Detection and characterization of pathogenic vibrios in shellfish by a Ligation Detection Reaction-Universal Array approach

International Journal of Food Microbiology 153 (2012) 474–482

Contents lists available at SciVerse ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

Short communication

Detection and characterization of pathogenic vibrios in shellfish by a Ligation Detection Reaction-Universal Array approach Alessia Cariani a,⁎, 1, Annamaria Piano b, 1, Clarissa Consolandi c, Marco Severgnini c, Bianca Castiglioni d, Giada Caredda c, Marco Candela e, Patrizia Serratore b, Gianluca De Bellis c, Fausto Tinti a a

Department of Experimental Evolutionary Biology, University of Bologna, Italy Department of Veterinary Medical Sciences, University of Bologna, Italy Institute of Biomedical Technologies, National Research Council, Milan, Italy d Institute of Agricultural Biology and Biotechnology, National Research Council, Italy e Department of Pharmaceutical Sciences, University of Bologna, Italy b c

a r t i c l e

i n f o

Article history: Received 16 May 2011 Received in revised form 23 September 2011 Accepted 11 November 2011 Available online 20 November 2011 Keywords: Food safety Vibrio Shellfish Virulence marker Multiplex PCR Microarray

a b s t r a c t Vibrios are a group of major foodborne pathogens widely distributed in marine environment. Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus are the pathogenic species of Vibrio that pose the greatest threat to human health. However, other vibrios, e.g. Vibrio alginolyticus, Vibrio mimicus and Grimontia hollisae, apparently less relevant in the group of foodborne pathogens, have been sporadically found in outbreaks. For seafood safety and economic purposes, a rapid and powerful method for the specific identification of harmful Vibrio strains is needed. We developed a PCR-Ligase Detection Reaction-Universal Array (PCR-LDR-UA) assay for the simultaneous identification of pathogenic vibrios and detection of virulence coding genes. The entire procedure was validated on a total of 31 reference strains and isolates from clinical and environmental samples, as well as on bivalve tissue homogenates infected with different strains of target Vibrio species. Twenty-three shellfish samples directed to human consumption were successfully screened, thus demonstrating that the developed microarray-based platform could be a reliable and sensitive detection tool for the identification of harmful Vibrio strains in seafood. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Bacteria belonging to the family Vibrionaceae are normal inhabitants in estuarine and marine environments (Hervio-Heath et al., 2002). Vibrio infections in humans mainly cause self-limiting gastroenteritis through the consumption of seafood, with special relevance for shellfish, as they concentrate microorganisms from surrounding waters during the filter-feeding process and are often consumed whole and raw or only lightly cooked. Although Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus are the main species associated with seafoodborne infections, others, e.g. Vibrio alginolyticus, Vibrio mimicus and Vibrio hollisae (now Grimontia hollisae), have been sporadically found in human infections (Thompson et al., 2004a). Vibrio genomes are particularly dynamic with a relevant portion of genetic information inserted or deleted from genomes by horizontal gene transfer (henceforth HGT), a common mechanism in marine habitats (Jiang and Paul, 1998). HGT often changes the ecological and pathogenic character of bacterial species and promotes microbial diversification by introducing ⁎ Corresponding author. E-mail address: [email protected] (A. Cariani). 1 These authors contributed equally to this work and should be considered co-first authors. 0168-1605/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2011.11.010

novel physiological traits (Dutta and Pan, 2002). The occurrence of infection outbreaks due to environmental strains of vibrios routinely not considered of clinical relevance has been correlated to the HGT of virulence factors between closely related species (González-Escalona et al., 2006). Due to these issues, a rapid and reliable monitoring of Vibrio pathogenic strains and their virulence factors in seafood is of relevant interest for human health and economic purposes. Culture-dependent standard laboratory methods used to identify harmful vibrios are generally time-consuming, labor-intensive, do not target virulence factors associated with human illness and they cannot detect microorganisms in the viable but non culturable state (VBNC) (Vora et al., 2005). The need to adequately monitor biological threats for human health has prompted the development of advanced technological research for the detection of pathogens. Molecular methods are suitable i) for a culture-independent detection of microorganisms, ii) to accurately identify bacterial species and iii) to provide data on the pathogenic potential of the microorganisms. Among the several molecular methods available for the identification of pathogenic bacteria, DNA-chip technologies are promising for accuracy, rapidity and efficiency of detection (Wilson et al., 2002). Our research deals with the development and the validation of a Ligation Detection Reaction-Universal Array (LDR-UA) platform (Candela et al., 2010) for the direct identification and pathogenic

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

characterization of harmful strains of Vibrio in shellfish. The DNAchip tool we developed was conceived for the simultaneous detection of species-specific markers and major virulence factors associated to vibrios. The high specificity and the multiplexing potential achieved in the enzymatic reaction make the LDR-UA approach particularly suitable to target a relatively small number of species and marker genes (Cremonesi et al., 2008). The LDR technique uses a pair of probes for each target: a) a Discriminating Oligonucleotide (DS) whose 3′end insists on a position capable of discriminating the target sequences from non-target ones; b) a Common Probe (CP), designed to be immediately 3′-downstream of the DS, which is used to complete the ligation process. The Universal Array format (Chen et al., 2000) is based on a set of artificial sequences, called ZipCodes, designed to be different from any biological sequence, and it can be used to address specifically ligated products to pre-determined positions of the array. This innovative technique has been recently applied to pathogen detection in food safety applications (Cremonesi et al., 2008; Lauri et al., 2010) and environmental screenings (Rantala et al., 2008; Sipari et al., 2010) successfully exhibiting high specificity and sensitivity. The DNA-chip assay developed in the present study was validated on multiple reference strains and environmental isolates. Additionally retail shellfish samples were screened to assess the reliability of the platform for routine monitoring studies.

