Detection of pathogenic bacteria in shellfish using multiplex PCR followed by CovaLink™ NH microwell plate sandwich hybridization

Journal of Microbiological Methods 53 (2003) 199 – 209 www.elsevier.com/locate/jmicmeth

Detection of pathogenic bacteria in shellfish using multiplex PCR followed by CovaLinkk NH microwell plate sandwich hybridization Chi-Ying Lee 1,2, Gitika Panicker 2, Asim K. Bej * Department of Biology, University of Alabama at Birmingham, 1300 University Boulevard, Birmingham, AL 35294-1170, USA

Abstract Outbreak of diseases associated with consumption of raw shellfish especially oysters is a major concern to the seafood industry and public health agencies. A multiplex PCR amplification of targeted gene segments followed by DNA – DNA sandwich hybridization was optimized to detect the etiologic agents. First, a multiplex PCR amplification of hns, spvB, vvh, ctx and tl was developed enabling simultaneous detection of total Salmonella enterica serotype Typhimurium, Vibrio vulnificus, Vibrio cholerae and Vibrio parahaemolyticus from both pure cultures and seeded oysters. Amplicons were then subjected to a colorimetric CovaLinkk NH microwell plate sandwich hybridization using phophorylated and biotinlylated oligonucleotide probes, the nucleotide sequences of which were located internal to the amplified DNA. The results from the hybridization with the multiplexed PCR amplified DNA exhibited a high signal/noise ratio ranging between 14.1 and 43.2 measured at 405 nm wavelength. The sensitivity of detection for each pathogen was 102 cells/g of oyster tissue homogenate. The results from this study showed that the combination of the multiplex PCR with a colorimetric microwell plate sandwich hybridization assay permits a specific, sensitive, and reproducible system for the detection of the microbial pathogens in shellfish, thereby improving the microbiological safety of shellfish to consumers. D 2003 Elsevier Science B.V. All rights reserved. Keywords: Sandwich hybridization; Multiplex PCR; Shellfish; Pathogen; CovaLinkk NH

1. Introduction Shellfish concentrate microorganisms in their tissue from surrounding waters during the filter-feeding process and are recognized as the reservoir for various

* Corresponding author. Tel.: +1-205-934-9857; fax: +1-205975-6097. E-mail address: [email protected] (A.K. Bej). 1 Current address: Department of Biology, National Changhua University of Education, Changhua 500, Taiwan, ROC. 2 Equal efforts were made to this study by these authors.

microbial pathogens (Elliot et al., 1995; Potasman et al., 2002). Besides accumulating naturally occurring microorganisms such as Vibrio vulnificus, Vibrio parahaemolyticus and their pathogenic forms, these molluscan shellfish are also prone to contamination by fecal pathogens, primarily, Salmonella spp., Shigella spp., Escherichia coli and enteric viruses from sewage-polluted waters (Roberts et al., 1990; Rippey, 1994; Wilson and Moore, 1996). The harmful effect of the presence of these pathogenic microorganisms is augmented by the fact that shellfish, particularly oysters, are consumed in its raw form. Recently,

0167-7012/03/$ - see front matter D 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0167-7012(03)00032-0

200

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

gastroenteritis-related illnesses, caused by a newly emerged serotype of V. parahaemolyticus O3:K6, marked the largest reported foodborne outbreak in the United States (CDC, 1998, 1999; Daniels et al., 2000; DePaola et al., 2000). Like V. parahaemolyticus, V. vulnificus is a naturally occurring estuarine microorganism found in high numbers in molluscan shellfish, primarily in oysters. V. vulnificus is known to cause deaths in susceptible individuals when ingested through the consumption of raw or poorly cooked oysters (CDC, 1993, 1996; Hlady and Klontz, 1996; Hlady, 1997). This microorganism is also capable of causing life-threatening septicemia through wound infection (Linkous and Oliver, 1999). In addition, outbreaks and sporadic illnesses caused by Vibrio cholerae have been reported in the United States as well as in other countries (DePaola et al., 1992; Klontz et al., 1987; McCarthy et al., 1992; CDC, 1982, 1986, 1993; Weber et al., 1994a,b). Besides vibrios, sporadic incidences of Salmonellarelated gastroenteritis have also been reported due to the consumption of sewage-contaminated shellfish (Allen, 1899; Goh, 1981; Greenwood et al., 1998; Mead et al., 1999). Outbreaks of disease from the consumption of contaminated raw oysters are therefore a major concern to the seafood industry and health agencies throughout the world (Potasman et al., 2002). The National Shellfish Sanitation Program and American Public Health Association recommend routine monitoring of consumable shellfish, especially oysters, for the presence of vibrios and fecal pathogens (APHA, 1970; NSSP, 1999). Conventionally, shellfish-associated microbial pathogens are identified by culture-based methods and biochemical tests, which often takes 5– 7 days to complete (Bosch et al., 1994; Rippey, 1994). The applications of PCR-based DNA amplification methods have greatly increased the speed at which these pathogens are detected (Bej et al., 1994; Jones and Bej, 1994; Lett et al., 1995; Kaysner and DePaola, 2001; Gonzalez-Rodriguez et al., 2002). In addition, simultaneous amplification of targeted DNA from shellfish-borne multiple microbial pathogens in a single PCR reaction has further improved the efficiency of the detection process (Brasher et al., 1998; Del Cerro et al., 2002; Murinda et al., 2002). Following PCR, generally, the amplified DNA is analyzed in an agarose gel, and in many occasions, even nucleo-

