Oligodendrocytes modulate the immune-inflammatory response in EAE via TNFR2 signaling

Journal Pre-proofs Oligodendrocytes modulate the immune-inflammatory response in EAE via TNFR2 signaling Pernille M. Madsen, Haritha L. Desu, Juan Pablo de Rivero Vaccari, Yoleinny Florimon, Ditte G. Ellman, Robert W. Keane, Bettina H. Clausen, Kate L. Lambertsen, Roberta Brambilla PII: DOI: Reference:

S0889-1591(19)30796-2 https://doi.org/10.1016/j.bbi.2019.11.017 YBRBI 3910

To appear in:

Brain, Behavior, and Immunity

Received Date: Revised Date: Accepted Date:

25 July 2019 8 November 2019 23 November 2019

Please cite this article as: Madsen, P.M., Desu, H.L., Pablo de Rivero Vaccari, J., Florimon, Y., Ellman, D.G., Keane, R.W., Clausen, B.H., Lambertsen, K.L., Brambilla, R., Oligodendrocytes modulate the immune-inflammatory response in EAE via TNFR2 signaling, Brain, Behavior, and Immunity (2019), doi: https://doi.org/10.1016/j.bbi. 2019.11.017

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier Inc.

Oligodendrocytes modulate the immune-inflammatory response in EAE via TNFR2 signaling Pernille M. Madsen1,2*#, Haritha L. Desu1,3*, Juan Pablo de Rivero Vaccari1, Yoleinny Florimon1, Ditte G. Ellman2, Robert W. Keane1,3,4, Bettina H. Clausen2,6, Kate L. Lambertsen2,5,6 and Roberta Brambilla1,2,3,6^ 1The

Miami Project To Cure Paralysis, Dept. Neurological Surgery, University of Miami

Miller School of Medicine, FL 33136, USA; 2Dept.

Neurobiology Research, Institute of Molecular Medicine, University of Southern

Denmark, Odense, Denmark; 3The

Neuroscience Program, University of Miami Miller School of Medicine, Miami, FL

33136, USA; 4Dept.

Physiology and Biophysics University of Miami Miller School of Medicine, FL

33136, USA; 5Department 6BRIDGE

of Neurology, Odense University Hospital, Odense, Denmark,

- Brain Research Inter Disciplinary Guided Excellence, Department of Clinical

Research, University of Southern Denmark, Odense, Denmark *Equal contribution #Present

address:

Center for Translational Neuromedicine, University of Rochester Medical Center, Rochester, NY. ^Correspondence should be addressed to: Roberta Brambilla, Ph.D. The Miami Project To Cure Paralysis University of Miami Miller School of Medicine 1095 NW 14th Terrace, Miami, FL 33136 Tel. 305.243.3576 - [email protected] Word count: 8491

Abstract The pleotropic cytokine tumor necrosis factor (TNF) is involved in the pathophysiology of multiple sclerosis (MS). In various models of MS, including experimental autoimmune encephalomyelitis (EAE), the membrane-bound form of TNF (tmTNF), which signals primarily via TNFR2, mediates protective and reparative effects, whereas the soluble form (solTNF), which signals primarily via TNFR1, promotes proinflammatory and detrimental functions. In this study, we investigated the role of TNFR2 expressed in the oligodendrocyte in the early phase of EAE pathogenesis. We demonstrated that mice with specific ablation of oligodendroglial TNFR2 displayed early onset and higher peak of motor dysfunction when subjected to EAE, in advance of which accelerated infiltration of immune cells was observed as early as 10 days post EAE induction. The immune cell influx was preceded by microglial activation and increased blood brain barrier permeability. Lack of oligodendroglial TNFR2 accelerated the expression of inflammatory cytokines as well as expression and activation of the inflammasome. Gene expression profiling of oligodendrocytes sorted from the spinal cord 14 days post EAE induction showed robust upregulation of inflammatory genes, some of which were elevated in cells lacking TNFR2 compared to controls. Together, our data demonstrate that oligodendrocytes are directly involved in inflammation and immune modulation in CNS disease and this function is regulated, at least in part, by TNFR2.