475

were cultured at 37 °C on Tryptone Soy Agar (TSA) supplemented with 3% NaCl, for 24 h. DNA from clinical isolates of V. parahaemolyticus was provided by Ronnie Gavilan Chavez, University of Santiago de Compostela, Spain. Bacterial strains were previously characterized by biochemical tests, single-target PCR and direct sequencing of selected genes (Supplementary material Tables A, B, C). 2.2. Target selection and microarray design Eleven genes were selected as potential target genes for PCR-LDRUA (Table 2). The species identification of V. cholerae, V. vulnificus, V. parahaemolyticus, V. alginolyticus, V. mimicus and G. hollisae was carried out by targeting the ubiquitous gene recA (Thompson et al., 2004b) and species-specific markers. In order to increase the robustness of the molecular identification, V. cholerae, V. vulnificus, V. parahaemolyticus and V. alginolyticus were considered correctly detected only if significant hybridization signals were simultaneously obtained for two specific markers (e.g. the recA and species-specific genes). The assessment of the pathogenic potential of the strains was achieved by targeting genes known to be required for virulence in Vibrio species. Multiple probes were selected to target different variants of V. parahaemolyticus tdh and trh genes and V. cholerae hemolysin gene hlyA. Moreover two distinct oligonucleotide pairs were synthesized for the majority of pathogenic factors (ctxA, all tdh and trh variants, vvhA) in order to increase the specificity of the detection.

2. Materials and methods

2.3. Probe design

2.1. Bacterial strains and media

For each target gene, orthologous sequence datasets were generated merging sequences retrieved from public database (NCBI) and sequences of obtained during this study (Supplementary material, Table C). For each probe, two datasets were built: a “Positive Set” with all available sequences of the target gene and species and a “Negative Set” including all other sequences in the database. For each positive set, a consensus sequence was calculated in Bioedit version 7.0.5.3 (Hall, 1999), setting the threshold frequency to 95%. LDR probe pairs were designed using ORMA (Oligonucleotide Retrieving for Molecular Application) (Severgnini et al., 2009) which runs in Matlab environment (Mathworks, Natick, MA), setting the annealing temperature (Tm) to 68 ± 1 °C and the probe length to 25–60 bp. More than 300 potential probe pairs were generated and tested for sequence similarity against the NCBI database by BLAST, to exclude any possible similarity with any known sequence that could occur in the samples analyzed. In case of sequences with high similarity, at least a mismatch at the 3′ end of the DS was required. Finally, probe pairs were selected according to specificity, Tm, number of degenerate bases and length. The DS probes were 5′-end labeled with Cy3, whereas CPs were 5′-end phosphorylated and carried a cZipCode at the 3′ end (Chen et al., 2000). All oligonucleotides were synthesized by Thermo Fisher Scientific GmbH (Ulm, Germany). For synthesis purpose, any degenerated base in the probe pairs was substituted by inosine.

The complete list of the 31 strains used is displayed in Table 1. Reference strains were purchased from the American Type Culture Collection (Manassas, VA, USA). Environmental strains were isolated from seawater and shellfish from the Adriatic Sea. Bacterial strains

Table 1 Bacterial strains used in this study. Species

Strain ID

Source

Vibrio cholerae V. cholerae V. cholerae V. cholerae V. cholerae V. mimicus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus V. vulnificus V. vulnificus Grimontia hollisae V. alginolyticus V. alginolyticus V. alginolyticus V. alginolyticus V. diabolicus V. diabolicus V. diabolicus V. diabolicus V. harveyi V. splendidus

70/28 Target Diagnostica 77/65 Sieroterapico Milano Isolate 344-17 Isolate 795-1 Isolate 178-19 ATCC 33653 ATCC 17802 ATCC 43996 Isolate 344-1 Isolate 298-1 Isolate 178-1 Isolate 178-14 Isolate 826-19 RIDM2210633 F6729 VPAQ3810 AQ4644 PM290 ATCC 27562 Isolate 628-7 ATCC 33564 ATCC 17749 Isolate 178-23 Isolate 822-4 Isolate 468-5 Isolate706-5 Isolate 735-1 Isolate 460-16 Isolate 707-2 Isolate 31712-11 ATCC 33125T

Collection Collection Sea water Sea water Shellfish Collection Collection Collection Sea water Sea water Shellfish Shellfish Sea water Clinical Clinical Clinical Clinical Clinical Collection Shellfish Collection Collection Shellfish Sea water Shellfish Sea water Sea water Shellfish Sea water Shellfish Collection

2.4. Genomic DNA extraction Genomic DNA was extracted from pure culture colonies by boiling method. Individual colonies were resuspended in 100 μL of sterile water, boiled for 15 min and incubated on ice for 3 min. After a centrifugation step at 5000 ×g for 15 min, the supernatant was transferred in new tubes and used as PCR template. Total DNA was extracted from homogenate of mollusc flesh and intervalvular liquid with InstaGene Matrix (Bio-Rad Laboratories, Hercules, CA, USA) according to the following procedure: 5 mL-aliquots were centrifuged at 10,000 ×g for 10 min, and the cell pellet was resuspended in 200 μL of InstaGene Matrix. Samples were then incubated at 56 °C for 20 min, boiled for 10 min and centrifuged at 5000 ×g for 3 min

476

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Table 2 Species and marker genes selected for PCR-LDR-UA design. Information about the targeted strains is reported. Target

Detection of

Species

Gene

V. cholerae/V. mimicus V. cholerae

recA toxR hlyA ctxA tcpI recA toxR tl tdh-1 tdh-234 trh1 trh2 ORF8 recA tl recA tdh recA vvhA viuB

V. parahaemolyticus

V. alginolyticus G. hollisae V. vulnificus

Recombinase Regulatory protein Hemolysin Cholera toxin, subunit A Regulatory protein for tcp genes Recombinase Regulatory protein Thermolabile hemolysin Thermostable direct hemolysin Thermostable direct hemolysin TDH-related hemolysin TDH-related hemolysin Open reading frame 8 Recombinase Thermolabile hemolysin Recombinase Thermostable direct hemolysin Recombinase Cytolysin Vulnibactin utilization protein

to collect total DNA. A 2 μL-aliquot of the supernatant was used as template in PCR amplification. 2.5. Gene amplification Single-target gene amplifications were carried out in 25 μL-reactions containing Buffer 1×, 2 mM MgCl2, 0.2 mM each dNTP, 0.4 μM each primer, 1 U Taq polymerase and 1 μL of DNA template. Single PCR conditions were: denaturation for 4 min at 94 °C, 30 cycles of 1 min at 94 °C, 1 min at annealing temperature (Ta) (i.e. 60 °C for all V. cholerae and V. vulnificus markers; 58 °C for all V. parahaemolyticus, V. alginolyticus and G. hollisae markers and recA gene), 1 min at 72 °C; a final extension step of 7 min at 72 °C. All PCR primer sequences are reported in Table 3. Primer pairs were designed using Primer3 (www. primer3.sourceforge.net/webif.php) and PrimerExpress (Applied

