Simplified procedure for detection of enteric pathogenic viruses in shellfish by RT-PCR

Journal of Virological Methods 90 (2000) 1 – 14 www.elsevier.com/locate/jviromet

Simplified procedure for detection of enteric pathogenic viruses in shellfish by RT-PCR O. Legeay, Y. Caudrelier, C. Cordevant, L. Rigottier-Gois, M. Lange * Ser6ice R&D, Institut Pasteur de Lille, 1 rue du Professeur Calmette, BP 245, 59019 Lille Cedex, France Received 9 December 1999; received in revised form 24 March 2000; accepted 27 March 2000

Abstract Epidemiological evidence linking the transmission of enteric viral disease to shellfish has been known for a long time. A variety of methods have been described for the detection of viral contaminants in shellfish using RT-PCR. However, these methods generally include numerous, often fastidious and time consuming steps for virus release from shellfish tissues and viral RNA isolation. A simplified procedure based on the enzymatic liquefaction of shellfish digestive tissues without any mechanical homogenisation step, followed by a simple clarification of the lysate using dichloromethane extraction, was developed. Viral RNA is isolated directly from the shellfish extract by a guanidium thiocyanate-silica extraction method, adapted for the use of a vacuum manifold system. Virus-specific RT-PCR assays were set up for detection of genomic sequences of the predominant viral pathogens, HAV, Astrovirus and Norwalk-like viruses (from genogoups I or II). The specificity of the amplicons is confirmed finally by hybridisation with DIG-labelled specific probes. The overall procedure applied to shellfish samples spiked with HAV particles allowed a detection of 20 pfu of HAV per g of hepatopancreas. In addition, up to 20 samples can be tested within 24 h. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Shellfish; HAV; Astrovirus; Norwalk-like viruses; RT-PCR; Dot-blot

1. Introduction Human disease transmission due to the consumption of shellfish contaminated by viruses was first recognised in 1956 with the report of a large outbreak of clam-associated hepatitis A. Since then, epidemiological evidence linking the transmission of enteric viral disease, mainly hepatitis * Corresponding author. Tel.: +33-320-877208; fax: + 33320-877206. E-mail address: [email protected] (M. Lange).

and gastroenteritis, to shellfish has continued to increase (Gerba, 1988; Jaykus, 1997). This has contributed to public concern about shellfish safety. Currently, the sanitary quality control of marketable shellfish is based on analysis of the level of faecal-pollution bacterial indicators in shellfish or in growing-waters. However, the reliability of these micro-organisms as an indicator of viral pollution has been widely questioned (Le Guyader et al., 1993; Toti et al., 1998), emphasised by occurrence of viral outbreaks associated with consumption of shellfish meeting the legal

0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0166-0934(00)00174-9

2

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

bacteriological standards (Desenclos et al., 1991; CDC, 1994; Daurat, 1994). This has stressed the need to develop methods allowing the direct detection of viral contaminants in shellfish. Nucleic acid-based techniques, especially RTPCR, have emerged rapidly as the methods of choice allowing rapid, specific and sensitive detection of enteric viruses (RNA viruses) in environmental samples. Furthermore, hepatitis A virus (HAV), Norwalk-like viruses and Astrovirus, recognised as the predominant enteric viruses linked epidemiologically to shellfish-associated viral diseases (Richards, 1985), were hardly detectable when using the traditional virological methods such as cell culture. The crucial point concerning the application of RT-PCR resides in the processing of shellfish samples. It requires the manipulation of a large sample volume because of the low copy number of viral nucleic acid usually present. It requires too an efficient elimination of inhibitory substances from shellfish prior to RNA amplification. A variety of methods have been investigated for processing the shellfish samples, all including several steps towards separation of virus particles from shellfish tissues before viral RNA purification and amplification (Sobsey et al., 1978; Yang and Xu, 1993; Lees et al., 1994; Atmar et al., 1995; Le Guyader et al., 1996; Cromeans et al., 1997; Traore et al., 1998; Croci et al., 1999). Two general schemes, designated extraction-concentration and adsorption-elutionconcentration, are used. A variety of extraction techniques has been described, such as clarification in presence of different buffers, flocculation using polyelectrolytes or extraction by organic solvents. Similarly, several concentration techniques may be used, such as flocculation in presence of PEG, precipitation by lowering the pH, ultrafiltration. The adsorption-elution scheme relies on the control of pH and ionic conditions. Such methods generally imply combination of these different techniques and are preceded in all cases by a mechanical homogenisation of shellfish, which is a possible source of cross contaminations. A simplified procedure based on the enzymatic liquefaction of shellfish digestive tissues with no

mechanical homogenisation step, followed by clarification of the lysate using organic solvent extraction, and direct viral RNA isolation from shellfish extract was developed. This procedure allows the processing of multiple shellfish samples simultaneously with a minimum of equipment and limited risk of cross-contaminations. The nucleic acid extract obtained can then be used for detection of any viral sequence. Thus, the detection of genomic sequences of the predominant viral contaminants: HAV, Astrovirus and the main genogroups (I and II) (Hafliger et al., 1997) of Norwalk-like viruses was achieved using specific RT-PCR assays combined with dot-blot hybridisation.

2. Material and methods

2.1. Virus strain HAV strain HM175/18f, purchased from the American Type Culture Collection, Maryland USA (ATCC VR-1402), was propagated in FRhK4 cells (fetal kidney cell of rhesus monkey, ATCC CRL-1688) and assayed for plaque formation. The Astrovirus (serotype 1) strain was kindly provided by Pr. H. Laveran (CHU-Clermont Ferrand, France) and propagated on CaCo-2 cells (human colon adenocarcinoma cell, ATCC HTB37).