Key words: cytokines, tumor necrosis factor, neuroinflammation, oligodendrocytes, neurodegeneration, demyelination, multiple sclerosis

1. Introduction The immunomodulatory cytokine tumor necrosis factor (TNF) is a key regulator of physiological and pathological processes. TNF exists in two active forms: a native transmembrane form, tmTNF, which functions via cell-to-cell contact, and a soluble form, solTNF, generated via enzymatic cleavage of tmTNF (Kriegler et al., 1988) by the metalloproteinase TNF alpha converting enzyme (TACE/ADAM17) (Black et al., 1997; Moss et al., 1997). TNF binds to two cognate receptors, TNFR1 and TNFR2, which differ in ligand affinity, downstream signaling and cellular expression (Grell, 1995; Grell et al., 1998; Probert, 2015). SolTNF preferentially binds to and activates TNFR1, whereas tmTNF, which can bind to both receptors, is the main activating ligand of TNFR2 (Grell, 1995; Grell et al., 1998; Holtmann and Neurath, 2004). TNFR1 is ubiquitously expressed, whereas TNFR2 is expressed on select cell populations (e.g. myeloid cells, Treg lymphocytes) and is upregulated in disease states (Dostert et al., 2019). In the central nervous system (CNS), TNFR1 is found on neurons and glial cells, mainly astrocytes and microglia, while TNFR2 is almost exclusively expressed by glia, with microglia having the highest expression in normal conditions (Brambilla et al., 2011; Probert, 2015; Zhang et al., 2014). During disease, TNFR1 generally initiates cell death mechanisms through engagement of its intracellular death domain, and chronic inflammatory mechanisms through NF-B activation (Dostert et al., 2019). Conversely, TNFR2 mainly initiates pro-survival and reparative cascades via TRAF2-dependent activation of PKB/Akt and NF-B (Dostert et al., 2019). TNF has been implicated in the pathophysiology of a variety of neurological diseases, including multiple sclerosis (MS). Since it was found highly elevated in

cerebrospinal fluid (CSF), blood and active lesions of MS patients, correlating with disease severity and progression (Hofman et al., 1989; Selmaj et al., 1991; Sharief and Hentges, 1991), TNF was recognized as a promising target for MS therapy. This concept, however, had to be reevaluated after the failure of the Lenercept trial, in which patients treated with a non-selective TNF inhibitor showed disease exacerbation and increased demyelination (The Lenercept Study Group, 1999). The studies that followed, using genetic and/or pharmacological approaches to target TNF and its receptors, depicted a complex and dichotomous picture of the role of TNF in MS pathology with solTNF sustaining detrimental effects via TNFR1, and tmTNF promoting beneficial functions via TNFR2 (Arnett et al., 2001; Brambilla et al., 2011; Gao et al., 2017; Madsen et al., 2016; Probert, 2015; Suvannavejh et al., 2000; Taoufik et al., 2011). Most notably, TNFR2 was implicated in oligodendrocyte differentiation and was recognized as an important signal for the formation of new oligodendrocytes and remyelination (Arnett et al., 2001). This finding provided a possible explanation as to why demyelinating episodes were reported following anti-TNF treatment not only in MS patients, as in the case of Lenercept, but also in patients receiving TNF inhibitors for other immune-inflammatory pathologies (e.g. rheumatoid arthritis, Crohn’s disease) (Kemanetzoglou and Andreadou, 2017). Collectively, these studies led to an understanding that indiscriminate blockade of TNF with non-selective inhibitors was not a viable therapeutic approach. Rather, strategies aimed at suppressing solTNF-TNFR1 signaling and enhancing tmTNF-TNFR2 signaling should be explored. Our group has significantly contributed to elucidating the function of TNF in CNS autoimmunity using the experimental autoimmune encephalomyelitis (EAE) model of

MS. We demonstrated that tmTNF-TNFR2 signaling in glial cells, specifically microglia and oligodendrocytes, drives protective and reparative processes (Gao et al., 2017; Madsen et al., 2016). By ablating TNFR2 from oligodendrocyte lineage cells in CNPcre:TNFR2fl/fl transgenic mice, we showed that lack of oligodendroglial TNFR2 leads to EAE exacerbation, accompanied by increased axon and myelin damage, as well as reduced remyelination at the chronic disease stage (Madsen et al., 2016). This implicated oligodendroglial TNFR2 in maintenance of myelin integrity and repair, possibly by promoting the differentiation of oligodendrocyte precursor cells (OPCs) into new myelinating oligodendrocytes, as previous studies have suggested (Arnett et al., 2001). The observation that CNP-cre:TNFR2fl/fl mice exhibited an earlier disease onset compared to control mice prompted us to postulate that, in addition to the remyelination process, oligodendroglial TNFR2 may be involved in inhibiting the initial immuneinflammatory response driving EAE. It is well established that onset of acute motor dysfunction in EAE coincides, and is strictly dependent on, the trafficking of immune cells (T cells and myeloid cells to start with) into the spinal cord (Constantinescu et al., 2011). We hypothesized that TNFR2 signaling in oligodendrocytes restrains this process. To test this idea, we induced EAE in CNP-cre:TNFR2fl/fl and TNFR2fl/fl mice and performed a series of analyses at the early stages of disease. In line with our previous study, ablation of oligodendroglial TNFR2 resulted in earlier onset and higher peak of disease. This coincided with accelerated immune cell infiltration into the spinal cord, preceded by changes in blood brain barrier (BBB) permeability. Additionally, ablation of oligodendroglial TNFR2 accelerated the expression of key proinflammatory molecules, including chemokines and cytokines, as well as the activation of the