V. cholerae (both clinical and environmental strains) and V. mimicus V. cholerae (both clinical and environmental strains) V. cholerae (both biotypes) V. cholerae pathogenic strains V. cholerae pathogenic strains V. parahaemolyticus (both clinical and environmental strains) V. parahaemolyticus (both clinical and environmental strains) V. parahaemolyticus (both clinical and environmental strains) V. parahaemolyticus pathogenic strains tdh1 + variant V. parahaemolyticus pathogenic strains tdh2+, tdh3+, tdh4 + variants V. parahaemolyticus pathogenic strains trh1+ variant V. parahaemolyticus pathogenic strains trh2+ variant V. parahaemolyticus pandemic strains V. alginolyticus V. alginolyticus G. hollisae G. hollisae tdh + V. vulnificus V. vulnificus V. vulnificus clinical strains

Biosystem, Foster City, CA, USA). Two different multiplex PCR reactions were set up: all V. cholerae and V. vulnificus markers were simultaneously amplified in a single reaction (Mplx1), as well as V. parahaemolyticus, V. alginolyticus and G. hollisae marker genes were amplified all together (Mplx2). Multiplex PCR were performed in 50 μL-reactions containing Buffer 1×, 2 mM MgCl2, 0.4 mM each dNTP, 1 μM each primer, 5 U Taq polymerase and 2 μL of DNA template. Multiplex PCR conditions were: denaturation for 4 min at 94 °C; 30 cycles of 1 min at 94 °C, 1 min at Ta (i.e. 60 °C for Mplx1; 58 °C for Mplx2 and recA), 1 min at 72 °C; a final extension of 7 min at 72 °C. All PCR reagents were purchased from Invitrogen (Carlsbad, CA, USA). The PCR products were purified with QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's protocols and quantified by the BioAnalyzer 2100 (AgilentTechnologies, Palo Alto, CA, USA) using the DNA 7500 kit.

Table 3 Primer pairs used for PCR amplification in single-target and multiplex reactions. Amplicon size and references are reported. F: forward primer, R: reverse primer. Mplx1: multiplex PCR reactions of V. cholerae and V. vulnificus markers; Mplx2: multiplex PCR reactions of V. parahaemolyticus, V. alginolyticus and G. hollisae marker genes. Target species

Gene

Primer sequences 5′–3′

Amplicon size (bp)

Reference

Vibrio spp.

recA

F: TGARAARCARTTYGGTAAAGG R: TCRCCNTTRTAGCTRTACC

837

Thompson et al., 2005

V. cholerae

toxR

402

Present study

V. cholerae

hlyA

738/727

Rivera et al., 2001

V. cholerae

ctxA

564

Fields et al., 1992

V. cholerae

tcpI

333

Present study

V. vulnificus

vvhA

437

Present study

V. vulnificus

viuB

F: GATTAGGCAGCAACGAAAGC R: CCAAGTTTGGAGCCGATTTA F: GGCAAACAGCGAAACAAATACC R: CTCAGCGGGCTAATACGGTTTA F: GCAGATTCTAGACCTCCTG R: CGATGATCTTGGAGCATTCCCAC F: CGCGATAAAGCAGTCGAAGA R: AAACATCCCACTGCCGTTAG F:AACTATGACGTTTTGTACGAAG R: CCACACTGTTCGACTGTGA F: AATGGTTCGCACATCAAAG R: GGATGAACAAGATCGTGGATA

413

Present study

V. parahaemolyticus/V. alginolyticus

tl

450

Bej et al., 1999

V. parahaemolyticus

toxR

368

Kim et al., 1999

V. parahaemolyticus/G. hollisae

tdh

337

V. parahaemolyticus

trh

148

Present study Bej et al., 1999 Present study

V. parahaemolyticus

ORF8

369

Myers et al., 2003

F: AAAGCGGATTATGCAGAAGCACTG R: GCTACTTTCTAGCATTTTCTCTGC F: GTCTTCTGACGCAATCGTTG R: ATACGAGTGGTTGCTGTCATG F: CCCCGGTTCTGATGAGATATT R: TGGAATAGAACCTTCATCTTCACC F: ACTAYTGGACAAACCGAAMCA R: CCAGAAAGAGCWGCCATYG F: AGGACGCAGTTACGCTTGATG R: CTAACGCATTGTCCCTTTGTAG