2.2. Shellfish contamination Mussels and oysters, purchased at a local market, were shucked and an excision of the digestive tissues (or hepatopancreas) was carried out. Adsorption assays were carried out by addition of viral dilutions, from 1 to 106 pfu of HAV, to 5-g samples of shellfish hepatopancreas which were then incubated for 1 h at room temperature. Bioaccumulation of HAV was identified in aquariums, containing 10–15 mussels in 4 l of aerated sea water, spiked with 102, 103 or 104 pfu of HAV/ml (final concentration). Each viral in-

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

oculum was prepared in 5 ml of sterile PBS (phosphate buffered saline), pH 7.4 supplemented with 1% of montmorillonite (Fluka). Mussels were observed for viability prior to inoculation and kept in the aquariums for 24 h. They were then rinsed, shucked and the hepatopancreas were excised.

2.3. Proteases Eight commercial proteases, usually used in large amounts in food industry, were provided by Gist –Brocades (Seclin, France) and Novo – Nordisk (Bagsvaerd, Denmark) for homogenisation assays of shellfish tissues. Absence of RNase activity in protease preparations was checked using a commercial kit (EnzChek RNase Gel assay, Molecular Probes, Oregon, USA). Briefly, protease solution was incubated for 30 min at room temperature with a MS2 RNA phage substrate, then subjected to agarose gel electrophoresis, followed by staining with SYBR green II RNA dye for checking integrity of the RNA substrate. In addition, buffers used to dilute proteases were treated with diethyl pyrocarbonate (DEPC) to inhibit RNases.

2.4. Viral RNA isolation The RNA extraction procedure was based on the method reported by Boom et al. (1990) relying on (i) lysis of cell membranes and viral capsids, using a lysis solution (5 M guanidinium thiocyanate, 0.02 M EDTA and Triton X 100 1.3% w/v, in Tris–HCl buffer 0.1 M, pH 6.4) and binding of nucleic acids on a silica based resin; (ii) washing of the RNA-silica complex by centrifugation-resuspension steps with a guanidinium thiocyanate based solution (5 M guanidinium thiocyanate in Tris– HCl buffer 0.1 M, pH 6.4), 70% ethanol and 80% acetone; (iii) final elution with RNase free water. This method was modified in order to allow the use of a vacuum system instead of the centrifugation – resuspension technique applied for the washing steps. A vacuum manifold allowing 20 RNA extractions simultaneously was used (Vac-Man Laboratory Vacuum Manifold, Promega Corp.).

3

2.5. Primers and probes Oligonucleotide primer and probe sequences used in this study for the specific RT-PCR and for hybridisation detection assays are detailed in Table 1. HAV and Astrovirus primer and probe sequences were derived from published studies (Deng et al., 1994; Belliot et al., 1997) and located in the highly conserved VP3-VP1 region of HAV genomic sequences and in the ORF1a sequence of Astrovirus serotypes 1–8. For Norwalk like viruses (NLV), a multiple alignment of published RNA polymerase sequences from genogroup I (NLV I) and genogroup II (NLV II) was obtained using NCBI blast search and GeneJockey II (Biosoft, Ltd.) programs and allowed the identification of consensus regions for each genogroup. Degenerated primers and probe sequences, specific for each Norwalk-like virus genogroup, were then designed using the primer analysis software OLIGO 5 (National Bioscience, Inc.) and experimentally tested on viral genomic sequences representative of the NLV I and NLV II groups.

2.6. Synthesis of RNA positi6e controls Molecular constructs containing partial genomic sequences, including RT-PCR targeted regions, from HAV, Astrovirus and viruses representative of NLV I and NLV II, were obtained by TA-cloning of amplified fragments, 719, 1302, 1024 and 1110-bp long respectively, into pGEM-T vectors (Promega Corp.), following the manufacturer’s instructions. Cloned plasmids, containing HAV, Astrovirus, NLV I and NLV II sequences were called pHAV5, pASV1, pSV1 and pMX4, respectively. For HAV, the template used was a plasmid containing the full genomic sequence of the HAV strain HM175 (Cohen et al., 1987), kindly provided by Dr C. Wychowski (Institut de Biologie de Lille, France). For NLVs, templates used were plasmids containing partial genomic sequences from Southampton virus (Lambden et al., 1995), representative of NLV I, kindly provided by Dr Ian Clarke (University Medical School, Southampton, UK) and from Mexico virus (Jiang et al., 1995), representative of NLV II and kindly provided by Dr Xi Jiang

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

4

(Center for Paediatric Research, Norfolk, USA). The Astrovirus genomic fragment was obtained by RT-PCR, using the Access RT-PCR system (Promega Corp.) on viral RNA extracted

from Astrovirus (serotype 1) strain infected cells. Oligonucleotide primer sequences used for amplification of inserts are summarised in Table 2.

Table 1 Oligonucleotide primer and probe sequences used in RT-PCR and hybridisation detection assaysa Name

Sequence

HAV HAVU2167 HAVL2413 HAVs2233 (probe)

GTTTTGCTCCTCTTTACCATGCTATG GGAAATGTCTCAGGTACTTTCTTTG TCAACAACAGTTTCTACAGA

Astro6irus ASV340MOn ASV348MON ASVSGB (probe)

CGTCATTATTTGTTGTCATACT ACATGTGCTGCTGTTACTATG GARATCCGTGATGCTAATGG

Norwalk like 6irus genogroup I NVLI410U24 NVLI839L20 NVLIs776 (probe)

450 bp YTTYTCHTTYTAYGGKGATGATGA GAASCGCATCCARCGGAACA TRAYTTCMTGKATGACYYTGC

RNA polymerase

Norwalk like 6irus genogroup II NVLII184U23 NVLII738L20 NVLIIS448 (probe)

574 bp CARYGGAACTCCAYYRCCCACTG TGCGATCGCCCTCCCAYGTG GTMACCCGTGAYCCAGCWGG

RNA polymerase

a

RT-PCR product length

Genomic sequences targeted

247 bp

VP3-VP1 genes

289 bp

ORF1a

Gene

Gene

The RT-PCR product length, as well as specific genomic sequences targeted are specified.

Table 2 Oligonucleotide primer sequences used for amplification of partial genomic fragments to clone into pGEM-T vectorsa Name

Sequence

Position

Reference sequence (Genbank accession no.)

