., & Lees, D. N. (2014). Environmental transmission of human noroviruses in shellfish waters. Applied and Environmental Microbiology, 80(12), 3552–3561. https:// doi.org/10.1128/aem.04188-13. Cannon, J. L., Barclay, L., Collins, N. R., Wikswo, M. E., Castro, C. J., Magaña, L. C., et al. (2017). Genetic and epidemiologic trends of norovirus outbreaks in the United States from 2013 to 2016 demonstrated emergence of novel GII.4 recombinant viruses. Journal of Clinical Microbiology, 55(7), 2208–2221. https://doi.org/10.1128/JCM. 00455-17. Capeding, M. R., Chua, M. N., Hadinegoro, S. R., Hussain, I. I., Nallusamy, R., Pitisuttithum, P., et al. (2013). Dengue and other common causes of acute febrile illness in Asia: An active surveillance study in children. PLoS Neglected Tropical Diseases, 7(7), https://doi.org/10.1371/journal.pntd.0002331 e2331. Chan, M. C. W., Hu, Y., Chen, H., Podkolzin, A. T., Zaytseva, E. V., Komano, J., et al. (2017). Global spread of norovirus GII.17 Kawasaki 308, 2014-2016. Emerging Infectious Diseases, 23(8), https://doi.org/10.3201/eid2308.161138 1359-1354. Cho, H. G., Lee, S. G., Lee, M. Y., Hur, E. S., Lee, J. S., Park, P. H., et al. (2016). An outbreak of norovirus infection associated with fermented oyster consumption in South Korea, 2013. Epidemiology and Infection, 144(13), 2759–2764. https://doi.org/ 10.1017/S0950268816000170. Costafreda, M. I., Bosch, A., & Pinto, R. M. (2006). Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Applied and Environmental Microbiology, 72(6), 3846–3855. https://doi.org/10.1128/aem.02660-05. Croci, L., De Medici, D., Ciccozzi, M., Di Pasquale, S., Suffredini, E., & Toti, L. (2003). Contamination of mussels by hepatitis A virus: A public health problem in southern Italy. Food Control, 14, 559–563. DePaola, A., Jones, J. L., Woods, J., Burkhardt, W., 3rd, Calci, K. R., Krantz, J. A., et al. (2010). Bacterial and viral pathogens in live oysters: 2007 United States market survey. Applied and Environmental Microbiology, 76(9), 2754–2768. Di Pasquale, S., De Santis, P., La Rosa, G., Di Domenico, K., Iaconelli, M., Micarelli, G., et al. (2019). Quantification and genetic diversity of Hepatitis E virus in wild boar (Sus scrofa) hunted for domestic consumption in Central Italy. Food Microbiology, 82, 194–201. https://doi.org/10.1016/j.fm.2019.02.005. Diez-Valcarce, M., Kokkinos, P., Soderberg, K., Bouwknegt, M., Willems, K., de RodaHusman, A. M., et al. (2012). Occurrence of human enteric viruses in commercial mussels at retail level in three European countries. Food and Environmental Virology, 4(2), 73–80. https://doi.org/10.1007/s12560-012-9078-9. EFSA. (2019). Analysis of the European baseline survey of norovirus in oysters. EFSA Journal, 17(7), e05762. https://doi.org/10.2903/j.efsa.2019.5762. EFSA BIOHAZ Panel. (2015). Scientific opinion on the evaluation of heat treatments, different from those currently established in the EU legislation, that could be applied to live bivalve molluscs from B and C production areas, that have not been submitted to purification or relaying, in order to eliminate pathogenic microorganisms. EFSA Journal, 13(12), 76 4332. EFSA BIOHAZ Panel. (2017). Public health risks associated with hepatitis E virus (HEV) as a food-borne pathogen. Elamri, D. E., Aouni, M., Parnaudeau, S., & Le Guyader, F. S. (2006). Detection of human enteric viruses in shellfish collected in Tunisia. Letters in Applied Microbiology, 43(4), 399–404. https://doi.org/10.1111/j.1472-765X.2006.01978.x. FAO, FAOSTAThttp://www.fao.org/faostat/en/#home, Accessed date: 30 May 2019 30 June 2019. FAO/WHO. (2008). Viruses in food: Scientific advice to support risk management activitiesRome (Italy): FAO Meeting report. Fogeda, M., Avellon, A., Cilla, C. G., & Echevarria, J. M. (2009). Imported and autochthonous hepatitis E virus strains in Spain. Journal of Medical Virology, 81, 1743–1749. Gao, S., Li, D., Zha, E., Zhou, T., Wang, S., & Yue, X. (2015). Surveillance of hepatitis E virus contamination