Mplx1

Mplx2

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

2.6. Detection of seeded strains in shellfish homogenates Twenty-five g of Tapes philippinarum homogenate was added to 225 mL of Alkaline Peptone Water (APW) with 3% NaCl, pH 8.6. Four aliquots were seeded with approximately 10 8 CFU of each target: Inaba 70/28 and Ogawa El Tor 77/65 for V. cholerae, ATCC 17802 and ATCC 43996 for V. parahaemolyticus, ATCC 27562 for V. vulnificus, and ATCC 33564 for G. hollisae. An unseeded aliquot of mollusc homogenate was included as negative control. The homogenates were enriched at 37 °C and 5 mL-aliquots were collected 24 h after inoculation. Each sample was used for direct DNA extraction, PCR amplification and LDR-UA experiments. 2.7. Screening of retail shellfish samples The detection of vibrios in retail shellfish was carried out on 23 mollusc samples obtained from monitoring surveys in the Adriatic Sea and identified as Crassostrea gigas (9), Mytilus galloprovincialis (7), T. philippinarum (6), Callista chione (1). These samples were screened for the presence of Vibrio by streaking shellfish homogenates on a highly selective media, thiosulfate citrate bile salts sucrose (TCBS) agar, and incubating at 37 °C for 24 h. A statistically significant number of suspected colonies were selected and screened on the basis of a set of biochemical tests for the identification of Vibrio spp. (Noguerola and Blanch, 2008; Serratore et al., 1999). Aliquots of 25 g of mollusc homogenate were enriched in APW at 37 °C. After 24 h, 5 mL-aliquots were used for DNA extraction, multiplex PCR amplification of all target genes and LDR-UA experiments. 2.8. LDR/Universal Array experiments and data analysis Chemical treatment of glass slides and spotting of probes on the array were carried out following Candela et al. (2010). The LDR and hybridization experiments were performed according to Candela et al. (2010) with the probe annealing temperature set at 63 °C. The LDRs were performed in 20 μL-reactions with specific amounts of purified PCR product in different types of experiments. Specificity tests were performed using 50 fmol of initial PCR product (in the multiplex PCR, this amount was calibrated on the least abundant amplified marker). In the sensitivity tests, the PCR product concentration was decreased with serial dilutions down to 0.7 fmol. The screening of shellfish samples was performed adjusting the overall template to 50 fmol. Each experiment was replicated twice and whenever the result of the two replicates was discordant, the sample was reprocessed. Data analysis was performed as described in detail in Candela et al. (2010). Briefly, to identify significant specific hybridization signals, a t-test for each target-associated ZipCode was performed, comparing the distribution of the hybridization values (n = 4 for each probe, n = 8 for the hybridization positive control) with the one of the negative controls (empty spots, n = 6), the latter corrected by adding two times the standard deviation. Where the ratio between the standard deviation and the mean of the distribution exceeded 100%, the most extreme value from the test population was removed. The significance threshold was set at P b 0.01. All statistical analyses were performed in Matlab environment. 3. Results The PCR-LDR-UA platform here developed addressed two principles: the identification of six Vibrio species of great interest for human health through multiple species-specific markers and the characterization of their harmful potential by the detection of primary virulence factors. For the detection of five species- specific variants of the housekeeping gene recA, the species-specific marker genes toxR, hlyA, tl, vvhA and virulence genes ctxA, tcpI, tdh, trh, ORF8 and viuB, a total of 28 probe pairs (DS + CP oligonucleotides) were selected (Table 4). The

477

mean Tm of probe pairs was 68.1 ± 0.6 °C, with probe length ranging from 30 to 60 nucleotides. Only one out of 56 probes had four degenerated bases, whereas 32 out of 56 were highly specific with no degenerated positions. In vitro specificity of the selected probe pairs was evaluated by PCR-LDR-UA experiments on reference strains, clinical and environmental isolates. Multiple marker genes were evaluated for most of the 31 strains tested, through single target and multiplex PCR-LDRUA, for a total of more than 80 assays performed. All the reference strains and environmental isolates were correctly identified (Fig. 1), proving an optimal specificity of the PCR-LDR-UA platform. Hybridization results were consistent with the strains molecular characterization previously obtained through single target PCR and gene sequencing (Supplementary material, Table B and C): all expected markers were detected and different gene variants were correctly identified (i.e. tdh, trh and hlyA). No cross-hybridization signal was observed on non-target strains such as Vibrio harveyi and Vibrio splendidus. However, unexpectedly, a positive VA-tl signal was obtained with Vibrio diabolicus tl amplicons. This finding was further investigated by direct sequencing of the tl amplicons from strains of V. diabolicus and V. alginolyticus (Supplementary material, Table C) revealing that the two species share the same tl haplotype. At the same time, no cross-ligation was observed on recA gene between the two species. The lower sensitivity limit of the PCR-LDR-UA was estimated at 6 fmol of PCR product in the ligation reaction step by the detection of a significant hybridization signal (Fig. 3), an amount that can be produced from a strain culture of at least 10 4 CFU/mL. The array applied on experimentally infected shellfish samples (Fig. 2, samples A–E) allowed the correct identification of the inoculated strains by the simultaneous detection of all species-specific genes and virulence factors, in agreement with the molecular characterization achieved previously (Supplementary material, Table B). In order to evaluate the array performance on retail shellfish, 23 shellfish samples were analyzed by PCR-LDR-UA. The summary results on these samples are shown in Fig. 2 (samples 1–23). All samples were negative for the presence of target Vibrio species on the basis of the TCBS isolation and biochemical screening. In contrast to the results obtained by biochemical screening, based on the results of the PCR-LDR-UA only ten samples were negative for the presence of target Vibrio species (samples 4, 5, 7, 12, 14–16, 19, 21 and 23). Otherwise, thirteen samples showed significant PCR-LDR-UA hybridization signals suggesting the presence of target Vibrio strains. Samples 3, 9, 11, 17 and 18 showed positive signals for VP-recA, VP-toxR and VP-tl probes, indicating the presence of V. parahaemolyticus strains. The detection of two out of three species-specific markers (VP-toxR and VP-tl probes) suggested the presence of V. parahaemolyticus strains also in sample 1. Samples 1, 3, 6, 11, 17 and 18 gave significant hybridization signals to V. alginolyticus specific probes (VA-recA and VA-tl). Among these positive samples, five showed the simultaneous occurrence of V. parahaemolyticus and V. alginolyticus (1, 3, 11, 17 and 18). Both samples 1 and 9 gave significant hybridization signals for trh (variant 2) probes. In samples 2, 20 and 22, hybridization signal from probe VA-tl was detected without the corresponding signal from the related VA-recA probe. In three samples, the signal from only one specific probe was detected (VC-toxR in sample 8 and 10 and VP-recA in sample 13). Since we adopted a double-probe identification system, the identification of V. cholerae and V. parahaemolyticus strains in these three samples was not supported.

4. Discussion A DNA microarray platform was implemented for a reliable identification of harmful Vibrio strains in seafood, without prior microbiological isolation of colonies. Through the simultaneous detection of species-specific markers and primary virulence factors, the PCR-

478 Table 4 Selected probe pairs (Discriminating Oligos and Common Probes) and associated ZipCode selected for the PCR-LDR-UA platform. VC: Vibrio cholerae, VV: V. vulnificus, VP: V. parahaemolyticus, VA: V. alginolyticus, VM: V. mimicus, GH: Grimontia hollisae. ZipCode numbers are as in Chen et al. (2000).