HAV HAV2094 HAV2815

GATTGACCTCTCCTTCTAAC GTAATCTAATCTGAATGTTC

2094-2114 2795-2815

HM-175-HAV strain (M14707)

Astro6irus ASV883 ASV-1971

CCCTGGTACAGACTTGGTTA TACATCACTATCGCTGACACTTT

883-902 1993-1971

Astrovirus-type 1 (L23513)

Norwalk like 6irus genogroup I NVLI4622 ATCATGTGTCGGCTAACTGC NVLI5924 CCAGATCCCCCACCAGTA

4622-4641 5941-5924

Southampton virus (L07418)

Norwalk like 6irus genogroup II NVLII104 GGCAGCAGCACTTGA NVLII1109 AAGATGAGCCAAATAAGGAT

104-118 1128-1109

Mexico virus (U22498)

a

Oligonucleotide positions on reference viral sequences, identified by their name and Genbank accession number are mentioned.

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

RNA positive controls of each virus-specific RT-PCR detection assay were obtained by in vitro transcription. Therefore, plasmids were linearised with SalI (for pSV1) or NcoI (for pHAV5, pASV1 and pMX4) before transcription. T7 RNA polymerase (Promega Corp.) was then used to transcribe the NLV I RNA, while SP6 RNA polymerase (Promega Corp.) was used for transcription of HAV, Astrovirus and NLV II RNAs, in order to provide positive sense RNAs. Transcripts were purified using a RNA purification kit (RNeasy total RNA purification system, Qiagen S.A.) and plasmid DNA was removed by a DNase-I treatment. RNA was quantified by adsorption at 260 nm, then stored at −80°C in RNase-free water.

2.7. RT-PCR assays The one-tube Access RT-PCR system (Promega Corp.) was used. For each virus-specific RT-PCR detection assay, 5 ml of RNA sample was added to a 20 ml reaction mix containing 1× AMV/Tfl buffer, 200 mM each dNTP, 400 nM each specific primer (Table 1), 2.5 units each AMV-reverse transcriptase and Tfl-DNA polymerase. In addition, the concentration of MgSO4 were optimised at 1 mM for HAV and NLVII, 1.5 mM for NLV I and 2.5 mM for Astrovirus specific detection assays. RT-PCR assays were carried out with a GeneAmp PCR system 2400 (Perkin Elmer), following uninterrupted thermal cycling programmes consisting of 45 min at 48°C, 3 min at 94°C, 40 cycles of 30 s at 94°C and 30 s at 55°C (for HAV and NLV II RT-PCR assays) or 50°C (for Astrovirus and NLV I RT-PCR assays), and a final elongation step of 20 min at 68°C. The RT-PCR products, of 247, 289, 450 and 574 bp for HAV, Astrovirus, NLV I and NLV II, respectively, were separated by electrophoresis on a 2% agarose gel followed by ethidium bromide staining or detected with virus specific probes using a dot-blot hybridisation assay. A positive control (102 copies of virus-specific transcripts) and a negative control (water) were added systematically to each RT-PCR assay.

5

2.8. Dot-blot hybridisation assays Specific probes (Table 1) were labelled with digoxigenin using the DIG oligonucleotide 3%-end labelling kit (Boehringer Mannheim) as indicated by the manufacturer, and the signal of the DIGlabelled blots was detected by a colourimetric reaction using ingredients provided in the DIGnucleic acid detection kit (Boehringer Mannheim). Basically, for each virus specific detection assay, 1 ml of RT-PCR products was dotted directly onto N+ nylon membranes (Boehringer Mannheim, Inc.). Denaturation of the nucleic acids was achieved by soaking the membranes for 5 min in a freshly made denaturation solution (0.5 M NaOH, 1.5 M NaCl), then 5 min in neutralisation buffer (1.5 M NaCl, 0.5 M Tris–HCl, 1 mM EDTA, pH 7.2). Membranes were then air dried before fixing the nucleic acids by UV cross-linking (at 0.14 J/cm2). A prehybridization step was performed at 55°C for 1 h in 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), Nlauroylsarkosine 0.1%, SDS 0.02%, blocking reagent (Boehringer Mannheim) 1% and poly(A) 10 mg/ml, in order to block non-specific nucleic acids binding sites. Prehybridization solution was then renewed with fresh solution supplemented with heat denatured appropriate DIG-labelled probe (2.5 nM final concentration) and virus-specific hybridisations carried out at 55°C in an oven/shaker (Amersham, Life Science) for 8–16 h. The elimination of unbound or non-specifically bound probes was achieved by 2×5 min washes at room temperature in 2×SSC, SDS 0.1% followed by 2× 15 min washes at 55°C in 0.05× SSC, SDS 0.1%. Membranes were then equilibrated for 2 min at room temperature with maleic acid buffer (100 mM maleic acid, 150 mM NaCl; pH 7.5) and blocked with blocking solution (maleic acid buffer plus Blocking reagent 1%) for 30 min at room temperature before being incubated for 30 min at room temperature with fresh blocking solution containing 150 mU/ml of antiDIG-alkaline phosphatase conjugate. Membranes were washed again 3×15 min in maleic acid buffer to remove unbound conjugate and were then equilibrated for 2 min at room temperature in detection buffer (0.1 M Tris–HCl, 0.1 M NaCl,

6

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

pH 9.5, 50 mM MgCl2). Freshly prepared colour substrate solution (NBT/BCIP stock solution diluted 1/50th in detection buffer) was added and colour reaction was allowed to develop in the dark, at room temperature, for 1 h before being stopped by washing membranes in water. Blots were analysed visually after drying. Finally, specificity and sensitivity were confirmed by a positive control (500 pg dot of virus-specific RT-PCR product) and by the negative controls of hybridisation (water), RT-PCR and RNA isolation procedure.