in shellfish in China. International Journal of Environmental Research and Public Health, 12(2), 2026–2036. https://doi.org/10.3390/ ijerph120202026. Garson, J. A., Ferns, R. B., Grant, P. R., Ijaz, S., Nastouli, E., Szypulska, R., et al. (2012). Minor groove binder modification of widely used TaqMan probe for hepatitis E virus reduces risk of false negative real-time PCR results. Journal of Virological Methods, 186(1–2), 157–160. https://doi.org/10.1016/j.jviromet.2012.07.027. Gentry, J., Vinje, J., Guadagnoli, D., & Lipp, E. K. (2009). Norovirus distribution within an estuarine environment. Applied and Environmental Microbiology, 75(17), 5474–5480. https://doi.org/10.1128/aem.00111-09. daSilva, A. K., Le Saux, J. C., Parnaudeau, S., Pommepuy, M., Elimelech, M., & Le Guyader, F. S. (2007). Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Applied and Environmental Micronbiology, 73(24), 7891–7897. de Graaf, M., van Beek, J., Vennema, H., Podkolzin, A. T., Hewitt, J., Bucardo, F., et al. (2015). Emergence of a novel GII.17 norovirus – end of the GII.4 era? Euro Surveillance, 20(26). Greening, G. E., & McCoubrey, D.-J. (2010). Enteric viruses and management of shellfish production in New Zealand. Food and Environmental Virology, 2(3), 167–175. https:// doi.org/10.1007/s12560-010-9041-6. Griffin, D. W., Donaldson, K. A., Paul, J. H., & Rose, J. B. (2003). Pathogenic human viruses in coastal waters. Clinical Microbiology Reviews, 16(1), 129–143. Grodzki, M., Ollivier, J., Le Saux, J. C., Piquet, J. C., Noyer, M., & Le Guyader, F. S. (2012). Impact of xynthia tempest on viral contamination of shellfish. Applied and Environmental Microbiology, 78(9), 3508–3511. https://doi.org/10.1128/aem. 07604-11. Grodzki, M., Schaeffer, J., Piquet, J. C., Le Saux, J. C., Cheve, J., Ollivier, J., et al. (2014).

Bioaccumulation efficiency, tissue distribution, and environmental occurrence of hepatitis E virus in bivalve shellfish from France. Applied and Environmental Microbiology, 80(14), 4269–4276. https://doi.org/10.1128/aem.00978-14. Halliday, M. L., Kang, L. Y., Zhou, T. K., Hu, M. D., Pan, Q. C., Fu, T. Y., et al. (1991). An epidemic of hepatitis A attributable to the ingestion of raw clams in Shanghai, China. The Journal of Infectious Diseases, 164(5), 852–859. Hansman, G. S., Oka, T., Li, T. C., Nishio, O., Noda, M., & Takeda, N. (2008). Detection of human enteric viruses in Japanese clams. Journal of Food Protection, 71(8), 1689–1695. Hata, A., Katayama, H., Kojima, K., Sano, S., Kasuga, I., Kitajima, M., et al. (2014). Effects of rainfall events on the occurrence and detection efficiency of viruses in river water impacted by combined sewer overflows. The Science of the Total Environment, 468–469, 757–763. https://doi.org/10.1016/j.scitotenv.2013.08.093. Hau, C. H., Hien, T. T., Tien, N. T., Khiem, H. B., Sac, P. K., Nhung, V. T., et al. (1999). Prevalence of enteric hepatitis A and E viruses in the Mekong River delta region of Vietnam. The American Journal of Tropical Medicine and Hygiene, 60(2), 277–280. Hoa-Tran, T. N., Nakagomi, O., Dao, A. T., Nguyen, A. T., Agbemabiese, C. A., Vu, H. M., et al. (2017). Molecular epidemiology of noroviruses detected in Vietnamese children with acute gastroenteritis from 2012 to 2015. Journal of Medical Microbiology, 66(1), 34–45. https://doi.org/10.1099/jmm.0.000417. Hoehne, M., & Schreier, E. (2006). Detection of Norovirus genogroup I and II by multiplex real-time RT- PCR using a 3’-minor groove binder-DNA probe. BMC Infectious Diseases, 6, 69. https://doi.org/10.1186/1471-2334-6-69. Ilic, N., Velebit, B., Teodorovic, V., Djordjevic, V., Karabasil, N., Vasilev, D., et al. (2017). Influence of environmental conditions on norovirus presence in mussels harvested in Montenegro. Food and Environmental Virology, 9(4), 406–414. https://doi.org/10. 