Species

Gene

VC/VM VC

recA toxR hlyA hlyA ctxA ctxA tcpI recA toxR tl tdh1 tdh1 tdh234 tdh234 trh1 trh1 trh2 trh2 orf8 recA tl recA tdh tdh recA vvhA vvhA viuB

VP

VA GH

VV

ZipCode no.

Discriminating Oligo 5′–3′

Common Probe 5′–3′

2 7 31 32 21B 21 27 4 8 10 12 14 17 18 19 20 23B 25B 28 3 9 6 15 16 5 22 23 29

GAYAGCCACATGGGTCTNCAAGCGCGTATGTTGTCG GTCAATGAATACGCAGARTCAAGCAGTGTGCCTTCATCAG GCGACACCGGATGCCAAAATTGTGCGTATCAGCC TAGATGATGACAGCACVGGAGCMGGCATTCATCTGAA GATGGTTATGGATTGGCAGGTTTCCCTCCGGAGCAT GAGCATAGAGCTTGGAGGGAAGAGCCGTGGATTC CACAGCTTTTGATATCGATAAAACAACTGGGCAACACGTTCTCACTATTG GGTYTVCAAGCTCGTATGCTTTCTCAAGCAATGCGTAAGCTT GCAGTGCATTGAACGCTACGTTAAGCACCATGCAGAAGAC ACATCACGTTGTTTGATACTCACGCCTTGTTCGAGACGC CCCGGTTCTGATGAGATATTGTTTGTTGTTCGAGATACAACTTTTAATACCCAAGCT GTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACCGTACG CCCCGGTTCTGATGAGATATTGTTTGTTGTTCGAGATRCAACTTTTAAWACCAAT AAAACCGTACAAAKATGTTTATSSTCAATCAGTATTCACAACGTCAGGTACTAAATGGC TGGACAAACCSAAACRTAAAACGAAAACCATATAAAAGCGTTCACGGTCAATCTA CCSAAACRTAAAACGAAAACCATATAAAAGCGTTCACGGTCAATCTATTTTCACG ACAAAGRTGTATACGGTCAATCGGTTTTCACAACWGCRGGTTCAAAG TTGGACAAACCGAAMCATAAAAAGAAAACCAWACAAAGRTGTATACGGTCAATCG AGCTGAGGCTTACGGGCTCACTCCTGCTGTACT CTGTATACGCGAAGAAACTTGGCGTWGATATCGATGCATTGCTA GCATCTGGCGCAGATAAGTTYGTGTTCTGGGATGTGACT CGCTGGATCCTATCTACGCGCGCAAGCTGA CCCTGGTTCTGATGAGATATTGTTTGTTGTTCGAGATACAACTTTTAATACCAAAGA GACAAACCGTAATGTAAAAAGAAAACCGTACAAAGATGTTCATGGTCAATCAGTATTCAT GTTATTGTTGTCGACTCTGTKGCMGCATTGACRCCAAAG TTATGGTGAGAACGGTGACAAAACGGTTGCGGGTGG AAAACGGTTGCGGGTGGTTCGGTTAACGGCTGG CGGTGCGAGAAGGGGACAACGTCATTTGGCCT

CAAGCRATGCGTAAACTGACGGGTAACCTVAAGCAATCCAACTGTAT CCACTGTAGTGAACACACCGCAGCCAGCCAATGT TAGATGATGACAGCACGGGAGCCGGCTGATCAACTC TGATCAACTCGGTTATCGTCAGTTTGGAGCCAGTTATACGAC AGAGCTTGGAGGGAAGAGCCGTGGATTCATCATGCA ATCATGCACCGCCGGGTTGTGGGAATGCTCCAA CCACCCCTGTTTATGTAGGCAACGACATTGTCGGCA ACAGGTAACCTGAAACAGTCTAACTGTATGTGTATCTTCATCAACCAAATCC TCSTTACCAGTGGAAGTRATTGCCACTGGCGGACAAAATA TAACTTCTGCGCCMGAAGAGCACGGTTTCGTGAACG CCGGTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACC AAGATGTTTATGGTCAATCAGTATTCACAACGTCAGGTACTAAATGGTTGACATCCTACA GCACCGGTSAATGTARASGTCTCTGACTTTTGGACAAACCGTAATGTAAAA TGACATCCTACATGACTGTGAACATTAATGATAAAGACTATACAATGGCAGCGGT TTTTCACGACTTCAGGCTCAAAATGGTTAAGCGCCTATAKRACGGTAAA ACTTCAGGCTCAAAATGGTTAAGCGCCTATAKRACGGTAAAYATKAATGGAAATA TGGTTAAGCGCCTATATGACAGTMAACATCAATGGTCAYAACTATACRATGGC GTTTTCACAACWGCRGGTTCAAAGTGGTTAAGCGCCTATATGACAGT TTTAGCTCGGTTAGCTGGCGGTTCTACAATTGAACAAGCATTAGGTATT GTTTCTCAGCCAGACACAGGTGAGCAAGCGCTAG CACCCAACCACAGCMACGCATCGTTATGTKGCAGAGAAAA ACGTTGATATCGATAACCTGTTGGTATCCCAGCCAGATACC GCCGGTCAATGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAAC AACGTCAGGTACTAAATGGTTGACATCCTACATGACTGTGAGCATTAATAATAAAGACTA GCAGAAATCGAAGGTGAGATGGGCGAYTCGCAC TTCGGTTAACGGCTGGAGCTGTCACGGCAGTTG AGCTGTCACGGCAGTTGGAACCAAGTTTGGGGC GAACACAAACCCGTTCCGAGAGCTTACTCGGTCAGACAATAT