3. Results

3.1. Shellfish processing Eight commercial proteases were tested for complete homogenisation of mussel or oyster tissues (full flesh or hepatopancreas). According to their pH activity range, enzymatic solutions were prepared by dilution of proteases in appropriate reaction buffers. Acetate buffer (0.2 M sodium acetate, acetic acid) was used at activity pH 3 and 5, phosphate buffer (0.2 M NaH2PO4, 0.2 M Na2HPO4) at pH 6 and borate buffer (0.1 M boric acid, 0.1 M NaOH, 0.1 M KCl) at pH 8 and 10. Final enzyme concentration of 5 or 10% (w/v or v/v of an initial standardised commercial preparation) were tested. Reaction volumes were optimised according to the weight and type of tissue to lyse (full flesh or hepatopancreas). Homogenisation of tissues was visually assessed, according to the apparent size of tissue debris present in solution, after 1, 3 or 15 h of incubation. A figure of the extent of the homogenisation was also obtained by weighting final cell debris pelleted (for 10 min, at 3000× g) after 15 h of incubation. In addition, compatibility of shellfish processing with viral RNA detection was evaluated by RTPCR after digestion of 1 g mussel hepatopancreas samples spiked with 106 pfu of HAV, followed by a chloroform extraction and application of the RNA isolation procedure. Enzymatic homogenisation of shellfish tissues was first assessed after incubation of either 5 g mussel flesh samples or 0.5 g mussel hepatopan-

creas samples, at 50°C, in different pH conditions and for different incubation times, using the eight proteases diluted 1/10th (w/v or v/v) in appropriate buffer. The results, summarised in Table 3, clearly showed that (i) hepatopancreas were generally homogenised more rapidly than full flesh and (ii) MPA-1B™ and BREWERS PROTEASE™ appeared to be more efficient than the other proteases tested. Activities of these two particular proteases were further optimised in presence of 5 g of either mussel or oyster hepatopancreas. Two points were considered, i.e. efficiency of shellfish tissue homogenisation as well as RT-PCR sensitivity for detection of viral RNA, isolated from HAV-spiked shellfish samples (data not shown). Conditions such as pH, temperature, incubation times, enzyme concentrations and reaction volume were tested. Both proteases gave equivalent performances with optimal results obtained at 56°C, pH 6.0, for 2 h, with 10 ml of protease solution (10%) added to 5 g samples of shellfish hepatopancreas. BREWERS PROTEASE™ being available in liquid form though, it appeared to be easiest to handle and to prevent RNase contamination. Indeed, absence of RNase activity, checked with EnzCheck-RNase Gel Assay (Molecular Probes), was reproducibly obtained with all tested preparations of BREWERS PROTEASE™ whereas MPA-1B™ preparations appeared to be occasionally contaminated by RNases (data not shown). Viral RNA was hardly detectable by RT-PCR when RNA was isolated directly from the crude lysate of HAV spiked shellfish extract. However, the sensitivity of detection was greatly improved when the lysate was clarified before RNA isolation (Fig. 1). Several combinations of organic solvent extraction procedures including extractions (v/v) once or twice with chloroform, once with phenol-chloroform plus once with chloroform, once with cethyl trimethyl ammonium bromide (CTAB) 0.1% chloroform plus once with chloroform and once or twice with dichloromethane were tested. Optimal detection was obtained after a double extraction (v/v) with either chloroform or dichloromethane. Dichloromethane was preferred to chloroform because of its lower toxicity.

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

7

Table 3 Shellfish homogenisation using industrial proteasesa Protease commercial names

pH tested

Flesh and Hepatopancreas homogenate appreciation after three incubation times 1h

SUMIZYME-AP200000™ (GB) SUMIZYME-AP75000™ (GB) MPA-1B™ (GB) BREWERS PROTEASE™ (GB) PANSTIMASE™ (GB) NEUTRASE™ (N) ALCALASE™ (N) DELVOLASE™ (GB)

3 5 3 5 6 8 6 8 6 8 6 8 8 10

3h

Pellet weight (g)

15 h

F

H

F

H

F

H

F

H

+ + + + + + + + + + + + + +

++ + ++ ++ +++ ++ +++ ++ + + + + + ++

+ + ++ ++ ++ + ++ + + + + ++ ++ +

+++ + +++ +++ +++ +++ +++ ++ + + ++ ++ ++ +++

+++ + +++ ++ +++ +++ +++ ++ ++ ++ + +++ ++ ++

+++ ++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++

1.7 2.2 1.2 0.9 1.1 3.0 1.3 0.9 1.8 1.0 ND 0.4 0.7 0.7

0.4 0.5 0.2 0.1 0.3 0.9 0.2 0.1 0.5 0.5 0.3 0.1 0.3 0.3

a Five grams mussel full flesh or 0.5 g mussel hepatopancreas samples were digested, respectively in 10 or 2 ml reaction mixtures containing one protease diluted 1/10th (v/v or w/v) in appropriate reaction buffer (according to the pH). Proteases commercialised by Gist–Brocades (GB) or Novo–Nordisk (N) are listed. Results show visual appreciation of homogenisation of full flesh (f) or hepatopancreas (h) after 1, 3 or 15 h incubation times, presented as large undigested tissue debris (+), few small sized undigested tissue debris (++), no visible undigested tissue debris (+++). The weight of the corresponding homogenate pellets, obtained after a 15 h incubation time and centrifugation at 3000×g during 10 min, are also shown.

Fig. 1. Effect of dichloromethane extraction on viral RNA detection by RT-PCR: 5 g mussel hepatopancreas samples were spiked with 0, 103 or 105 pfu of HAV. Mussel tissues were digested with the BREWERS PROTEASE™, then either directly submitted to the RNA isolation procedure with no solvent extraction (I) or submitted to a double dichloromethane extraction before RNA isolation (II). Electrophoresis on 2% agarose gel of RT-PCR products is shown. Lane M is a 100 bp ladder (Promega Corp.).

8

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

In conclusion, the optimal conditions for shellfish processing consist of the digestion of 5 g of mussel or oyster hepatopancreas during 2 h at 56°C, in 10 ml of BREWERS PROTEASE™ solution (10%) pH 6.0, followed by a double extraction (v/v) with dichloromethane.