1007/s12560-017-9298-0. ISO. (2017). ISO 15216-1 Microbiology of food and animal feed - horizontal method for determination of hepatitis A virus and norovirus in food using real-time RT-PCR - Part 1: Method for quantification. Jacobsen, K. H., & Koopman, J. S. (2004). Declining hepatitis A seroprevalence: A global review and analysis. Epidemiology and Infection, 132(6), 1005–1022. https://doi.org/ 10.1017/s0950268804002857. Jorgensen, C. B. (1996). Bivalve filter feeding revisited Marine. Ecology Progress Series, 142, 287–302. Jothikumar, N., Cromeans, T. L., Robertson, B. H., Meng, X. J., & Hill, V. R. (2006). A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of Virological Methods, 131(1), 65–71. https://doi.org/10. 1016/j.jviromet.2005.07.004. Kageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, S., Hoshino, F. B., ... Katayama, K. (2003). Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. Journal of Clinical Microbiology, 41, 1548–1557. Katelaris, P. H., Robertson, G., Bradbury, R., Tippett, G., Hoa, D. Q., & Ngu, M. C. (1995). Seroprevalence of hepatitis viruses in children in rural Viet Nam. Transactions of the Royal Society of Tropical Medicine and Hygiene, 89(5), 487. https://doi.org/10.1016/ 0035-9203(95)90077-2. Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2), 111–120. King, N. J., Hewitt, J., & Perchec-Merien, A. M. (2018). Hiding in plain sight? It's time to investigate other possible transmission routes for hepatitis E virus (HEV) in developed countries. Food and Environmental Virology, 10(3), 225–252. https://doi.org/10. 1007/s12560-018-9342-8. Kitajima, M., Hata, A., Yamashita, T., Haramoto, E., Minagawa, H., & Katayama, H. (2013). Development of a reverse transcription-quantitative PCR system for detection and genotyping of aichi viruses in clinical and environmental samples. Applied and Environmental Microbiology, 79(13), 3952–3958. https://doi.org/10.1128/AEM. 00820-13. Kittigul, L., Pombubpa, K., Sukonthalux, S., Rattanatham, T., & Utrarachkij, F. (2011). Noroviruses in oysters from local markets and oyster farms in southern Thailand. Southeast Asian Journal of Tropical Medicine and Public Health, 42(1), 105–113. Kittigul, L., Pombubpa, K., Sukonthalux, S., Rattanatham, T., Utrarachkij, F., & Diraphat, P. (2010). Detection of hepatitis A virus and bacterial contamination in raw oysters in Thailand. Southeast Asian Journal of Tropical Medicine and Public Health, 41(1), 105–113. Kittigul, L., Thamjaroen, A., Chiawchan, S., Chavalitshewinkoon-Petmitr, P., Pombubpa, K., & Diraphat, P. (2016). Prevalence and molecular genotyping of noroviruses in market oysters, mussels, and cockles in bangkok, Thailand. Food and Environmental Virology, 8(2), 133–140. https://doi.org/10.1007/s12560-016-9228-6. Koizumi, Y., Isoda, N., Sato, Y., Iwaki, T., Ono, K., Ido, K., et al. (2004). Infection of a Japanese patient by genotype 4 hepatitis e virus while traveling in Vietnam. Journal of Clinical Microbiology, 42(8), 3883–3885. https://doi.org/10.1128/jcm.42.8.38833885.2004. Kojima, S., Kageyama, T., Fukushi, S., Hoshino, F. B., Shinohara, M., Uchida, K., ... Katayama, K. (2002). Genogroup-specific PCR primers for detection of Norwalk-like viruses. Journal of Virological Methods, 100, 107–114. Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7), 1870–1874. https://doi.org/10.1093/molbev/msw054. La Rosa, G., Della Libera, S., Iaconelli, M., Proroga, Y. T. R., De Medici, D., Martella, V., et al. (2017). Detection of norovirus GII.17 Kawasaki 2014 in shellfish, marine water and underwater sewage discharges in Italy. Food and Environmental Virology, 9(3), 326–333. https://doi.org/10.1007/s12560-017-9290-8. La Rosa, G., Muscillo, M., Vennarucci, V. S., Garbuglia, A. R., La Scala, P., & Capobianchi, M. R. (2011). Hepatitis E virus in Italy: molecular analysis of travel-related and

8

Food Control 108 (2020) 106828