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Target

viuB

vvhA

recA

vvhA

VV

tdh

tdh

479

GH

tl

recA

ORF8

recA

VA

trh2

trh2

trh1

trh1

tdh234

VP

tdh1

tdh234

tl

tdh1

toxR

tcpI

recA

ctxA

ctxA

hlyA

toxR

hlyA

VC

VC/VM

recA

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Fig. 1. Summary of the results of the specificity tests on selected probe pairs. The results of the PCR-LDR-UA assay are shown in terms of unadjusted P-value of the one sided t-test: white cells represent significant signals (P b 0.01). The strain and the amplicon tested are displayed in the left column. PCR: single-target amplification, Mplx: multiplex amplification, VC: Vibrio cholerae, VV: V. vulnificus, VP: V. parahaemolyticus, VA: V. alginolyticus, VM: V. mimicus, GH: Grimontia hollisae. Probe pairs and corresponding ZipCodes are provided on the bottom, grouped according to target species. ZipCode 66 is the hybridization control, “Blank” is the mean of negative controls (empty spots), “Other” represents the mean of all the remaining ZipCodes in the Universal Array not associated to any probe pair.

viuB

vvhA

vvhA

VV

tdh

recA

tdh GH

tl

recA

recA

VA

trh2

ORF8

trh2

trh1

trh1

tdh234

VP

tdh1

tdh234

tl

tdh1

toxR

tcpI

recA

ctxA

hlyA

hlyA

ctxA

VC

VC /VM

toxR

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

recA

480

Fig. 2. Summary of the results on experimentally infected and retail shellfish samples. The results of the PCR-LDR-UA assay are shown in terms of unadjusted P-value of the one sided t-test: white cells represent significant signals (P b 0.01). A–E: experimentally infected samples; 1–23: retail shellfish samples. Probe pairs and corresponding ZipCodes are provided on the bottom, grouped according to target species. ZipCode 66 is the hybridization control, “Blank” is the mean of negative controls (empty spots), “Other” represents the mean of all the remaining ZipCodes in the Universal Array not associated to any probe pair.

LDR-UA assay we developed allows the rapid and high-resolution identification of the most harmful Vibrio species for human health. In addition, it potentially achieves the successful detection of strains usually not relevant to human concern, which could, however, have acquired clinical significance by HGT of virulence factors. The array prototype exhibited high specificity in the detection of the target genes on reference strains and environmental isolates. However, a cross-reaction of V. diabolicus strains towards V. alginolyticus tl amplicon was observed, but with no corresponding signal for the recA gene. The double-probe identification system of the array, thus, allows the differentiation of this two species, thanks to the different hybridization patterns observed: a signal from the VA-tl probe without the corresponding signal from the VA-recA probe suggests the presence of V. diabolicus strains, while a positive signal from both probes indicates the presence of V. alginolyticus. Little is known about V. diabolicus, a recently discovered, non pathogenic species, phylogenetically closely related to V. parahaemolyticus. On the basis of our findings, this species possesses a tl gene, sharing the same haplotype with V. alginolyticus, causing possible interference in the molecular identification of V. alginolyticus strains. However these species could be efficiently distinguished by recA gene sequences, allowing researchers to be confident in the species identification also on non-previously characterized samples.

The performance of the PCR-LDR-UA in the environmental and seafood monitoring studies was rated by the detection of Vibrio strains in retail shellfish samples. The presence of target vibrios was assessed in 57% of the analyzed mollusc samples. Among these positive samples, half were infected by V. parahaemolyticus and V. alginolyticus, two of the most common vibrios reported in the Adriatic Sea (Masini et al., 2007; Vezzulli et al., 2009). The multi-probe positive signal corroborates the robustness of the results. The detection of trh2+ strains of V. parahaemolyticus in two samples is consistent with the previous finding of only few potentially pathogenic trh+ strains of this species in the Adriatic Sea (Caburlotto et al., 2009; Fabbro et al., 2010; Ottaviani et al., 2010). The hybridization pattern showing a positive signal of the VA-tl probe coupled to a negative VA-recA signal could indicate the presence of V. diabolicus strains in three shellfish samples. TCBS isolation, followed by biochemical screening of isolates, failed in the detection of target Vibrio species in 13 out of 23 retail shellfish samples screened, demonstrating the higher sensitivity of PCR-LDR-UA with respect to conventional microbiological approach. Possible explanations for these results are consistent with some considerations: the isolation method does not include an enrichment step and provides the analysis of a statistically significant number of the isolated colonies, but not all of them. This approach is inherently

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Fig. 3. Sensitivity assessment results. P-value plots derived from the dilution tests performed on three Vibrio parahaemolyticus strains: tl amplicon on isolate 178-1 (solid black line), toxR amplicon on ATCC 17802 (light gray line) and isolate 178-14 (dashed black line). Y-axis reports the one-sided t-test P-value, in logarithmic scale. X-axis is the concentration of PCR product (fmol). The horizontal line represents P-value threshold for significance (i.e.: 0.01), whereas vertical lines represent the boundary of the detection limit, between 6 and 3 fmol.

less sensitive and accurate than molecular methods, able to identify even small amounts of cells, living, dead or in the VBNC state (Vora et al., 2005). The detection assay of Vibrio species in shellfish based on the PCRLDR-UA platform has the advantage of combining high efficiency and rapidity. Because microbiological isolation of colonies is unnecessary, the procedure provides reliable results in 8 h after the enrichment step. In contrast, current microbiological methods have a longer duration of multiple days. The addition of the enzymatic-mediated Ligation Detection Reaction after the amplification step has at least two main advantages over conventional PCR methods: a) the sensitivity limit to 6 fmol of PCR product is far below any detectable limit on conventional detection methods for PCR products (e.g.: agarose gel); b) more noteworthy, the LDR step allows a robust identification of the PCR products which could not have been possible simply evaluating the size of the PCR products. The multiple-probe strategy gave an unequivocal distinction between V. cholerae (based on hlyA variants) and V. parahaemolyticus (based on tdh and trh genes) strains. Current Real-Time PCR detection methods provide rapid, high sensitive and exact quantification of the targets (Tebbs et al., 2011). However, the PCR-LDR-UA method has the advantages over Real-Time PCR to be more cost-effective when many loci (>10) have to be investigated simultaneously (Lauri et al., 2011; Wang et al., 2008). Several microarray-based platforms for the detection of pathogenic Vibrio spp. have been developed in the last years (Call, 2005; Chen et al., 2011; Gonzalez et al., 2004; Kim et al., 2010; Panicker et al., 2004; Vora et al., 2005). Panicker et al. (2004) focused to the three main human-pathogen species V. cholerae, V. parahaemolyticus and V. vulnificus. Vora et al. (2005) carried out an exhaustive characterization of pathogenic Vibrio spp. using a RNA-based procedure on Vibrio isolates, which however, seems to be less suitable for the direct Vibrio detection in complex matrices such as shellfish. Otherwise, the developed PCRLDR-UA platform has been successfully applied for Vibrio identification in mollusc samples and has the advantage to be particularly flexible, because probe pairs can be eliminated, added or replaced at the cost of oligonucleotide synthesis. Since all the ZipCodes have the same Tm, the Universal Array format can be used regardless of the target species or genes, thus sensibly reducing the costs and setup time.