Subcloning of partial genomic sequences from HAV (HM175 strain), Astrovirus (serotype 1 strain), NLV I representative (Southampton virus strain) and NLV II representative (Mexican virus strain) into pGEM-T vectors allowed the synthesis of pure RNA transcripts, 0.8, 1.1, 1.4 and 1.2 kb long, respectively (data not shown). This products appeared to be reproducible easily and quantifiable. Thus, these quantified transcripts could be used for setting up optimal conditions of each virus-specific RT-PCR assays. They were also used as positive controls for monitoring crucial steps of the procedure as RNA isolation and RT-PCR.

and 1 ml of lysis solution. The tube was vortexed then incubated on a rotated incubator for 20 min at room temperature. The mixture was transferred into a Wizard™ Minicolumn (Promega Corp.) fitted on the vacuum manifold system, where RNA bound to the resin could be washed successively with 1 ml of guanidinium thiocyanate washing solution, 2 ml of 70% ethanol and 1 ml of 80% isopropanol. Residual isopropanol was removed from the column by centrifugation (12 000 rpm, 2 min). RNA was then eluted in an RNase free microcentrifuge tube, by addition of 100 ml of prewarmed RNase free water, incubation at 80°C for 10 min with a final spin at 12 000 × g for 2 min. Optimised conditions led to a very efficient elimination of RT-PCR inhibitors (Fig. 2). A detection threshold of 102 to 103 copies present in 100 ml was obtained (data not shown) and thus, the addition of 104 copies (in 100 ml) of RNA transcript in lysis solution was chosen as positive control for monitoring potential interference on RT-PCR assays due to sample-specific inhibitors or to extraction procedure failure.

3.3. Viral RNA isolation

3.4. RT-PCR assays

The convenient system using microcolumns fitted on a vacuum manifold system was favoured to replace the centrifugation-resuspension of RNA-silica complex for washing steps. Therefore, several silica based resins, as silica or diatomaceous earth (Sigma) prepared as described by Boom et al. (1990), or ready to use resins, Wizard® DNA Clean-Up system (Promega Corp.), SV® Total RNA isolation system (Promega Corp.), RNaid® system (Bio101, Inc.) or RNeasy total RNA system (Qiagen, S.A.) were tested. The best results with regard to the compatibility with microcolumn-vacuum system and RNA yield recovery were obtained with the Wizard® DNA Clean-Up resin. In addition, acetone, which was used initially as a washing solution, appeared to be too corrosive for microcolumns and so was replaced by isopropanol. Finally, optimal conditions were obtained by pipetting 500 ml of shellfish extract into a reaction tube containing 500 ml of resin (Wizard™ DNA Clean up Resin from Wizard™ DNA Clean up system, Promega Corp.)

Four commercial one-tube RT-PCR system were tested. The Access RT-PCR system (from Promega Corp.) appeared to give the best results with regard to sensitivity in presence of shellfish extracts (data not shown). Primers used for the detection of HAV and Astrovirus were derived from validated studies (Apaire-Marchais et al., 1995; Belliot et al., 1997), whereas primers specific for NLV I and NLV II groups were designed from the result of multiple alignment of all sequences of NLV I and II coding for RNA polymerase, deposited in data banks. Conditions were optimised for each virus-specific RT-PCR assay, allowing the detection of as low as one to ten copies of transcript per ml of water on a 2% agarose gel or by dot-blot hybridisation assay (Fig. 3).

3.2. Virus-specific RNA positi6e control synthesis

3.5. Dot-blot hybridisation assays As for detection primers, internal probes used for the specific hybridisation of RT-PCR prod-

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

9

Fig. 2. RT-PCR inhibitors removal: four samples of 5 g mussel hepatopancreas were digested with the BREWERS PROTEASE™. Dichloromethane extraction and RNA isolation procedures were then either applied or omitted before RT-PCR. Electrophoresis on 2% agarose gel of HAV specific RT-PCR products obtained with 0, 10 and 103 copies of HAV transcript, in presence of water (W), of shellfish extract with no solvent extraction and no RNA isolation applied (I), shellfish extract with solvent extraction but no RNA isolation applied (II), shellfish extract with no solvent extraction but RNA isolation applied (III), shellfish extract with solvent extraction and RNA isolation applied (IV) is shown. Lane M is a 100 bp ladder (Promega Corp.).

Fig. 3. Sensitivity of virus-specific RT-PCR assays. Serial dilutions (from 104 to 1 copies/ml) of (1) HAV; (2) Astrovirus; (3) NLV I and (4) NLV II transcripts were amplified using optimal virus-specific RT-PCR conditions. Five microlitres of RT-PCR product were then loaded on a 2% agarose gel and separated by electrophoresis. Lane 0 correspond to RT-PCR negative controls. Lane M correspond to a 100 bp ladder (Promega Corp.).

10

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

Fig. 4. Outline scheme for the overall procedure. Shellfish hepatopancreas are excised and pooled for making 5 g samples. Samples are digested with BREWERS PROTEASE™ then clarified by dichloromethane extractions. For each shellfish extract, one 500 ml aliquot (i) was submitted to the viral RNA isolation procedure then to each virus-specific RT-PCR plus dot-blot assay and an other 500 ml aliquot (ii) was spiked with 104 copies of HAV transcript before being submitted to RNA isolation and HAV-specific RT-PCR plus dot-blot assay.

ucts, were derived from previous studies of HAV (Deng et al., 1994) and Astrovirus (Belliot et al., unpublished data) and designed from the multiple alignment of published sequences for NVL I and NLV II. The DIG nucleic acid labelling and detection system on membranes was used according to the manufacturer’s instructions, with some modifications. First, an alkaline denaturation on membranes of RT-PCR products showed better results (in sensitivity) than the DNA heat denaturation advised. Secondly, special effort was needed to remove residual background generated in presence of shellfish extract negative control. Highly stringent conditions were therefore used.