E. Suffredini, et al. autochthonous cases. Journal of General Virology, 92, 1617–1626. La Rosa, G., Proroga, Y. T. R., De Medici, D., Capuano, F., Iaconelli, M., Della Libera, S., et al. (2018). First detection of hepatitis E virus in shellfish and in seawater from production areas in southern Italy. Food and Environmental Virology, 10(1), 127–131. https://doi.org/10.1007/s12560-017-9319-z. Le Cann, P., Ranarijaona, S., Monpoeho, S., Le Guyader, F., & Ferre, V. (2004). Quantification of human astroviruses in sewage using real-time RT-PCR. Research in Microbiology, 155(1), 11–15. https://doi.org/10.1016/j.resmic.2003.09.013. Le Guyader, F. S., Atmar, R. L., & Le Pendu, J. (2012). Transmission of viruses through shellfish: When specific ligands come into play. Current Opinion in Virology, 2(1), 103–110. https://doi.org/10.1016/j.coviro.2011.10.029. Le Guyader, F. S., Bon, F., DeMedici, D., Parnaudeau, S., Bertone, A., Crudeli, S., et al. (2006). Detection of multiple noroviruses associated with an international gastroenteritis outbreak linked to oyster consumption. Journal of Clinical Microbiology, 44(11), 3878–3882. https://doi.org/10.1128/jcm.01327-06. Le Guyader, F. S., Parnaudeau, S., Schaeffer, J., Bosch, A., Loisy, F., Pommepuy, M., et al. (2009). Detection and quantification of noroviruses in shellfish. Applied and Environmental Microbiology, 75(3), 618–624. https://doi.org/10.1128/aem.01507-08. Li, D., Stals, A., Tang, Q. J., & Uyttendaele, M. (2014). Detection of noroviruses in shellfish and semiprocessed fishery products from a Belgian seafood company. Journal of Food Protection, 77(8), 1342–1347. https://doi.org/10.4315/0362-028x. jfp-14-016. Lodder, W. J., Rutjes, S. A., Takumi, K., & de Roda Husman, A. M. (2013). Aichi virus in sewage and surface water, The Netherlands. Emerging Infectious Diseases, 19(8), 1222–1230. https://doi.org/10.3201/eid1908.130312. Lodo, K. L., Veitch, M. G., & Green, M. L. (2014). An outbreak of norovirus linked to oysters in Tasmania. Communicable Disease Intell Quarternary Reports, 38(1), E16–E19. Loisy, F., Atmar, R. L., Guillon, P., Le Cann, P., Pommepuy, M., & Le Guyader, F. S. (2005). Real-time RT-PCR for norovirus screening in shellfish. Journal of Virological Methods, 123, 1–7. Loutreul, J., Cazeaux, C., Levert, D., Nicolas, A., Vautier, S., Le Sauvage, A. L., et al. (2014). Prevalence of human noroviruses in frozen marketed shellfish, red fruits and fresh vegetables. Food and Environmental Virology, 6(3), 157–168. https://doi.org/10. 1007/s12560-014-9150-8. Lowther, J. A., Gustar, N. E., Powell, A. L., Hartnell, R. E., & Lees, D. N. (2012). Two-year systematic study to assess norovirus contamination in oysters from commercial harvesting areas in the United Kingdom. Applied and Environmental Microbiology, 78(16), 5812–5817. https://doi.org/10.1128/aem.01046-12. Lowther, J. A., Gustar, N. E., Powell, A. L., O'Brien, S., & Lees, D. N. (2018). A one-year survey of norovirus in UK oysters collected at the point of sale. Food and Environmental Virology. https://doi.org/10.1007/s12560-018-9338-4. Maalouf, H., Zakhour, M., Le Pendu, J., Le Saux, J. C., Atmar, R. L., & Le Guyader, F. S. (2010). Distribution in tissue and seasonal variation of norovirus genogroup I and II ligands in oysters. Applied and Environmental Microbiology, 76(16), 5621–5630. https://doi.org/10.1128/aem.00148-10. Manso, C. F., & Romalde, J. L. (2013). Detection and characterization of hepatitis A virus and norovirus in mussels from Galicia (NW Spain). Food and Environmental Virology, 5(2), 110–118. https://doi.org/10.1007/s12560-013-9108-2. Ma, L. P., Zhao, F., Yao, L., Li, X. G., Zhou, D. Q., & Zhang, R. L. (2013). The presence of genogroup II norovirus in retail shellfish from seven coastal cities in China. Food and Environmental Virology, 5(2), 81–86. https://doi.org/10.1007/s12560-013-9102-8. McLeod, C., Polo, D., Le Saux, J. C., & Le Guyader, F. S. (2017). Depuration and relaying: A review on potential removal of norovirus from oysters. Comprehensive Reviews in Food Science and Food Safety, 16(4), 692–706. https://doi.org/10.1111/1541-4337. 