tide sequence of the amplified DNA is determined to avoid false-positive results (Atlas and Bej, 1994). Conventional DNA –DNA hybridization using genespecific probes is also used for the detection of targeted pathogens in various food matrices with high specificity. However, the sensitivity of detection by this method is often compromised (Gooch et al., 2001; McCarthy et al., 2000; Reddy et al., 1992; Wright et al., 1992). In addition, these methods could prove to be laborious and time-consuming, especially when a large number of samples are analyzed. Therefore, hybridization protocols utilizing an ELISA microwell plate format have been successfully developed, which offer shorter hybridization time, higher sensitivity and easier high-throughput sample processing (Nagata et al., 1985; van der Vliet et al., 1993; Lamoureux et al., 1997; Gutierrez et al., 1998). CovaLinkk NH, a novel type of microwell surface, allows for a solid support DNA hybridization assay by coupling of phosphorylated oligonucleotide probes to the well surface. The microwell surface has secondary amine groups positioned at the end of the spacer arms covalently grafted onto the polystyrene surface and the DNA molecules are covalently bound to this surface by means of a phosphoramidate bond (Chu et al., 1983; Rasmussen et al., 1991). This hybridization methodology has been shown to be as sensitive as radioactive DNA hybridization (Chevrier et al., 1993). In this study, a multiplex PCR was developed for simultaneous amplification of gene fragments from total and pathogenic V. vulnificus, V. parahaemolyticus, V. cholerae and Salmonella enterica serotype Typhimurium from pure cultures and seeded oyster tissue homogenates. Following amplification, a sandwich hybridization protocol was optimized using CovaLinkk NH strips (Nunc, Naperville, IL). The microwell plate format allowed for an efficient validation of the multiplexed PCR amplified DNA and was tested for sensitivity and specificity of detection of different gene targets.

2. Material and methods 2.1. Bacterial strains and media The following bacterial strains were used in the present study: V. cholerae 569B ATCC 25870, V.

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

vulnificus MO6-24, V. parahaemolyticus ATCC 33844, S. enterica serotype Typhimurium ATCC 19585. S. enterica serotype Typhimurium was grown on Luria broth (LB) or LB agar at 37 jC; V. vulnificus on marine agar (MA) (Difco, Detroit, MI), V. cholerae on nutrient agar (NA) (Difco) and V. parahaemolyticus on nutrient agar supplemented with 3% (w/v) NaCl (NA-3) (Difco) and all cultures were grown at 37 jC. The seeded oyster tissues were enriched in alkaline peptone water (APW, pH 8.5) (Atlas, 1993). 2.2. Genomic DNA extraction Genomic DNA was extracted from exponential cultures of the organism by first resuspending in 567 Al of TE buffer (10 mM Tris – Cl, 1.0 mM EDTA, pH 8). Alkaline lysis was performed with 30 Al of 10% (w/ v) sodium dodecyl sulfate and 3 Al of 20 mg/ml proteinase K (Sigma) using a procedure adapted from Ausubel et al. (1987). After 1 h incubation, 100 Al of 5 M NaCl was added along with 80 Al CTAB/NaCl solution to complex with polysaccharides. DNA was purified from proteins and other cellular constituents using an equal volume (780 Al) chloroform-isoamyl alcohol (24:1) followed by centrifugation at 10,000
g for 5 min. Further purification of the supernatant, which was transferred to a new tube, was achieved by adding an equal volume of phenol –chloroform – isoamyl alcohol (25:24:1) followed by centrifugation. Then, 0.6 volume (300 Al) of isopropanol was used to precipitate the DNA. The sample was centrifuged at 10,000
g for 5 min and the DNA pellet washed once with 1 ml cold 70% (v/v) ethanol before being dried under vacuum. The purified DNA was resuspended in 50 Al Tris – EDTA buffer (10 mM Tris – Cl, 1 mM Na2EDTA, pH 8.0) (Ausubel et al., 1987). 2.3. Oligonucleotide primers and probes The target genes, oligonucleotide primer sets and DNA probes used for detection of each of the four pathogens are given in Table 1. The phosphorylated and biotinylated oligonucleotide probes were designed based on the nucleotide sequences internal to the amplified segments of their respective target genes. All oligonucleotide primers and probes were obtained from Integrated DNA Technology (Coralville, ID).

201

2.4. Optimization of multiplex PCR and primer specificity All reactions were carried out using 1 Ag of template DNA, 200 AM of each dNTP, 5 AM of each oligonucleotide primer, 2.5 U of AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT) and 1
reaction buffer. The 1
reaction buffer consisted of 50 mM Tris –Cl (pH 8.9), 50 mM KCl, with varying concentrations (2.5, 4, 6 or 8 mM) of MgCl2. The final volume of the PCR mix was adjusted to 100 Al with sterile distilled water. Reactions were carried out in a DNA thermocycler 2400 (Perkin-Elmer) with the following parameters: an initial denaturation at 94 jC for 3 min; then 30 cycles of amplification of which each cycle consisted of denaturation at 94 jC for 1 min, primer annealing at 55 jC for 2 min, primer extension at 72 jC for 3 min; and final extension of the incompletely synthesized DNA was at 72 jC for 5 min. In order to confirm the specificity of each primer set to its target gene, PCR amplifications were carried out as described above with the exception that only the primer set being tested was added to the reaction mix. All PCR-amplified DNAs were separated in 2% (w/v) NuSieve 3:1 or 2% (w/v) SeaKem agarose (FMC Bioproducts, Rockland, ME) with 1
TAE (pH 8.3) (Ausubel et al., 1987). The gels were then stained with ethidium bromide, visualized on a UV transilluminator (Fotodyne, Hartland, WI), and photographed with a Polaroidk Type 55 film. 2.5. Detection of microbial pathogens in seeded oysters Oysters were processed according to standard methods (APHA, 1986). The resultant homogenates were exposed to UV light (254 nm wavelength) for 1 h, and subsequently subjected to three cycles of freezing at  80 jC followed by thawing at room temperature to reduce the indigenous target microbial population. Cells from each of the microbial strains were mixed separately in 10 ml of APW (pH 8.5). Each culture was 10-fold serially diluted and viable plate counts from each dilution determined. Microbial pathogens from each dilution were used to seed 1 g of oyster homogenate in 5 ml of APW (pH 8.5). After mixing, the seeded homogenates were enriched for 3 h at 37 jC in a rotary shaker. Following enrichment, the samples were centrifuged at 10,000
g for 10 min. The pellets were

202

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

Table 1 Description of oligonucleotide primers and probes used in multiplex PCR and colorimetric detection of microbial pathogens Pathogen

Target gene

Primer/Probe (5V! 3V)

Tm (jC)

Amplicon size (bp)

Source

Total Salmonella spp.