inflammasome. Expression studies on oligodendrocytes isolated from the spinal cord of naïve and EAE-induced mice, as well as in vitro experiments on cultured primary oligodendrocyte

precursor

cells

(OPCs)

and

mature

oligodendrocytes

(OLs),

demonstrated that several of these molecules (e.g. IL1, IL6, CXCL10) are produced by oligodendrocytes and are directly regulated by TNFR2. Together, our data demonstrate that oligodendrocytes are directly involved in inflammation and immune modulation when exposed to an injury environment and this function is regulated, at least in part, by TNFR2.

2. Material and Methods

2.1. Mice Adult (2-3 months old) female TNFR2fl/fl and CNP-cre:TNFR2fl/fl conditional knockout (KO) mice (Madsen et al., 2016) were used for in vivo experiments. For identification of the

TNFR2fl

allele,

mice

were

TTGGGTCTAGAGGTGGCGCAGC-3’

genotyped and

with

forward

reverse

primer

primer

5’5’-

GGCCAGGAAGTGGGTTACTTTAGGGC-3’. For identification of the CNP-cre allele, mice were genotyped with forward primer 5’-GCCCAAGCTCTTCTTCAGG-3’ and reverse primer 5-’CGAGTTGATAGCTGGCTGG-3’. Germline TNFR2-/- (#002620) and WT C57BL/6 mice were obtained from the Jackson Laboratory and used to generate primary cell cultures. All mice were housed in the Animal Core Facility of The Miami Project to Cure Paralysis, in a virus/antigen-free, temperature and humidity-controlled room with a 12 h light/dark cycle and free access to water and food. Mice were groupcaged (maximum five mice per cage) throughout the duration of the experimentations. All experiments were performed according to protocols and guidelines approved by the Institutional Animal Care and Use Committee of the University of Miami.

2.2. Induction of EAE with MOG35-55 peptide EAE was induced in 2-3-month old female mice using the myelin oligodendrocyte glycoprotein 35-55 peptide (MOG35-55) (BioSynthesis), as previously described (Madsen et al., 2017). Mice received an i.p. injection of pertussis toxin (PTX) in PBS (400 ng/mouse in a 200 l volume; day 0), followed by a s.c. injection of MOG35-55 peptide

emulsified in Complete Freund’s Adjuvant (300 g/mouse in a 200 l volume; day 1), and a second i.p. injection of PTX (400 ng/mouse in a 200 l volume; day 2). Mouse locomotor behavior was assessed daily by an investigator blinded to the genotype, and scored using a standardized 0-6 scale as follows: 0, no clinical signs; 1, loss of tail tone; 2, flaccid tail; 3, complete hind limb paralysis; 4, complete forelimb paralysis; 5, moribund; 6, dead, with 0.5 increments for intermediate behaviors.

2.3. Tissue collection for histological analyses For immunohistochemistry, mice were transcardially perfused with 0.1 M PBS followed by 4% paraformaldehyde (PFA) in 0.1 M PBS. Spinal cords were dissected out and post-fixed in 4% PFA in 0.1 M PBS for 2 h followed by cryoprotection in 0.1 M PBS + 20% sucrose. Spinal cord tissues were cryostat sectioned into 14 or 30 m-thick serial sections. For in situ hybridization, tissues were handled under RNase-free conditions. Spinal cords were isolated form non-perfused mice, the thoracic segments dissected out, fresh frozen, embedded in OCT and cryostat cut into 30 m-thick parallel sections.