12271. Mesquita, J. R., Oliveira, D., Rivadulla, E., Abreu-Silva, J., Varela, M. F., Romalde, J. L., et al. (2016). Hepatitis E virus genotype 3 in mussels (Mytilus galloprovinciallis), Spain. Food Microbiology, 58, 13–15. https://doi.org/10.1016/j.fm.2016.03.009. Mesquita, J. R., Vaz, L., Cerqueira, S., Castilho, F., Santos, R., Monteiro, S., et al. (2011). Norovirus, hepatitis A virus and enterovirus presence in shellfish from high quality harvesting areas in Portugal. Food Microbiology, 28(5), 936–941. https://doi.org/10. 1016/j.fm.2011.01.005. Messens, W., Fernandez-Escamez, P. S., Lees, D., Lindqvist, R., O'Mahony, M., Suffredini, E., et al. (2017). Thermal processing of live bivalve molluscs for controlling viruses: On the need for a risk-based design. Critical Reviews in Food Science and Nutrition, 1–12. https://doi.org/10.1080/10408398.2017.1338246. Montazeri, N., Maite, M., Liu, D., Cormier, J., Landry, M., Shackleford, J., et al. (2015). Surveillance of enteric viruses and microbial indicators in the eastern oysters (Crassostrea virginica) and harvest waters along Louisiana gulf coast. Journal of Food Science, 80(5), M1075–M1082. https://doi.org/10.1111/1750-3841.12871. Muscillo, M., Fratini, M., Graffeo, R., Sanguinetti, M., Martella, V., Green, K. Y., et al. (2013). GIV noroviruses in wastewaters and in stool specimens from hospitalized patients. Food and Environmental Virology. https://doi.org/10.1007/s12560-0139121-5. Namsai, A., Louisirirotchanakul, S., Wongchinda, N., Siripanyaphinyo, U., Virulhakul, P., Puthavathana, P., et al. (2011). Surveillance of hepatitis A and E viruses contamination in shellfish in Thailand. Letters in Applied Microbiology, 53(6), 608–613. https://doi.org/10.1111/j.1472-765X.2011.03152.x. Ng, T. L., Chan, P. P., Phua, T. H., Loh, J. P., Yip, R., Wong, C., et al. (2005). Oysterassociated outbreaks of Norovirus gastroenteritis in Singapore. Journal of Infection, 51(5), 413–418. https://doi.org/10.1016/j.jinf.2004.11.003. Nguyen, T. A., Hoang, L., Pham, l. D., Hoang, K. T., Mizuguchi, M., Okitsu, S., et al. (2008). Identification of human astrovirus infections among children with acute gastroenteritis in the Southern Part of Vietnam during 2005-2006. Journal of Medical Virology, 80(2), 298–305. https://doi.org/10.1002/jmv.21032. Nguyen, G. T., Pu, J., Miura, T., Ito, H., Kazama, S., Konta, Y., et al. (2018). Oyster

contamination with human noroviruses impacted by urban drainage and seasonal flooding in Vietnam. Food and Environmental Virology, 10(1), 61–71. https://doi.org/ 10.1007/s12560-017-9325-1. Nishida, T., Kimura, H., Saitoh, M., Shinohara, M., Kato, M., Fukuda, S., et al. (2003). Detection, quantitation, and phylogenetic analysis of noroviruses in Japanese oysters. Applied and Environmental Microbiology, 69(10), 5782–5786. Oh, D. Y., Silva, P. A., Hauroeder, B., Diedrich, S., Cardoso, D. D., & Schreier, E. (2006). Molecular characterization of the first Aichi viruses isolated in Europe and in South America. Archives of Virology, 151, 1199–1206. O'Hara, Z., Crossan, C., Craft, J., & Scobie, L. (2018). First report of the presence of hepatitis E virus in scottish-harvested shellfish purchased at retail level. Food and Environmental Virology, 10(2), 217–221. https://doi.org/10.1007/s12560-0189337-5. Okamoto, H., Takahashi, M., Nishizawa, T., Fukai, K., Muramatsu, U., & Yoshikawa, A. (2001). Analysis of the complete genome of indigenous swine hepatitis E virus isolated in Japan. Biochemical and Biophysical Research Communications, 289, 929–936. Pavoni, E., Consoli, M., Suffredini, E., Arcangeli, G., Serracca, L., Battistini, R., et al. (2013). Noroviruses in seafood: A 9-year monitoring in Italy. Foodbourne Pathogens & Disease, 10(6), 533–539. https://doi.org/10.1089/fpd.2012.1399. Pepe, T., Ventrone, I., Suffredini, E., Ceruso, M., Croci, L., Anastasio, A., et al. (2012). Norovirus monitoring in bivalve molluscs harvested and commercialized in southern Italy. Journal of Food Protection, 75(5), 976–981. https://doi.org/10.4315/0362028x.jfp-11-424. Pham, N. T., Khamrin, P., Nguyen, T. A., Kanti, D. S., Phan, T. G., Okitsu, S., et al. (2007). Isolation