Histone-like nucleoid structuring protien (hns)

66 66

152

Jones et al., 1993; Pon et al., 1988; this study

Pathogenic Salmonella spp.

Salmonella plasmid virulence B (spvB)

70 66

561

Caldwell and Gulig, 1991; this study

Vibrio vulnificus

Vibrio vulnificus hemolysin (vvh)

70 68

205

Brasher et al., 1998; Wright et al., 1985; this study

Vibrio cholerae

Cholera toxin (ctx)

74 70

302

Brasher et al., 1998; Mekalanos et al., 1983; this study

Vibrio parahaemolyticus

Thermolabile hemolysin (tl )

L-hns: taccaaagctaaacgcgcagct R-hns: tgatcaggaaatcttccagttgc PP-hns: ctaaatatagctatgttgacgaaaacggtgaaact BP-hns: cgtacaccggctgtaatcaaaaaagcaatg L-spvB: ggttactgcatgacagtaacggc R-spvB: cgcaaagcttgttcagtatcgg PP-spvB: gagcatatctattactcctacttggcggagaacgg BP-spvB: acgctggtttcccgtctgctgctggagtat L-vvh: ttccaacttcaaaccgaactatgac R-vvh: gctactttctagcattttctcgc PP-vvh: gaagcgcccgtgtctgaaactggcgtaacggattt BP-vvh: gttcttccttcagcgctgttttcggtttac L-ctx: ctcagacgggatttgttaggcacg R-ctx: tctatctctgtagccggtattacg PP-ctx: attagtttgagaagtgcccacttagtgggtcaaac BP-ctx: gtttctgctttaggtgggattccatactcc L-tl: aaagcggattatgcagaagcactg R-tl: gctactttctagcattttctctgc PP-tl: acggacgcaggtgcgaagaacttcatgttgatgac BP-tl: aatgtcacgcatccaacaacagcaactcac

70 68

450

Brasher et al., 1998; Taniguchi et al., 1986; this study

L—PCR primer sequence located on the upstream of the target gene. R—PCR primer sequence located on the downstream of the target gene. PP—probes phosphorylated at the 5V-end. BP—probes biotinylated at the 5V-end.

washed 2
with TE buffer (pH 7.2) and resuspended in 200 Al of sterile distilled water. These samples were subjected to DNA purification using the ‘‘Chelex 100k’’ (Bio-Rad, Hercules, CA) method (Bej and Jones, 1993). Briefly, the resuspended samples were mixed with Chelex 100k [final concentration 5% (w/ v)] by vortexing for 2 min, incubated at 58 jC for 10 min, boiled for 20 min, and mixed with ammonium acetate [final concentration of 2.5 M (w/v)]. After vortexing for 10 s, the treated samples were centrifuged at 10,000
g for 5 min. The supernatants were collected, mixed with an equal volume of Pro-Cipitatek (Affinity Technology), and centrifuged at 10,000
g for 10 min. The precipitation step was repeated a second time. The final supernatants were concentrated using NanoSpink tubes (MW cutoff 100,000) and centrifuged at 2000
g. The concentrated samples (each approximately 30 Al) were saved at 4 jC until used for multiplex PCR amplification. 2.6. CovaLinkk NH microwell plate hybridization A sandwich hybridization assay performed in a microwell format was also used for detecting multi-

plex PCR-amplified DNA according to the method of Chevrier et al. (1993). Phosphorylated capture probes (Table 1) were covalently bound to the surface of CovaLinkk NH strips (Nunc) by a phosphoramidate bond. Various concentrations of the phosphorylated probes and biotinylated probes were tested in order to optimize the assay. Phosphorylated probe concentrations of 500, 1000 and 2000 ng were diluted in water denatured at 95 jC for 10 min, and promptly chilled on ice. One part of ice-cold 140 mM 1-methylimidazole was mixed with 13 parts of the probe solution and 70 Al of the mixture was added to each well of the CovaLinkk NH microwell strips. The strips were kept on ice and 30 Al of a freshly made 167 mM 1ethyl-3-(3-dimethylaminopropyl)-carbodiimide was added to each well. The strips were then incubated in a 50 jC oven. After 5 h of incubation, the wells were washed three times using a washing solution [0.4 N NaOH, 0.25% (w/v) SDS] heated to 50 jC. They were then soaked for 5 min and washed for an additional three times using the same heated washing solution. Finally, the wells were washed three times at room temperature with 10 mM Tris –HCl (pH 8.0) containing 1 mM EDTA. Multiplex PCR-amplified

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

203

3. Results and discussion 3.1. Multiplex PCR

Fig. 1. Agarose gel electrophoresis showing the results of multiplex PCR amplification of five-target gene segments from purified DNA of the four microbial pathogens. Lanes 1 and 8, 123 bp DNA ladder (GIBCO BRL Life Sciences); Lane 2, 561 bp spvB amplicon from S. enterica serotype Typhimurium; Lane 3, 450 bp tl amplicon from V. parahaemolyticus; Lane 4, 302 bp ctx amplicon from V. cholerae; Lane 5, 205 bp vvh amplicon from V. vulnificus; Lane 6, 152 bp hns amplicon from S. enterica serotype Typhimurium; Lane 7, Multiplex PCR amplification of all five target gene segments.