2.4. Immunohistochemistry Sections were blocked with 5% normal goat serum in 0.1 M PBS + 0.4% Triton-X for 1 h and incubated overnight at 4°C with primary antibodies against CD45 (rat, 1:500, eBioscience), CD3 (rat, 1:500, BD Pharmingen), Iba1 (rabbit, 1:500, Wako), PDGFR (rabbit, 1:500, Santa Cruz), Olig2 (rabbit, 1:500, Millipore), and Hif1 (Mouse, 1:500, Novus Biologicals). Positive staining was visualized with secondary species-specific fluorescent antibodies conjugated with AlexaFluor488 and AlexaFluor594 (1:750,

Invitrogen). Lastly, sections were stained with DAPI (1:1000, stock 1 mg/ml, Invitrogen) for 5 min, coverslipped and imaged with an Olympus FluoView 1000 confocal microscope or a Zeiss Axiovert A1 fluorescence microscope.

2.5. Stereological quantification Five 30 m-thick serial sections taken at 300 m intervals were analyzed at a 63X magnification with a Zeiss Axiovert A1 fluorescence microscope by an investigator blinded to the genotype. The number of positive cells per mm3 of tissue was estimated with Stereoinvestigator software (MicroBrightfield) using the Optical Fractionator for unbiased counting and systematic random sampling. All analyses were conducted by an investigator blinded to the genotype.

2.6. Generation and stimulation of primary oligodendrocyte cultures Primary oligodendrocyte cultures were generated from WT and TNFR2-/- mice as described previously (Madsen et al., 2016). In brief, cortices from postnatal day 4-6 pups were dissected out, meninges carefully removed, and tissues dissociated with a papain-based Neural Tissue Dissociation Kit (Miltenyi). PDGFR+ OPCs were isolated by incubation with anti-PDGFR magnetic microbeads and positively selected by MACS separation using LS columns (Miltenyi). Cells were seeded on poly-D-lysine/laminin coated 24-well plates (40,000 cells/well) in DMEM/F12/HEPES supplemented with 1% N2, 2% B27 (both from Invitrogen), 0.01% BSA, 1% penicillin/streptomycin, 10 ng/ml FGF2 and 10 ng/ml PDGF-AA. Cell were grown for 4 days to expand proliferating OPCs and the medium was replaced daily. Cultures were assessed to be 98% pure, at a

minimum, by immunostaining for the oligodendrocyte lineage marker Olig2.. After 4 days in culture, cells were either collected as OPCs or differentiated into mature OLs by switching to a differentiation medium consisting of DMEM/F12/HEPES supplemented with 1% N2, 2% B27, 0.01% BSA, 0.5% gentamycin, 10 ng/ml CNTF and 40 ng/ml T3. Cells were differentiated into OLs for 4 days before collection for experimental use. Primary OPCs and OLs were stimulated on days 4 and 8, respectively, with a cytokine cocktail of TNF/IFN/IL1β (all at 25 ng/ml) or exposed to PBS vehicle for 3 h at 37°C before collection.

2.7. Western blotting Mice were transcardially perfused with chilled 0.1 M PBS, and the spinal cords were immediately dissected out and frozen in liquid nitrogen. Tissues were homogenized in 300 l RIPA buffer containing phosphatase inhibitor cocktail 1 (Sigma) and Complete protease inhibitor cocktail (Roche Diagnostics). Twenty g of protein per sample were run on an 11% SDS-PAGE gel, then transferred to a 0.2 m nitrocellulose membrane. After blocking with 5% BSA in tris buffered saline + 0.1% Tween 20 (TBST) for 1 h at room temperature, membranes were incubated with primary antibodies against Caspase-1 (mouse, 1:1000, Novus Biologicals), ASC (mouse, 1:500, Santa Cruz), IL-1 (rat, 1:500, Cell Signaling) and -actin (mouse, 1:2500, Sigma) at 4°C overnight. Proteins were labelled with HRP-conjugated species-specific secondary antibodies (all 1:2000, GE Healthcare) and visualized with Super Signal West Pico Chemiluminescent substrate (Thermo Scientific). Gels were imaged with ChemiDoc Touch (BioRad) with the saturation setting on to ensure that signal intensity was within the linear range.

Results were quantified with Quantity One software (Bio-Rad). The data were normalized to -actin and expressed as arbitrary units (AU) ± SEM.