and molecular characterization of Aichi viruses from fecal specimens collected in Japan, Bangladesh, Thailand, and Vietnam. Journal of Clinical Microbiology, 45(7), 2287–2288. https://doi.org/10.1128/JCM.00525-07. Phan, T. G., Khamrin, P., Akiyama, M., Yagyu, F., Okitsu, S., Maneekarn, N., et al. (2007). Detection and genetic characterization of norovirus in oysters from China and Japan. Clinical Laboratory, 53(7–8), 405–412. Pogan, R., Schneider, C., Reimer, R., Hansman, G., & Uetrecht, C. (2018). Norovirus-like VP1 particles exhibit isolate dependent stability profiles. Journal of Physics: Condensed Matter, 30(6), https://doi.org/10.1088/1361-648X/aaa43b 064006. Polo, D., Alvarez, C., Diez, J., Darriba, S., Longa, A., & Romalde, J. L. (2014). Viral elimination during commercial depuration of shellfish. Food Control, 43, 206–212. https://doi.org/10.1016/j.foodcont.2014.03.022. Polo, D., Varela, M. F., & Romalde, J. L. (2015). Detection and quantification of hepatitis A virus and norovirus in Spanish authorized shellfish harvesting areas. International Journal of Food Microbiology, 193, 43–50. https://doi.org/10.1016/j.ijfoodmicro. 2014.10.007. Pontrelli, G., Boccia, D., M, D. I. R, Massari, M., Giugliano, F., Celentano, L. P., et al. (2008). Epidemiological and virological characterization of a large community-wide outbreak of hepatitis A in southern Italy. Epidemiology and Infection, 136(8), 1027–1034. https://doi.org/10.1017/s095026880700951x. Pu, J., Kazama, S., Miura, T., Azraini, N. D., Konta, Y., Ito, H., et al. (2016). Pyrosequencing analysis of norovirus genogroup II distribution in sewage and oysters: First detection of GII.17 Kawasaki 2014 in oysters. Food and Environmental Virology, 8(4), 310–312. https://doi.org/10.1007/s12560-016-9261-5. Pusch, D., Oh, D. Y., Wolf, S., Dumke, R., Schroter-Bobsin, U., Hohne, M., et al. (2005). Detection of enteric viruses and bacterial indicators in German environmental waters. Archives of Virology, 150(5), 929–947. Rajko-Nenow, P., Keaveney, S., Flannery, J., Mc, I. A., & Dore, W. (2014). Norovirus genotypes implicated in two oyster-related illness outbreaks in Ireland. Epidemiology and Infection, 142(10), 2096–2104. https://doi.org/10.1017/s0950268813003014. Rajko-Nenow, P., Keaveney, S., Flannery, J., O'Flaherty, V., & Dore, W. (2012). Characterisation of norovirus contamination in an Irish shellfishery using real-time RT-qPCR and sequencing analysis. International Journal of Food Microbiology, 160(2), 105–112. https://doi.org/10.1016/j.ijfoodmicro.2012.10.001. Rasmussen, L. D., Schultz, A. C., Uhrbrand, K., Jensen, T., & Fischer, T. K. (2016). Molecular evidence of oysters as vehicle of norovirus GII.P17-GII.17. Emerging Infectious Diseases, 22(11), 2024–2025. https://doi.org/10.3201/eid2211.161171. Razafimahefa, R. M., Ludwig-Begall, L. F., & Thiry, E. (2019). Cockles and mussels, alive, alive, oh—the role of bivalve molluscs as transmission vehicles for human norovirus infections. Transboundary and Emerging Diseases, 0(0), https://doi.org/10.1111/tbed. 13165. Rodriguez-Manzano, J., Hundesa, A., Calgua, B., Carratala, A., Maluquer de Motes, C., Rusiñol, M., et al. (2014). Adenovirus and norovirus contaminants in commercially distributed shellfish. Food and Environmental Virology, 6(1), 31–41. https://doi.org/ 10.1007/s12560-013-9133-1. Rodriguez, R. A., Gundy, P. M., Rijal, G. K., & Gerba, C. P. (2012). The impact of combined sewage overflows on the viral contamination of receiving waters. Food and Environmental Virology, 4(1), 34–40. https://doi.org/10.1007/s12560-011-9076-3. Romalde, J. L., Rivadulla, E., Varela, M. F., & Barja, J. L. (2018). An overview of 20 years of studies on the prevalence of human enteric viruses in shellfish from Galicia, Spain. Journal of Applied Microbiology, 124(4), 943–957. https://doi.org/10.1111/jam. 13614. Ruis, C., Roy, S., Brown, J. R., Allen, D. J., Goldstein, R. A., & Breuer, J. (2017). The emerging GII.P16-GII.4 Sydney 2012 norovirus lineage is