PCR amplification of the mixed genomic DNA from the multiple pathogens with each set of oligonucleotide primers produced a single DNA fragment of expected molecular weight (Fig. 1). This implied that the primers were specific for detection of the individual pathogens used in this study and would not exhibit false-positives on account of the PCR reaction. The results from the multiplex PCR yielded simultaneous amplification of all five targets, spvB, hns, vvh, ctx and tl, with comparable band intensities using the PCR cycling parameters and an annealing temperature of 55 jC (Fig. 1). The molecular weights of the target genes, spvB, hns, vvh, ctx and tl, were 0.561, 0.152, 0.205, 0.302 and 0.45 kbp, respectively. The use of 2.5 mM MgCl2 in PCR reactions resulted in maximum intensities of the amplified DNA bands, whereas the intensities progressively decreased with 4, 6 or 8 mM MgCl2 in the reactions (Fig. 2). Consistent results were obtained from all three experiments.

DNA was denatured in the wells by sequentially adding 95 Al of sterile distilled water, 5 Al of amplified DNA (from 100 Al PCR reaction) and 10 Al of 1N NaOH. After 10 min, 15 Al of 1M NaH2PO4 containing 1% sarkosyl was added and the strips were incubated at 40 jC. After 1 h, 50 Al of 10, 20, 40 or 80 nM of biotinylated detection probes (Table 1) resuspended in 0.1N NaOH, 0.1M NaH2PO4 containing 1% sarkosyl were added to each well. The strips were then incubated at 40 jC overnight. The wells were washed five times with TBS-Tw (20 mM Tris – HCl, pH 7.5, 150 mM NaCl, 0.1% Tween 20) and 100 Al of alkaline phosphatase-avidine conjugate (2 Ag/ ml) in TBS-Tw containing 1% bovine serum albumin was added. After 1 h incubation, the wells were washed five times with TBS-Tw. Finally, 200 Al of substrate solution (375 Ag/ml of paranitrophenyl phosphate in 1 M diethanolamine, pH 9.8, 1 mM MgCl2) was added to each well, and the strips were incubated for 2 h. The absorbance at 405 nm was then determined using a microplate reader (Molecular Devices, Sunnyvale, CA).

Fig. 2. Agarose gel electrophoresis showing the results of optimization of MgCl2 used in multiplex PCR amplification of five target gene segments (spvB, hns, ctx, vvh, tl) using genomic DNA from S. enterica serotype Typhimurium, V. cholerae, V. vulnificus and V. parahaemolyticus, respectively. Lane 1, 123 bp DNA ladder (Gibco); Lane 2, 2.5 mM MgCl2; Lane 3, 4 mM MgCl2; Lane 4, 6 mM MgCl2; Lane 5, 8 mM MgCl2; Lane 6, PCR negative control.

204

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

3.3. Optimization of CovaLinkk NH microwell plate detection using individual amplified target genes from seeded oysters

Fig. 3. Agarose gel electrophoresis showing the sensitivity of detection of target genes by multiplex PCR in oyster tissue homogenate seeded with 10-fold dilutions of S. enterica serotype Typhimurium, V. cholerae, V. vulnificus and V. parahaemolyticus cells after 3 h of enrichment. Lane 1, 123 bp DNA ladder (Gibco); Lane 2, 104 cells; Lane 3, 103 cells; Lane 4, 102 cells; Lane 5, 101 cells; Lane 6, 100 cells; Lane 7, 10 1 cells; Lane 8, PCR negative control.

3.2. Multiplex PCR from seeded oyster tissue homogenate Multiplex PCR from oyster tissue homogenates successfully allowed the detection of all four bacterial pathogens in one PCR tube with relatively equal intensities DNA bands when analyzed in an agarose gel. The sensitivity of detection for each of the target genes following enrichment was shown to be 102 cells/ g of oyster tissue homogenate (Fig. 3). The levels of detection were based on the viable plate count of each of the microbial pathogens inoculated in APW and then seeded in oyster homogenate prior to enrichment. The level of sensitivity obtained was well within the required minimum detection levels described in the National Shellfish Sanitation Program and the American Public Health Association guidelines (APHA, 1970, 1986; NSSP, 1999). The utility of multiplex PCR in the identification of pathogens from clinical, environmental as well as food samples has been well documented (Mahbubani and Berj, 1994; Lett et al., 1995; Mason et al., 2001; Kong et al., 2002; Wang et al., 2002). The results further emphasize that the use of multiplex PCR combining the DNA extraction method could be used for rapid detection of multiple pathogens in shellfish without compromising the required specificity and sensitivity of detection.

In order to achieve acceptable signal/noise (S/N) ratios at 405 nm wavelength, the CovaLinkk NH microwell hybridization method was first optimized by varying the concentrations of the phosphorylated (PP) and biotinylated probes (BP) as well as the amount of carbodiimide used. The ‘signal’ value recorded was that of the wells, which received the target gene to be detected, while the ‘noise’ was that recorded from wells that did not receive the target gene but were otherwise treated identically. An optimum S/N ratio was that of signal being two-folds higher than the background or noise. First, the concentration of carbodiimide buffer used for covalent binding of the phosphorylated probe to the wells of CovaLinkk microwell plates was evaluated. An initial concentration of 167 mM carbodiimide tested using 1000 ng of PP-hns and 10 nM BP-hns produced a S/N ratio of 13.22. Increasing the concentrations of the carbodiimide up to 3
(500 mM) the initial concentration also did not show any significant increase in the S/N ratio and therefore was not changed for the assay of the PCR products (data not shown). Second, hybridizations with various concentrations (500 and 1000 ng) of phosphorylated probe (PP), fixed concentration of biotinylated probe (BP) (10 nM) and PCR amplified DNA from individual target genes in CovaLinkk NH microwell exhibited high S/N ratios for all target genes except for ctx (Table 2). Therefore, in order to increase the value for the S/N ratio for ctx, a higher concentration of PP-ctx (1000 and 2000 ng) as well as varying concentrations

Table 2 Representative results of colorimetric detection of PCR-amplified hns target gene with varying concentrations of phosphorylated probe (PP-hns) and 10 nM biotinylated probe (BP-hns) using a sandwich hybridization assay PP-hns (ng)

Signala

Noiseb

S/N ratio

nc

500 1000

0.747 F 0.08 1.13 F 0.34

0.12 F 0.09 0.07 F 0.04

6.22 16.14

4 4

a Absorbance generated when only the target amplicon was assayed. b Absorbance generated when no target amplicon was assayed. c Sample size (number of wells used during each assay).