481

Furthermore, problems related to secondary structure of the target DNAs or steric hindrance of differently sized targets (Peplies et al., 2003) are avoided or minimized by the enzymatic ligation and by the relatively high hybridization Tm (i.e.: 65 °C). The implementation of simple and flexible microarray tools is a relevant need in the diagnostic research field, as highlighted by recent literature in which an array based genotyping platform developed for human clinical application (as it was for the LDR-UA technique) was applied for pathogens detection (Chen et al., 2011). The identification of multiple pathogenic strains through the detection of specific virulence-factor genes is an innovative approach that is currently replacing the genotyping of species-specific polymorphisms of universal markers, as 16S rRNA gene. Moreover, the increasing genomic information available in public database enables the identification of species-specific target sequences and advanced molecular techniques, like multiplex PCR, allow the simultaneous amplification of tens of markers (Kim et al., 2010). The strength of the developed PCR-LDRUA platform relies on the coupling of information from multiple species-specific marker genes with that of the primary Vibrio virulence factors. This multilocus typing approach confers reliability and specificity to the strains detection, through the accurate identification at species level (achieved with a double markers system) and the characterization of their harmful potential. In order to protect consumer health and avoid financial losses in the shellfish industry, the microbiological safety of seafood products is a matter of fundamental importance. The PCR-LDR-UA assay here described can be used as a screening tool for pathogen detection in retail shellfish: positive samples can be further investigated through additional methods; for those resulting negative, on the other hand, laborious, time- and cost-expensive techniques can be avoided. The array here developed represents a first application of this sensitive, specific, and rapid detection system for pathogenic Vibrio in shellfish destined to human consumption and could complement current molecular methods in the screening of species potentially harmful for human health. Supplementary materials related to this article can be found online at doi: 10.1016/j.ijfoodmicro.2011.11.010. Acknowledgments This work was supported by a grant from University of Bologna from Strategic Research Project 2005 MICRO(BI)ARRAY coordinated by Fausto Tinti. We also acknowledge partial financial support from MIUR (FIRB “MICRAM”, RBNE01ZB7A; FIRB2003, RBLA03ER38_004). We are grateful to Ronnie Gavilan Chavez, University of Santiago de Compostela, Spain for providing clinical strains of V. parahaemolyticus. References Bej, A.K., Patterson, D.P., Brasher, C.W., Vickery, M.C., Jones, D.D., Kaysner, C.A., 1999. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. Journal of Microbiological Methods 36, 215–225. Caburlotto, G., Gennai, M., Ghidini, V., Tafi, M., Lleo, M.M., 2009. Presence of T3SS2 and other virulence-related genes in tdh-negative Vibrio parahaemolyticus environmental strains isolated from marine samples in the area of the Venetian Lagoon, Italy. FEMS Microbiology Letters 70, 506–514. Call, D.R., 2005. Challenges and opportunities for pathogen detection using DNA microarrays. Critical Reviews in Microbiology 31, 91–99. Candela, M., Consolandi, C., Severgnini, M., Biagi, E., Castiglioni, B., Vitali, B., De Bellis, G., Brigidi, P., 2010. High taxonomic level fingerprint of the human intestinal microbiota by Ligase Detection Reaction — Universal Array approach. BMC Microbiology 10, 116. Chen, J., Iannone, M.A., Li, M.S., Taylor, J.D., Rivers, P., Nelsen, A.J., Slentz-Kesler, K.A., Roses, A., Weiner, M.P., 2000. A microsphere-based assay for multiplexed single nucleotide polymorphism analysis using single base chain extension. Genome Research 10, 549–557. Chen, W., Yu, S., Zhang, C., Zhang, J., Shi, C., Hu, Y., Suo, B., Cao, H., Shi, X., 2011. Development of a single base extension-tag microarray for the detection of pathogenic Vibrio species in seafood. Applied Microbiology and Biotechnology 89, 1979–1990.