circulating worldwide, arose by late-2014 and contains polymerase changes that may increase virus transmission. PLoS One, 12(6), https://doi.org/10.1371/journal.pone.0179572 e0179572. Said, B., Ijaz, S., Kafatos, G., Booth, L., Thomas, H. L., Walsh, A., et al. (2009). Hepatitis E incident investigation team. Emerging Infectious Diseases, 15(11), 1738–1744. https:// doi.org/10.3201/eid1511.091094 Hepatitis E outbreak on cruise ship. Samandoulgou, I., Hammami, R., Morales Rayas, R., Fliss, I., & Jean, J. (2015). Stability of secondary and tertiary structures of virus-like particles representing noroviruses: Effects of pH, ionic strength, and temperature and implications for adhesion to

9

Food Control 108 (2020) 106828

E. Suffredini, et al. surfaces. Applied and Environmental Microbiology, 81(22), 7680–7686. https://doi. org/10.1128/AEM.01278-15. Santo Domingo, J., & Edge, T. (2010). Identification of primary sources of faecal pollution. In G. Rees, K. Pond, D. Kay, J. Bartram, & J. Santo Domingo (Eds.). Safe management of shellfish and harvest waters (pp. 51–90). London, United Kingdom: IWA Publishing. Scallan, E., Hoekstra, R. M., Angulo, F. J., Tauxe, R. V., Widdowson, M. A., Roy, S. L., et al. (2011). Foodborne illness acquired in the United States–major pathogens. Emerging Infectious Diseases, 17(1), 7–15. Schaeffer, J., Le Saux, J. C., Lora, M., Atmar, R. L., & Le Guyader, F. S. (2013). Norovirus contamination on French marketed oysters. International Journal of Food Microbiology, 166(2), 244–248. https://doi.org/10.1016/j.ijfoodmicro.2013.07.022. Seo, D. J., Lee, M. H., Son, N. R., Seo, S., Lee, K. B., Wang, X., et al. (2014). Seasonal and regional prevalence of norovirus, hepatitis A virus, hepatitis E virus, and rotavirus in shellfish harvested from South Korea. Food Control, 41, 178–184. https://doi.org/10. 1016/j.foodcont.2014.01.020. Shieh, Y. C., Khudyakov, Y. E., Xia, G., Ganova-Raeva, L. M., Khambaty, F. M., Woods, J. W., et al. (2007). Molecular confirmation of oysters as the vector for hepatitis A in a 2005 multistate outbreak. Journal of Food Protection, 70(1), 145–150. Shrestha, S. M., Shrestha, S., Tsuda, F., Nishizawa, T., Gotanda, Y., Takeda, N., & Okamoto, H. (2003). Molecular investigation of hepatitis E virus infection in patients with acute hepatitis in Kathmandu, Nepal. Journal of Medical Virology, 69, 207–214. Simmons, G., Garbutt, C., Hewitt, J., & Greening, G. (2007). A New Zealand outbreak of norovirus gastroenteritis linked to the consumption of imported raw Korean oysters. N Z Med J, 120(1264), U2773. Suffredini, E., Ciccaglione, A., Rizzo, C., La Rosa, G., Capuano, F., Proroga, Y. T. R., et al. (2015). Multidisciplinary approach in the investigation of a Hepatitis A outbreak and in the management of HAV contaminated shellfish production areas - campania Region, Italy, 2015. Paper presented at the 13° national congress of the Italian society for virology (SIV), orvieto, Italy. Suffredini, E., Iaconelli, M., Vicenza, T., Bonanno Ferraro, G., Sonnessa, M., Mancini, P., et al. (2019). Molecular detection of Aichi virus in urban wastewaters in Italy. (in preparation). Suffredini, E., Lanni, L., Arcangeli, G., Pepe, T., Mazzette, R., Ciccaglioni, G., et al. (2014). Qualitative and quantitative assessment of viral contamination in bivalve molluscs harvested in Italy. International Journal of Food Microbiology, 184, 21–26. https://doi. org/10.1016/j.ijfoodmicro.2014.02.026. Suffredini, E., Magnabosco, C., Civettini, M., Rossetti, E., Arcangeli, G., & Croci, L. (2012). Norovirus contamination in different shellfish species harvested in the same production areas. Journal of Applied Microbiology, 113(3), 686–692. https://doi.org/10. 1111/j.1365-2672.2012.05356.x. Suffredini, E., Proroga, Y. T. R., Di Pasquale, S., Di Maro, O., Losardo, M., Cozzi, L., et al. (2017). Occurrence and trend of hepatitis a virus in bivalve molluscs production areas following a contamination event. Food and Environmental Virology. https://doi.