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

of BP-ctx was attempted (Table 3). Increasing the concentrations of both PP-ctx and BP-ctx, above 1000 ng and 10 nM, respectively, did not show a proportional increase in S/N ratio, but was seven- to eightfold higher in absorbance than the background signal. This level of increase is well within the acceptable range for the positive detection. The S/N ratios obtained for all five targeted genes using 1000 ng of PP and 10 nM of BP are shown in Table 4. The difference in S/N ratio observed for hns target in Tables 2 and 4 is possibly due to the difference in efficiency of the PCR amplification method, which is directed by the interaction of the primers and the target gene during the first 5 – 10 amplification cycles (Atlas and Bej, 1994). Increasing the concentrations of the probes further was not attempted, as it would not be cost-effective for developing an assay for routine monitoring of shellfish for the presence of these pathogens. The results shown were consistent for the assay conducted in triplicate with very low variability between assays. 3.4. CovaLinkk NH detection of multiplex PCR amplified target genes from seeded oysters The results of the CovaLinkk NH detection of the multiplex PCR products exhibited high specificity and sensitivity in the identification of all five-target

Table 3 Colorimetric detection of PCR-amplified ctx target gene with varying concentrations of phosphorylated probe (PP-ctx) and biotinylated probe (BP-ctx) using a sandwich hybridization assay BP-ctx (nM)

Signala

(A) With 1000 ng PP-ctx 80 0.42 F 0.008 40 0.42 F 0.017 20 0.53 F 0.007 10 0.388 F 0.04 (B) With 2000 ng of PP-ctx 80 0.296 F 0.2 40 0.37 F 0.026 20 0.465 F 0.028 10 0.4 F 0.003 a

Noiseb

S/N ratio

nc

0.059 F 0.002 0.05 F 0.026 0.058 F 0.007 0.053 F 0.005

6.8 8.4 9.1 7.3

3 3 3 3

0.06 F 0.01 0.061 F 0.008 0.05 F 0.001 0.045 F 0.01

4.9 6.06 9.3 8.9

3 3 3 3

Absorbance generated when only the target amplicon was assayed. b Absorbance generated when no target amplicon was assayed. c Sample size (number of wells used during each assay).

205

Table 4 Colorimetric detection of individual PCR-amplified target genes with 1000 ng phosphorylated probe and 10 nM biotinylated probe using a sandwich hybridization assay Target gene

Signala

Noiseb

S/N ratio

nc

hns vvh ctx tl spvB

1.34 F 0.12 0.61 F 0.01 0.24 F 0.01 0.75 F 0.18 1.72 F 0.28

0.031 F 0.015 0.032 F 0.006 0.017 F 0.007 0.026 F 0.012 0.042 F 0.030

43.22 19.06 14.10 28.84 43.00

3 3 3 3 3

a Absorbance generated when only the target amplicon was assayed. b Absorbance generated when no target amplicon was assayed. c Sample size (number of wells used during each assay).

genes. The ‘signal’ wells in this case had all five amplicons added to them whereas the ‘noise’ wells had four amplicons added except the amplicon that was to be detected. The hybridization parameters used were as optimized with the individual PCRCovaLinkk detection described earlier. All five amplicons were shown to hybridize with high specificity to the respective oligonucleotide probes coupled to the well surfaces of the microwell plate (Table 5; Fig. 4). The noise associated with each of the reactions was minimal, thus ensuring that the multiplex PCR products did not cross-react with the other probes. Hybridization between the immobilized oligonucleotide probes and the multiplex PCR amplified DNA exhibited detectable S/N ratio for as low as 102 cells/g of oyster tissue homogenate. The coefficient of variation between triplicate inter-assays was about 3% with low standard deviations between the intra-assay wells. Therefore, the results show that the Table 5 Colorimetric detection of multiplex PCR-amplified amplicons using a sandwich hybridization assay Target gene

Signala

Noiseb

S/N ratio

nc

hns vvh ctx tl spvB

1.38 F 0.006 0.30 F 0.033 0.47 F 0.01 0.49 F 0.04 0.35 F 0.03

0.039 F 0.005 0.019 F 0.01 0.049 F 0.007 0.029 F 0.02 0.024 F 0.002

35.38 15.78 9.59 16.90 14.60

3 3 3 3 3

a

Absorbance generated when only the target amplicon was assayed. b Absorbance generated when all four non-target amplicons were assayed. c Sample size.

206

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

Fig. 4. Colorimetric CovaLinkk NH microwell plate hybridization assay of multiplex PCR products exhibiting specificity of detection of the four microbial pathogens seeded in oyster tissue homogenates. Lanes A, B, E and F exhibit a positive identification of the target whereas Lanes C, D, G and H were negative controls. Row 1, pathogenic S. enterica serotype Typhimurium; Row 2, V. cholerae; Row 3, V. parahaemolyticus; Row 4, total S. enterica serotype Typhimurium; Row 5, V. vulnificus. Each reaction was conducted in duplicate.

CovaLinkk hybridization method is an effective means of verifying gene products obtained from PCR amplification method.