The hybridisation of the DIG-labelled specific probes was performed at 55°C and the subsequent washings including 2× 15 min at 55°C with SSC concentration as low as 0.05× were also required. The optimised conditions were used for all four virus-specific dot-blot hybridisation assays. Under these conditions, an average detection threshold of 500 pg of RT-PCR products was observed, which was 5–10 times the one observed using a 2% agarose ethidium bromide-stained gel. The overall procedure for the detection of viral sequences of HAV, Astrovirus, NLV I and NLV II in shellfish is outlined in Fig. 4, and allows analysis of up to 20 samples within 24 h. As low

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

as 102 pfu of HAV could be detected in 5-g hepatopancreas samples spiked with viral suspension of HAV. The results obtained with mussel samples are shown in Fig. 5, similar results being obtained with oysters. Furthermore, this procedure was applied to mussels naturally contaminated by bioaccumulation assays, performed in aquariums inoculated up to final concentrations of 104, 103 or 102 pfu of HAV per ml of seawater. Viral RNA was detected in all conditions (data not shown), demonstrating the efficiency of the procedure to extract virus (or viral RNA) from shellfish tissues contaminated in natural conditions.

4. Discussion The objective of this study was to develop a simple and rapid method for the molecular detection of viral pathogens in shellfish by RT-PCR. A variety of methods have already been described regarding shellfish tissue processing and isolation of viral RNA suitable for amplification (Le Guyader et al., 1994; Atmar et al., 1995; Jaykus et al., 1996; Hafliger et al., 1997; Lopez et al., 1997; Arnal et al., 1998; Croci et al., 1999). Most of these methods are complex. They generally include numerous, time consuming and fastidious steps for virus isolation from shellfish. In addition, they always require a mechanical homogeni-

Fig. 5. Sensitivity of the overall procedure: 5 g mussel hepatopancreas samples were either spiked with serial dilutions, from 105 to 10 pfu, of HAV, or not-contaminated (negative control), then were submitted to the overall procedure. Blot results of detection obtained from samples contaminated with 105 to 10 pfu of HAV are shown in the top lane, when controls, including non-contaminated shellfish sample (0 pfu), RNA isolation negative control (TE), RT-PCR assay negative control (RT− ), RNA isolation positive control (TE + ), as well as negative control (H2O) and positive control (50 and 5 ng) of hybridisation are shown in the bottom lane.

11

sation step using, most of the time, a Waring blender or an Omni-mixer. This initial step was considered to be limiting for analysis of multiple samples, especially due to the high risk of crosscontaminations. Therefore, the activity of several proteases was tested in order to obtain a complete liquefaction of shellfish tissues. Advantages of this approach include the simplicity of manipulations, minimum equipment requirement and absence of risk linked with cross-contamination. Proteases usually commercialised for industrial use were chosen because of their availability in highly concentrated form for a very low cost, with reproducible characteristics and quality. Results obtained (Table 3) showed the efficiency of this method., especially for the liquefaction of shellfish hepatopancreas. Interestingly, HAV capsids appeared to be resistant to the proteolysis activity of the protease selected (BREWERS PROTEASE™). This was shown by experiments involving the antigen-capture of HAV particles from artificially contaminated mussels that have been submitted to the shellfish processing procedure (unpublished results). Nevertheless, to exclude any damage of viral RNA possibly released during shellfish processing, absence of RNase activity in the lysis reaction mix was controlled. Hepatopancreas excision before shellfish processing had been described as advantageous considering the natural concentration of viral contaminants in this particular organ (Enriquez et al., 1992; Romalde et al., 1994) and elimination of RT-PCR inhibitors present in shellfish flesh (Atmar et al., 1995). In addition, digestion of hepatopancreas appeared to be faster than digestion of full flesh (see Table 3) and required a smaller reaction volume as well. Given the small size of the reaction volume (10 ml for liquefaction of 5 g of hepatopancreas), a concentration step of the shellfish extract was not required. The sample size, 5 g of hepatopancreas, including more than one individual shellfish was chosen in order to compensate the variability of virus uptake by shellfish, described by several authors (Gaillot et al., 1988; Jaykus et al., 1994). It corresponds to a mean of ten mussels or five oysters and is also equivalent to 100–140 g of mussel flesh and fluid. These values are similar to the sample size (100 g)

12

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

generally used for standard microbial analysis of shellfish. Values comprised between 20 and 60 g of shellfish flesh and fluid were more generally used for viral detection in shellfish by RT-PCR (Le Guyader et al., 1994; Lees et al., 1994; Jaykus et al., 1996; Traore et al., 1998). Several techniques, including organic solvent extraction using Freon®, chloroform or butanol, and flocculation using Beef-Extract, CTAB or Cat-Floc®, have been cited for the clarification of shellfish extract (Sobsey et al., 1978; Yang and Xu, 1993; Lees et al., 1994; Atmar et al., 1995; Cromeans et al., 1997). A double extraction procedure using dichloromethane appeared to be sufficient for the clarification of the shellfish lysate. This step seemed to help the virus release from shellfish solids (Fig. 1), whereas removal of RT-PCR inhibitors was mainly achieved with the RNA isolation procedure (Fig. 2). This confirmed results described previously (Hale et al., 1996; Legeay et al., 1997; Arnal et al., 1999a) concerning efficiency of the RNA isolation method described by Boom et al. (1990) to remove RT-PCR inhibitors. However, the intrinsic variability of chemical and biochemical composition of shellfish hepatopancreas can lead to an unexpected presence, or abundance of particular RT-PCR inhibitors which may pass through the purification procedure. Therefore, monitoring of interference on RT-PCR is essential and relies on the addition of a RNA positive control to each shellfish extract, before RNA isolation. Not all virus-specific transcripts were used, one RT-PCR assay for monitoring of RNA isolation and of detection was assumed to be sufficient. This procedure requires doubling the RNA isolation and adding one RT-PCR assay, for each sample extract. This point could be improved by the use of an internal control, isolated and amplified concurrently with viral RNA present in the shellfish extract and distinguished from the wild viral sequence by hybridisation of the RT-PCR products with specific probes (Legeay et al., 1997; Arnal et al., 1999b). The use of a vacuum manifold system, allowing rapid extraction of 20 samples at once, was particularly suitable for routine analysis perspectives. Similarly, the RT-PCR assay performed in one