org/10.1007/s12560-017-9302-8. Svraka, S., Duizer, E., Vennema, H., de Bruin, E., van der Veer, B., Dorresteijn, B., & Koopmans, M. (2007). Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005. Journal of Clinical Microbiology, 45(5), 1389–1394. Taffon, S., Bidini, G., Vichi, F., Corti, G., Genovese, D., Kondili, L. A., ... Rapicetta, M. (2011). A unique HAV strain circulated in patients with acute HAV infection with different risk exposures in Tuscany, Italy. Journal of Clinical Virology, 50, 142–147. Tan, D. M., Lyu, S. L., Liu, W., Zeng, X. Y., Lan, L., Qu, C., et al. (2018). Utility of droplet digital PCR assay for quantitative detection of norovirus in shellfish, from production to consumption in guangxi, China. Biomedical and Environmental Sciences, 31(10), 713–720. https://doi.org/10.3967/bes2018.096. Tao, J., Chunhui, H., Fanning, S., Nan, L., Jiahui, W., Hongyuan, Z., et al. (2018). Norovirus contamination in retail oysters from Beijing and Qingdao, China. Food Control, 86, 415–419. Timeanddatecom Weather in Vietnam. Retrieved from https://www.timeanddate.com/ weather/vietnam, Accessed date: 30 June 2019. Torok, V., Hodgson, K., McLeod, C., Tan, J., Malhi, N., & Turnbull, A. (2018). National survey of foodborne viruses in Australian oysters at production. Food Microbiology, 69, 196–203. https://doi.org/10.1016/j.fm.2017.08.014. Trujillo, A. A., McCaustland, K. A., Zheng, D. P., Hadley, L. A., Vaughn, G., Adams, S. M., ... Monroe, S. S. (2006). Use of TaqMan real-time reverse transcription-PCR for rapid detection, quantification, and typing of norovirus. Journal of Clinical Microbiology, 44, 1405–1412. Umesha, K. R., Bhavani, N. C., Venugopal, M. N., Karunasagar, I., & Krohne, G. (2008). Prevalence of human pathogenic enteric viruses in bivalve molluscan shellfish and cultured shrimp in south west coast of India. International Journal of Food Microbiology, 122(3), 279–286. https://doi.org/10.1016/j.ijfoodmicro.2007.12.024. Varela, M. F., Polo, D., & Romalde, J. L. (2016). Prevalence and genetic diversity of human sapoviruses in shellfish from commercial production areas in Galicia, Spain. Applied and Environmental Microbiology, 82(4), 1167–1172. https://doi.org/10.1128/ AEM.02578-15. Venugopal, V., & Gopakumar, K. (2017). Shellfish: Nutritive value, health benefits, and consumer safety. Comprehensive Reviews in Food Science and Food Safety, 16(6), 1219–1242. https://doi.org/10.1111/1541-4337.12312. WHO (2012). WHO position paper on hepatitis A vaccines - June 2012. Weekly Epidemiological Record, 87(28/29), 261–276. Woods, J. W., Calci, K. R., Marchant-Tambone, J. G., & Burkhardt, W., 3rd (2016). Detection and molecular characterization of norovirus from oysters implicated in outbreaks in the US. Food Microbiology, 59, 76–84. https://doi.org/10.1016/j.fm. 2016.05.009. WorldAtlas Top fish and seafood exporting countries. Retrieved from https://www. worldatlas.com/articles/top-fish-and-seafood-exporting-countries.html, Accessed date: 30 June 2019.

10