4. Conclusion Simultaneous amplification of the five target gene segments was achieved by multiplex PCR of both purified genomic DNA as well as DNA from oyster tissue homogenate seeded with four microbial pathogens. These pathogens were detected with high specificity and with a sensitivity of 102 cells/g of oyster using the optimized PCR parameters. The multiplex PCR products were further validated by the non-radioactive and colorimetric CovaLinkk NH microtiter plate hybridization assay. DNA hybridization with all five target genes, spvB, hns, tl, vvh and ctx, was shown to be specific and produced the same sensitivity level of detection as obtained by gel electrophoresis. The advantage of this colorimetric, non-radioactive method has been exploited in the clinical laboratories for the measurement of specific immunoglobulins and antigens (Spoljar and Tomasic, 2000; Denis et al., 1997; Zielen et al., 1996). The detection of Salmonella spp. from food samples has also been evaluated using CovaLinkk NH hybridization with either colorimetric, fluorimetric or chem-

iluminescent detection (Cano et al., 1993; Rasmussen et al., 1994; Soumet et al., 1995, 1997). But this is the first report of detection and validation of PCR products of multiple pathogens from oyster homogenates using the CovaLinkk NH microtiter plate colorimetric hybridization approach. One of the advantages of this approach is that once the oligonucleotide probes are immobilized onto the CovaLinkk NH plates, they can be stored at 5 jC for up to 2 months (Spoljar and Tomasic, 2000; Chevrier et al., 1993). In addition, the use of 2 oligonucleotide probes for sandwich hybridization increased the specificity of detection of respective target DNA. Therefore, detection of multiple microbial pathogens using multiplex PCR amplification followed by colorimetric hybridization in 96 microwell plate can be used to analyze a relatively large number of oyster samples in a relatively short time without the use of hazardous chemicals such as radionucleotides and ethidium bromide.

Acknowledgements This research was supported in part by funding from the Mississippi Alabama SeaGrant Consortium and The University of Alabama at Birmingham under the grant NA86RG0039-4 [Project No. R/SP-1].

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

References Allen, K., 1899. The transmission of typhoid by sewage polluted oysters. Am. Public Health Assoc. 25, 154 – 165. American Public Health Association, 1970. Recommended Procedures for the Examination of Seawater and Shellfish. American Public Health Association, Washington, DC. American Public Health Association, 1986. Laboratory Procedures for the Examination of Seawater and Shellfish, 7th ed. American Public Health Association, Washington, DC. Atlas, R.M., 1993. Handbook of Microbiological Media. CRC Press, Boca Raton, FL. Atlas, R.M., Bej, A.K., 1994. Polymerase Chain Reaction. In: Gerhardt, P. (Editor-in-Chief), Murray, R.G.E., Wood, W.A., Kraig, N.R. (Eds.), Methods for General and Molecular Bacteriology. ASM Press, Washington, DC, pp. 418 – 435. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Sideman, J.G., Smith, J.A., Struhl, K., 1987. Current Protocols in Molecular Biology. Wiley, New York, pp. 2.10 – 2.11. Bej, A.K., Jones, D.D., 1993. Detection of Salmonella spp., V. cholerae, and V. vulnificus from artificially contaminated shellfish by multiplex polymerase chain reaction (PCR) and gene probes. 93rd Annual Meeting of American Society For Microbiology, Atlanta, GA, Abst. Q-208. Bej, A.K., Mahbubani, M.H., Boyce, M.J., Atlas, R.M., 1994. Detection of Salmonella spp. in oysters by PCR. Appl. Environ. Microbiol. 60, 368 – 373. Bosch, A., Xavier, A.F., Gajardo, R., Pinto, R.M., 1994. Should shellfish be purified before public consumption? Lancet 344, 1024 – 1025. Brasher, C.W., DePaola, A., Jones, D.D., Bej, A.K., 1998. Detection of microbial pathogens in shellfish with multiplex PCR. Curr. Microbiol. 37, 101 – 107. Caldwell, A.L., Gulig, P.A., 1991. The Salmonella typhimurium virulence plasmid encodes a positive regulator of a plasmidencoded virulence gene. J. Bacteriol. 173, 7176 – 7185. Cano, R.J., Rasmussen, S.R., Sanchez Fraga, G., Palomares, J.C., 1993. Fluorescent detection-polymerase chain reaction (FDPCR) assay on microwell plates as a screening test for salmonellas in foods. J. Appl. Bacteriol. 75, 247 – 253. Centers for Disease Control and Prevention, 1982. Epidemiologic notes and reports Non-O1 Vibrio cholerae gastroenteritis—New Hampshire. MMWR 31, 538 – 539. Centers for Disease Control and Prevention, 1986. Epidemiologic notes and reports toxigenic Vibrio cholerae 01 infections—Louisiana and Florida. MMWR 35, 606 – 607. Centers for Disease Control and Prevention, 1993. Isolation of Vibrio cholerae O1 from oysters—Mobile Bay, 1991 – 1992. MMWR 42, 91 – 93. Centers for Disease Control and Prevention, 1996. Vibrio vulnificus infections associated with eating raw oysters—Los Angeles. MMWR 45, 621 – 624. Centers for Disease Control and Prevention, 1998. Outbreak of Vibrio parahaemolyticus infections associated with eating raw oysters—Pacific Northwest, 1997. MMWR 47, 457 – 462.