tube (Access RT-PCR system, Promega Corp.) is suitable for diagnostic purpose because of simplified manipulations and low risk of cross-contaminations. Concerning sensitivity, as low as one copy of virus specific transcript per ml of aqueous solution (Fig. 3) and the equivalent of 102 pfu of HAV per 5 g of hepatopancreas could be detected with this RT-PCR system (Fig. 5). Furthermore, given that (i) 5 g of hepatopancreas corresponds to 100–140 g of full flesh and that (ii) viral contaminants are concentrated in the hepatopancreas (Enriquez et al., 1992; Romalde et al., 1994), sensitivity of the procedure might be approximated around 0.8–1 pfu of HAV per g of full flesh. Such sensitivity results were equivalent to those obtained in studies using semi-nested RTPCR or RT-PCR combined to hybridisation (Jaykus et al., 1996; Cromeans et al., 1997; Hafliger et al., 1997). The main benefit of the dot-blot hybridisation assay, using DIG-labelled virus-specific probes and revelation by a colourimetric reaction, was the confirmation of the specificity of RT-PCR products. Improvement in sensitivity was also observed compared with the gel electrophoresis technique. However, dot-blot hybridisation is time consuming and the duration of the overall procedure can be shortened using only gel electrophoresis (24 h for RT-PCR+dotblot/20 samples, 12 h for RT-PCR+ electrophoresis/20 samples). In conclusion, a simple procedure, suitable for routine diagnostic use, was developed for the detection of viral pathogens in shellfish. This procedure can be used for epidemiological studies for evaluation of the frequency of virus-specific nucleic acids in marketable shellfish, or to determine viral pathogens circulation in shellfish collected either from producing areas or from natural environments. Specific detection of the predominant enteric viruses, epidemiologically linked to shellfish-associated viral diseases, i.e. HAV, Astrovirus and genogroups I and II of Norwalk-like viruses, were set up. Moreover, this procedure can easily be applied to the molecular detection of any other virus, such as emergent viruses or viral indicators, and probably of any other microbial pathogen, using appropriate PCR or RT-PCR conditions. Other improvements include the intro-

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

duction, in each sample extract, of virus-specific internal standards for a more accurate monitoring of RNA isolation and RT-PCR. This would lead to a simplification of the procedure and to lowering its cost. Also, substitution of the dot-blot by a microplate hybridisation assay, for the specific detection of RT-PCR products, would allow a further simplification of this procedure as well as minimising the time.

Acknowledgements We are very grateful to Csezlav Wychowski (Institut de Biologie de Lille, France), Ian Clarke (University Medical School, Southampton, UK) and Xi Jiang (Center for Paediatric Research, Norfolk, USA) for giving molecular constructs, to Pr. Laveran (CHU-Clermont Ferrand, France) for providing the Astrovirus strain, and to Ousmane Traore´ (CHU-Clermont Ferrand, France) for his advice about propagation and detection of Astrovirus and for his participation in cloning experiments. We would like to thank Mr Dauvin (Station Marine de Wimereux, University of Lille, France) for providing laboratory facilities for bioaccumulation assays and Mr Vroemen (GistBrocades, Seclin, France) for providing enzymes.

References Apaire-Marchais, V., Robertson, B.H., Aubineau-Ferre, V., Le Roux, M.G., Leveque, F., Schwartzbrod, L., Billaudel, S., 1995. Direct sequencing of hepatitis A virus strains isolated during an epidemic in France. Appl. Environ. Microbiol. 61 (11), 3977 – 3980. Arnal, C., Crance, J.M., Gantzer, C., Schwartzbrod, L., Deloince, R., Billaudel, S., 1998. Persistence of infectious hepatitis A virus and its genome in artificial seawater [in process citation]. Zentralbl. Hyg. Umweltmed. 201 (3), 279 – 284. Arnal, C., Ferre-Aubineau, V., Besse, B., Mignotte, B., Schwartzbrod, L., Billaudel, S., 1999a. Comparison of seven RNA extraction methods on stool and shellfish samples prior to hepatitis A virus amplification [in process citation]. J. Virol. Methods 77 (1), 17–26. Arnal, C., Ferre-Aubineau, V., Mignotte, B., Imbert-Marcille, B.M., Billaudel, S., 1999b. Quantification of hepatitis A virus in shellfish by competitive reverse transcription-PCR

13

with coextraction of standard RNA. Appl. Environ. Microbiol. 65 (1), 322 – 326. Atmar, R.L., Neill, F., Romalde, J.L., Le Guyader, F., Woodley, C.M., Metcalf, T.G., Estes, M.K., 1995. Detection of Norwalk virus and hepatitis A virus in shellfish tissues with the PCR. Appl. Environ. Microbiol. 61 (8), 3014 – 3018. Belliot, G., Laveran, H., Monroe, S.S., 1997. Detection and genetic differentiation of human astroviruses: phylogenetic grouping varies by coding region. Arch. Virol. 142 (7), 1323 – 1334. Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-vanDillen, P.M.E., Van der Noordaa, J., 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495 – 503. CDC, 1994. Viral gastroenteritis associated with consumption of raw oysters — Florida, 1993. MMWR 43 (24), 446 – 449. Cohen, J.I., Rosenblum, B., Ticehurst, J.R., Daemer, R.J., Feinstone, S.M., Purcell, R.H., 1987. Complete nucleotide sequence of an attenuated hepatitis A virus: comparison with wild-type virus. Proc. Natl. Acad. Sci. USA 84 (8), 2497 – 2501. Croci, L., De Medici, D., Morace, G., Fiore, A., Scalfaro, C., Beneduce, F., Toti, L., 1999. Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR. Int. J. Food Microbiol. 48 (1), 67 – 71. Cromeans, T.L., Nainan, O.V., Margolis, H.S., 1997. Detection of hepatitis A virus RNA in oyster meat. Appl. Environ. Microbiol. 63 (6), 2460 – 2463. Daurat, G., 1994. Une e´pide´mie de gastro-ente´rite aigue¨ a` virus Norwalk-like lie´e a` la consommation d’huıˆtres dans l’he´rault, De´cembre 1992. Bull. Epide´miol. Hebd. 37, 170 – 171. Deng, M.Y., Day, S.P., Cliver, D.O., 1994. Detection of hepatitis A virus in environmental samples by antigen-capture PCR. Am. J. Public Health 60 (6), 1927 – 1933. Desenclos, J.C., Klontz, K.C., Wilder, M.H., Nainan, O.V., Margolis, H.S., Gunn, R.A., 1991. A multistate outbreak of hepatitis A caused by the consumption of raw oysters. Am. J. Public Health 81 (10), 1268 – 1272. Enriquez, R., Fro¨sner, G.G., Hochstein-Mintzel, V., Riedemann, S., Reinhardt, G., 1992. Accumulation and persistence of hepatitis A virus in mussels. J. Med. Virol. 37, 174 – 179. Gaillot, D., Terver, D., Finance, C., Schwartzbrod, L., 1988. Improved method for contamination of mussels by poliovirus. Int. J. Food Microbiol. 6 (4), 333 – 339. Gerba, C.P., 1988. Viral disease transmission by seafoods. Food Technol. 3, 99 – 103. Hafliger, D., Gilgen, M., Luthy, J., Hubner, P., 1997. Seminested RT-PCR systems for small round structured viruses and detection of enteric viruses in seafood. Int. J. Food Microbiol. 37 (1), 27 – 36. Hale, A.D., Green, J., Brown, D.W., 1996. Comparison of four RNA extraction methods for the detection of small round structured viruses in faecal specimens. J. Virol. Methods 57 (2), 195 – 201.