482

A. Cariani et al. / International Journal of Food Microbiology 153 (2012) 474–482

Cremonesi, P., Pisoni, G., Severgnini, M., Consolandi, C., Moroni, P., Raschetti, M., Castiglioni, B., 2008. Pathogen detection in milk samples by ligation detection reaction-mediated universal array method. Journal of Dairy Science 92, 3027–3039. Dutta, C., Pan, A., 2002. Horizontal gene transfer and bacterial diversity. Journal of Bioscience 27, 27–33. Fabbro, C., Cataletto, B., Del Negro, P., 2010. Detection of pathogenic Vibrio parahaemolyticus through biochemical and molecular-based methodologies in coastal waters of the Gulf of Trieste (North Adriatic Sea). FEMS Microbiology Letters 307, 158–164. Fields, P.I., Popovic, T., Wachsmuth, K., Olsvik, O., 1992. Use of polymerase chain reaction for detection of toxigenic Vibrio cholerae O1 strains from the Latin American cholera epidemic. Journal of Clinical Microbiology 30, 2118–2121. Gonzalez, S.F., Krug, M.J., Nielsen, M.E., Santos, Y., Call, D.R., 2004. Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray. Journal of Clinical Microbiology 42, 1414–1419. González-Escalona, N., Blackstone, G.M., DePaola, A., 2006. Characterization of a Vibrio alginolyticus strain, isolated from Alaskan oysters, carrying a hemolysin gene similar to the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus. Applied and Environmental Microbiology 72, 7925–7929. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95–98. Hervio-Heath, D., Colwell, R.R., Derrien, A., Robert-Pillot, A., Fournier, J.M., Pommepuy, M., 2002. Occurrence of pathogenic vibrios in coastal areas of France. Journal of Applied Microbiology 92, 1123–1135. Jiang, S.C., Paul, J.H., 1998. Gene transfer by transduction in the marine environment. Applied and Environmental Microbiology 64, 2780–2787. Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. Journal of Clinical Microbiology 37, 1173–1177. Kim, D.H., Lee, B.K., Kim, Y.D., Rhee, S.K., Kim, Y.C., 2010. Detection of representative enteropathogenic bacteria, Vibrio spp., pathogenic Escherichia coli, Salmonella spp., Shigella spp., and Yersinia enterocolitica, using a virulence factor gene-based oligonucleotide microarray. Journal of Microbiology 48, 682–688. Lauri, A., Castiglioni, B., Severgnini, M., Gorni, C., Mariani, P., 2010. A method based on the Ligation Detection Reaction-Universal Array (LDR-UA) for the detection and characterization of Listeria and Campylobacter strains. European Food Research and Technology 231, 985–998. Lauri, A., Castiglioni, B., Morabito, S., Tozzoli, R., Consolandi, C., Mariani, P., 2011. A tool based on Ligation Detection Reaction-Universal Array (LDR-UA) for the characterization of VTEC by identification of virulence-associated and serogroup-specific genes. Molecular and Cellular Probes 25, 35–43. Masini, L., De Grandis, G., Principi, F., Mengarelli, C., Ottaviani, D., 2007. Research and characterization of pathogenic vibrios from bathing water along the Conero Riviera (Central Italy). Water Research 41, 4031–4040. Myers, M.L., Panicker, G., Bej, A.K., 2003. PCR detection of a newly emerged pandemic Vibrio parahaemolyticus O3:K6 pathogen in pure cultures and seeded waters from the Gulf of Mexico. Applied and Environmental Microbiology 69, 2194–2200. Noguerola, I., Blanch, A., 2008. Identification of Vibrio spp. with a set of dichotomous keys. Journal of Applied Microbiology 105, 175–185. Ottaviani, D., Leoni, F., Rocchegiani, E., Canonico, C., Potenziani, S., Santarelli, S., Masini, L., Scuota, S., Carraturo, A., 2010. Vibrio parahaemolyticus-associated gastroenteritis

in Italy: persistent occurrence of O3:K6 pandemic clone and emergence of O1:KUT serotype. Diagnostic Microbiology and Infectious Disease 66, 452–455. Panicker, G., Call, D.R., Krug, M.J., Bej, A.K., 2004. Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays. Applied and Environmental Microbiology 70, 7436–7444. Peplies, J., Glöckner, F.O., Amann, R., 2003. Optimization strategies for DNA microarraybased detection of bacteria with 16S rRNA-targeting oligonucleotide probes. Applied and Environmental Microbiology 69, 1397–1407. Rantala, A., Rizzi, E., Castiglioni, B., De Bellis, G., Sivonen, K., 2008. Identification of hepatotoxin-producing cyanobacteria by DNA-chip. Environmental Microbiology 10, 653–664. Rivera, I.N.G., Chun, J., Huq, A., Sack, R.B., Colwell, R.R., 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Applied and Environmental Microbiology 67, 2421–2429. Serratore, P., Turtura, G.C., Rinaldini, E., Milandri, S., Presepi, D., 1999. Phenotypic characterization of some bacterial populations belonging to the genus Vibrio. Annali di Microbiologia ed Enzimologia 49, 79–88. Severgnini, M., Cremonesi, P., Consolandi, C., Caredda, G., De Bellis, G., Castiglioni, B., 2009. ORMA: a tool for identification of species-specific variations in 16S rRNA gene and oligonucleotides design. Nucleic Acids Research 37, e109. Sipari, H., Rantala-Ylinen, A., Jokela, J., Oksanen, I., Sivonen, K., 2010. Development of a chip assay and quantitative PCR for detecting microcystin synthetase E gene expression. Applied and Environmental Microbiology 76, 3797–3805. Tebbs, R.S., Brzoska, P.M., Furtado, M.R., Petrauskene, O.V., 2011. Design and validation of a novel multiplex Real-Time PCR assay for Vibrio pathogen detection. Journal of Food Protection 74, 939–948. Thompson, F.L., Iida, T., Swings, J., 2004a. Biodiversity of vibrios. Microbiology and Molecular Biology Reviews 68, 403–431. Thompson, C.C., Thompson, F.L., Vandemeulebroecke, K., Hoste, B., Dawyndt, P., Swings, J., 2004b. Use of recA as an alternative phylogenetic marker in the family Vibrionaceae. International Journal of Systematic and Evolutionary Microbiology 54, 919–924. Thompson, F.L., Gevers, D., Thompson, C.C., Dawyndt, P., Naser, S., Hoste, B., Munn, C.B., Swings, J., 2005. Phylogeny and molecular identification of vibrios on the basis of multilocus sequence analysis. Applied and Environmental Microbiology 71, 5107–5115. Vezzulli, L., Pezzati, E., Moreno, M., Fabiano, M., Pane, L., Pruzzo, C., 2009. Benthic ecology of Vibrio spp. and pathogenic Vibrio species in a coastal Mediterranean environment (La Spezia Gulf, Italy). Microbial Ecology 58, 808–818. Vora, G.J., Meador, C.E., Bird, M.M., Bopp, C.A., Andreadis, J.D., Stenger, D.A., 2005. Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proceedings of the National Academy of Sciences 102, 19109–19114. Wang, X.L., Xie, S.G., Zhang, L., Yang, W.X., Wang, X., Jin, H.Z., 2008. Comparison of ligase detection reaction and real-time PCR for detection of low abundant YMDD mutants in patients with chronic hepatitis B. World Journal of Gastroenterology 14, 120–124. Wilson, W.J., Strout, C.L., DeSantis, T.Z., Stilwell, J.L., Carrano, A.V., Andersen, G.L., 2002. Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Molecular and Cellular Probes 16, 119–127.