207

Centers for Disease Control and Prevention, 1999. Outbreak of Vibrio parahaemolyticus infection associated with eating raw oysters and clams harvested from Long Island Sound—Connecticut, New Jersey, and New York, 1998. MMWR 48, 48 – 51. Chevrier, D., Rasmussen, S.R., Guesdon, J.L., 1993. PCR product quantification by non-radioactive hybridization procedures using an oligonucleotide covalently bound to microwells. Mol. Cell Probes 7, 187 – 197. Chu, B.C., Wahl, G.M., Orgel, L.E., 1983. Derivatization of unprotected polynucleotides. Nucleic Acids Res. 11, 6513 – 6529. Daniels, N., Ray, B., Easton, A., Marano, N., Kahn, E., McShan, A.L., Del Rosario, L., Baldwin, T., Kingsley, M.A., Puhr, N.D., Wells, J.G., Angulo, F.J., 2000. Emergence of a new Vibrio parahaemolyticus serotype in raw oysters. JAMA 284, 1541 – 1545. Del Cerro, A., Marquez, I., Guijarro, J.A., 2002. Simultaneous detection of Aeromonas salmonicida, Flavobacterium psychrophilum and Yersinia ruckeri, three major fish pathogens, by multiplex PCR. Appl. Environ. Microbiol. 68, 5177 – 5180. Denis, M., Soumet, C., Legeay, O., Arnauld, C., Bounaix, S., Thiery, R., Jestin, A., 1997. Development of a semiquantitative PCR assay using internal standard and colorimetric detection on microwell plate for pseudorabies virus. Mol. Cell. Probes 11, 439 – 448. DePaola, A., Capers, G.M., Motes, M.L., 1992. Isolation of Latin American epidemic strain of Vibrio cholerae O1 from U.S. Gulf Coast {Letter}. Lancet 339, 624. DePaola, A., Kaysner, C.A., Bowers, J.C., Cook, D.W., 2000. Environmental investigations of Vibrio parahaemolyticus in oysters following outbreaks in Washington, Texas, and New York (1997, 1998). Appl. Environ. Microbiol. 66, 4649 – 4654. Elliot, E.L., Kaysner, C.A., Jackson, L., Tamplin, M.L., 1995. Vibrio cholerae, V. parahaemolyticus, V. vulnificus, and other Vibrio spp. Bacterial Analytical Manual, 8th ed. Association of Official Analytical Chemists, Arlington, VA, pp. 9.01 – 9.27. Goh, K.T., 1981. An outbreak of paratyphoid A in Singapore: clinical and epidemiological studies. Southeast Asian J. Trop. Med. Public Health 12, 55 – 62. Gonzalez-Rodriguez, M.N., Santos, J.A., Otero, A., Garcia-Lopez, M.L., 2002. PCR detection of potentially pathogenic aeromonads in raw and cold-smoked freshwater fish. J. Appl. Microbiol. 93, 675 – 680. Gooch, J.A., DePaola, A., Kaysner, C.A., Marshall, D.L., 2001. Evaluation of two direct plating methods using nonradioactive probes for enumeration of Vibrio parahaemolyticus in oysters. Appl. Environ. Microbiol. 67, 721 – 724. Greenwood, M., Winnard, G., Bagot, B., 1998. An outbreak of Salmonella enteritidis phage type 9 infections associated with cockles. Commun. Dis. Public Health 1, 35 – 37. Gutierrez, R., Garcia, T., Gonzalez, I., Sanz, B., Hernandez, P.E., Martin, R., 1998. Quantitative detection of meat spoilage bacteria by using the polymerase chain reaction (PCR) and an enzyme linked immunosorbent assay (ELISA). Lett. Appl. Microbiol. 26, 372 – 376. Hlady, W.G., 1997. Vibrio infections associated with raw oyster consumption in Florida, 1991 – 1994. J. Food Prot. 60, 353 – 357.

208

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209

Hlady, W.G., Klontz, K.C., 1996. The epidemiology of Vibrio infections in Florida, 1981 – 1993. J. Infect. Dis. 173, 1176 – 1183. Jones, D.D., Bej, A.K., 1994. Applications of polymerase chain reaction (PCR) in food microbiology. In: Griffin, H., Griffin, A. (Eds.), PCR Technology: Current Innovations. CRC Press, Boca Raton, FL, pp. 341 – 365. Jones, D., Law, R., Bej, A.K., 1993. Detection of Salmonella spp. in contaminated oysters using polymerase chain reaction and gene probes. J. Food Sci. 58, 1191 – 1197. Kaysner, C.A., DePaola Jr., A, 2001. Vibrio. In: Downes, F.P., Ito, K. (Eds.), Compendium of Methods for the Microbiological Examination of Food. American Public Health Association, Washington, DC, pp. 405 – 420. Klontz, K.C., Tauxe, R.V., Cook, W.I., Wachsmuth, I.K., 1987. Cholera after consumption of raw oysters: a case report. Ann. Intern. Med. 107, 846 – 848. Kong, R.Y., Lee, S.K., Law, T.W., Law, S.H., Wu, R.S., 2002. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res. 36, 2802 – 2812. Lamoureux, M., Fliss, L., Blais, B.W., Messier, S., Holley, R.A., Simard, R.E., 1997. Microtitre plate hybridization system for detection of thermophilic Campylobacter rRNA. J. Appl. Microbiol. 82, 259 – 266. Lett, P.W., Southworth, J.P., Jones, D.D., Bej, A.K., 1995. Detection of pathogenic Escherichia coli in ground beef using Multiplex PCR. Food Testing and Analysis, 34 – 38. Linkous, D.A., Oliver, J.D., 1999. Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174, 207 – 214. Mahbubani, M.H., Bej, A.K., 1994. Application of PCR method in clinical microbiology. In: Griffin, H., Griffin, A. (Eds.), PCR Technology: Current Innovations. Academic Press, CA, pp. 327 – 339. Mason, W.J., Blevins, J.S., Beenken, K., Wibowo, N., Ojha, N., Smeltzer, M.S., 2001. Multiplex PCR protocol for the diagnosis of staphylococcal infection. J. Clin. Microbiol. 39, 3332 – 3338. Mekalanos, J.J., Swartz, D.J., Pearson, G.D., Harford, N., Groyne, F., de Wilde, M., 1983. Cholera toxin genes: nucleotide sequence, deletion analysis and vaccine development. Nature 306, 551 – 557. McCarthy, S.A., McPhearson, R.M., Guarino, A.M., Gaines, J.L., 1992. Toxigenic Vibrio cholerae O1 and cargo ships entering Gulf of Mexico {Letter}. Lancet 339, 624 – 625. McCarthy, S.A., DePaola, A., Kaysner, C.A., Hill, W.E., Cook, D.W., 2000. Evaluation of nonisotopic DNA hybridization methods for detection of the tdh gene of V. parahaemolyticus. J. Food Prot. 63, 1660 – 1664. Mead, P.S., Slutsker, L., Dietz, V., McGaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R.V., 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5, 607 – 625. Murinda, S.E., Nguyen, L.T., Ivey, S.J., Gillespie, B.E., Almeida, R.A., Draughon, F.A., Oliver, S.P., 2002. Prevalence and molecular characterization of Escherichia coli O157:H7 in bulk tank milk and fecal samples from cull cows: a 12-month survey of dairy farms in east Tennessee. J. Food Prot. 65, 752 – 759. Nagata, Y., Yokota, H., Kosuda, O., Yokoo, K., Takemura, K.,