14

O. Legeay et al. / Journal of Virological Methods 90 (2000) 1–14

Jaykus, L.A., 1997. Epidemiology and detection as options for control of viral and parasitic foodborne disease. Emerg. Infect. Dis. 3 (4), 529–538. Jaykus, L.A., De Leon, R., Sobsey, M.D., 1996. A virion concentration method for detection of human enteric viruses in oysters by PCR and oligoprobe hybridisation. Appl. Environ. Microbiol. 6, 2074–2080. Jaykus, L.A., Hemard, M.T., Sobsey, M.D., 1994. Human enteric pathogenic viruses. In: Hackney, M.D., Pierson, C.R. (Eds.), Environmental Indicators and Shellfish Safety. Chapman & Hall, New York, pp. 92–153. Jiang, X., Matson, D.O., Velazquez, F.R., Calva, J.J., Zhong, W.M., Hu, J., Ruiz-Palacios, G.M., Pickering, L.K., 1995. Study of Norwalk-related viruses in Mexican children. J. Med. Virol. 47 (4), 309–316. Lambden, P.R., Liu, B., Clarke, I.N., 1995. A conserved sequence motif at the 5% terminus of the Southampton virus genome is characteristic of the Caliciviridae. Virus Genes 10 (2), 149 – 152. Le Guyader, F., Apaire, M.V., Brillet, J., Billaudel, S., 1993. Use of genomic probes to detect hepatitis A virus and enterovirus RNAs in wild shellfish and relationship of viral contamination to bacterial contamination. Appl. Environ. Microbiol. 59 (11), 3963–3968. Le Guyader, F., Dubois, E., Menard, D., Pommepuy, M., 1994. Detection of hepatitis A virus, rotavirus, and enterovirus in naturally contaminated shellfish and sediment by reverse transcription-seminested PCR. Appl. Environ. Microbiol. 60 (10), 3665–3671. Le Guyader, F., Neill, F.H., Estes, M.K., Monroe, S.S., Ando, T., Atmar, R.L., 1996. Detection and analysis of a small round-structured virus strain in oysters implicated in an outbreak of acute gastroenteritis. Appl. Environ. Microbiol. 62 (11), 4268 – 4272.

.

Lees, D.N., Henshilwood, K., Dore, W.J., 1994. Development of a method for detection of enteroviruses in shellfish by PCR with poliovirus as a model. Appl. Environ. Microbiol. 60 (8), 2999 – 3005. Legeay, O., Bounaix, S., Denis, M., Arnauld, C., Hutet, E., Cariolet, R., Albina, E., Jestin, A., 1997. Development of a RT-PCR test coupled with a microplate colorimetric assay for the detection of a swine arterivirus (PRRSV) in boar semen. J. Virol. Methods 68 (1), 65 – 80. Lopez, S.E., Deng, M.Y., Cliver, D.O., 1997. Magnetic immunoseparation PCR assay (MIPA) for detection of hepatitis A virus (HAV) in American oyster (Crassostrea 6irginica). Lett. Appl. Microbiol. 24 (2), 101 – 104. Richards, G.P., 1985. Outbreaks of shellfish-associated enteric virus illness in the United States: requisite for development of viral guidelines. J. Food Prot. 48 (9), 815 – 823. Romalde, J.L., Estes, M.K., Szucs, G., Atmar, R.L., Woodley, C.M., Metcalf, T.G., 1994. In situ detection of hepatitis A virus in cell cultures and shellfish tissues. Appl. Environ. Microbiol. 60 (6), 1921 – 1926. Sobsey, M.D., Carrick, R.J., Jensen, H.R., 1978. Improved methods for detecting enteric viruses in oysters. Appl. Environ. Microbiol. 36 (1), 121 – 128. Toti, L., Croci, L., De Medici, D., Fiore, A., Di Pasquale, S., 1998. Hepatitis A virus in mussels and cleansing treatments resistance. Microbiol. Aliment. Nutr. 16, 71 – 76. Traore, O., Arnal, C., Mignotte, B., Maul, A., Laveran, H., Billaudel, S., Schwartzbrod, L., 1998. Reverse transcriptase PCR detection of astrovirus, hepatitis A virus, and poliovirus in experimentally contaminated mussels: comparison of several extraction and concentration methods. Appl. Environ. Microbiol. 64 (8), 3118 – 3122. Yang, F., Xu, X., 1993. A new method of RNA preparation for detection of hepatitis A virus in environmental samples by the polymerase chain reaction. J. Virol. Methods 43 (1), 77 – 84.