Kikuchi, T., 1985. Quantification of picogram levels of specific DNA immobilized in microtiter wells. FEBS Lett. 183, 379 – 382. National Shellfish Sanitation Program Model Ordinance: 1999 revision, 2000. U.S. Food and Drug Administration, Washington, DC. Pon, C.L., Calogero, R.A., Gualerzi, C.O., 1988. Identification, cloning, nucleotide sequence and chromosomal map location of hns, the structural gene for Escherichia coli DNA-binding protein H-NS. Mol. Gen. Genet. 212, 199 – 202. Potasman, I., Paz, A., Odeh, M., 2002. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin. Infect. Dis. 35, 921 – 928. Rasmussen, S.R., Larsen, M.R., Rasmussen, S.E., 1991. Covalent immobilization of DNA onto polystyrene microwells: the molecules are only bound at the 5V end. Anal. Biochem. 198, 138 – 142. Rasmussen, S.R., Rasmussen, H.B., Larsen, M.R., Hoff-Jorgensen, R., Cano, R.J., 1994. Combined polymerase chain reaction-hybridization microplate assay used to detect bovine leukemia virus and Salmonella. Clin. Chem. 40, 200 – 205. Reddy, G.P., Hayat, U., Abeygunawardana, C., Fox, C., Wright, A.C., Maneval, D.R., Bush, C.A., Morris, J.G., 1992. Purification and determination of the structure of capsular polysaccharide of Vibrio vulnificus M06-24. J. Bacteriol. 174, 2620 – 2630. Rippey, S.R., 1994. Infectious diseases associated with shellfish consumption. Clin. Microbiol. Rev. 7, 419 – 425. Roberts, D., Hooper, W., Greenwood, M., 1990. Practical food microbiology. London Public Health Laboratory Service, pp. 51 – 55. Soumet, C., Ermel, G., Boutin, P., Boscher, E., Colin, P., 1995. Chemiluminescent and colorimetric enzymatic assays for the detection of PCR-amplified Salmonella sp. products in microplates. Biotechniques 19, 792 – 796. Soumet, C., Ermel, G., Salvat, G., Colin, P., 1997. Detection of Salmonella spp. in food products by polymerase chain reaction and hybridization assay in microplate format. Lett. Appl. Microbiol. 24, 113 – 116. Spoljar, B.H., Tomasic, J., 2000. A novel ELISA for determination of polysaccharide specific immunoglobulins. Vaccine 19, 924 – 930. Taniguchi, H., Hirano, H., Kubomura, S., Higashi, K., Mizuguchi, Y., 1986. Comparison of the nucleotide sequences of the genes for the thermostable direct hemolysin and the thermolabile hemolysin from Vibrio parahaemolyticus. Microb. Pathog. 1, 425 – 432. van der Vliet, G.M., Hermans, C.J., Klatser, P.R., 1993. Simple colorimetric microtiter plate hybridization assay for detection of amplified Mycobacterium leprae DNA. J. Clin. Microbiol. 31, 665 – 670. Wang, G., Clark, C.G., Rodgers, F.G., 2002. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J. Clin. Microbiol. 40, 3613 – 3619. Weber, J.T., Levine, W.C., Hopkins, D.P., Tauxe, R.V., 1994a.

C.-Y. Lee et al. / Journal of Microbiological Methods 53 (2003) 199–209 Cholera in the United States, 1965 – 1991. Risks at home and abroad. Arch. Intern. Med. 154, 551 – 556. Weber, J.T., Mintz, E.D., Canizares, R., Semiglia, A., Gomez, I., Sempertegui, R., Davila, A., Greene, K.D., Puhr, N.D., Cameron, D.N., 1994b. Epidemic cholera in Ecuador: multidrug-resistance and transmission by water and seafood. Epidemiol. Infec. 112, 1 – 11. Wilson, I.G., Moore, J.E., 1996. Presence of Salmonella spp. and Campylobacter spp. in shellfish. Epidemiol. Infect. 116, 147 – 153. Wright, A.C., Morris Jr., J.G., Maneval Jr., D.R., Richardson, K.,

209

Kaper, J.B., 1985. Cloning of the cytotoxin-hemolysin gene of Vibrio vulnificus. Infect. Immun. 50, 922 – 924. Wright, A.C., Guo, Y., Johnson, J.A., Nataro, J.P., Morris, J.G., 1992. Development and testing of a nonradioactive DNA oligonucleotide probe that is specific for Vibrio cholerae cholera toxin. J. Clin. Microbiol. 30, 2302 – 2306. Zielen, S., Broker, M., Strnad, N., Schwenen, L., Schon, P., Gottwald, G., Hofmann, D., 1996. Simple determination of polysaccharide specific antibodies by means of chemically modified ELISA plates. J. Immunol. Methods 193, 1 – 7.