2.8. Multiplex analysis Multiplex analysis was performed in spinal cord tissues (thoracic segments), and in OPC and OL cultures. Spinal cord samples were obtained from the thoracic spinal cord of PBS-perfused mice homogenized in 300 l RIPA buffer containing phosphatase inhibitor cocktail 1 (Sigma) and Complete protease inhibitor cocktail (Roche Diagnostics). OPC and OL samples were obtained by homogenizing cells obtained from 2 wells of a 6-well plate in 250 l RIPA buffer with phosphatase and protease inhibitors. Cytokine expression was evaluated as previously described (Madsen et al., 2015) using the MSD Mouse Proinflammatory V-Plex Plus Kit, or individual plates for the assessment of CCL2, CCL5 and TNFR1 (Mesoscale). Samples were run on a SECTOR Imager 6000 Plate Reader (Mesoscale Discovery) and the data analyzed with the MSD Discovery Workbench software. Samples with CV values above 25% were excluded.

2.9. RNA isolation and real-time PCR Total RNA was isolated from cultured cells using the RNeasy Micro Kit (Qiagen) in combination with on-column DNA digestion with the RNase-Free DNase Set (Qiagen), as described (Madsen et al., 2017). For each sample, 30 ng of RNA was reverse transcribed using the Sensiscript RT kit (Qiagen) and the resulting cDNA was used as template for real-time PCR amplification using the Power SYBR Green qPCR Master Mix (Life technologies). Quantitative PCR was performed on an ABI 7300 Real-Time

PCR System (Applied Biosystem) and the relative mRNA expression was calculated with the ΔΔCt method (Livak and Schmittgen, 2001) by normalization to -actin. Data were expressed as percentage of non-simulated or stimulated WT control. See Table 1 for gene-specific primer list.

2.10. Flow cytometry Following transcardial perfusion with PBS, spinal cords and spleens were harvested and placed in cold Hanks’ Balanced Salt Solution (HBSS). Samples were mechanically dissociated into single-cell suspensions by pushing the tissues through a 70 m cell strainer using HBSS. For leukocyte isolation from the spleen, suspensions were spun at 400xg for 5 min, supernatants removed, and red blood cells lysed in 2 ml lysis buffer (eBioscience) according to manufacturer’s instructions. Cells were then resuspended in flow cytometry buffer (FCB, eBioscience) and stained as described below. Leukocytes infiltrating into the spinal cord were isolated by negative selection of single-cell spinal cord suspensions with Myelin Removal Beads II in combination with LS columns, according to the manufacturer’s protocol (Miltenyi). Similar to the spleen cells, spinal cord cells were resuspended in FCB and stained as described below. The number of viable cells was determined by trypan blue exclusion assay using a Bio-Rad TC20 automated cell counter.

2.11. Immunolabeling and flow cytometric analysis Cells were resuspended in 100 l FCB, blocked with 0.5 l TruStainFcX (anti-mouse CD16/32 FcR block, Biolegend) for 5 min at room temperature, and stained for 30 min

at 4°C with: eFluor605NC-anti-CD45 (1:500, Biolegend), FITC-anti-CD4 (1:200, eBioscience), APC-anti-CD8 (1:200, Biolegend), PE-anti-B220 (1:200, Biolegend), APCeFluor780-anti-MHCII (1:200, eBioscience), PE-Cy7-anti-CD11b (1:200, eBioscience) and PerCP-Cy5.5-anti-Ly6G (1:200, Biolegend). Cells were then fixed in 1% PFA for 1 h. Finally, cells were resuspended in 500 l FCB, labelled with DAPI to exclude cell debris and analyzed with a CytoFLEX S flow cytometer (Beckman-Coulter) equipped with CytExpert software (Beckman-Coulter).

2.12. Evans blue extravasation assay Mice were injected i.p. with 250 l sterile 0.5% Evans blue (EB) in 0.1 M PBS, and after 1h transcardially perfused with 0.1 M chilled PBS. Spinal cord and brain were dissected out and incubated with 1 ml formamide for 24 h at 50°C with constant rotation. Samples were then spun at 10.000 rpm for 10 min and the supernatant was collected. EB absorbance was measured at 610 nm wavelength with a Nanodrop spectrophotometer and data expressed as percentage of TNFR2fl/fl corresponding tissue.

2.13. PCR Array Spinal cords were harvested in cold HBSS and dissociated with the Adult Neural Dissociation Kit (Miltenyi). Single-cell suspensions were cleared from debris using the Debris Removal Solution (Miltenyi). To select for cells of the oligodendrocyte lineage, suspensions were incubated with 10 l of anti-PDGFR plus 10 l of anti-O4 magnetic microbeads (Miltenyi) for 15 min at 4°C, then positively selected with LS columns (Miltenyi). Total RNA was isolated with a miRNeasy Kit (Qiagen), and gene expression

assayed with the Mouse Multiple Sclerosis RT2 Profiler PCR Array (Qiagen). Arrays were run on a LightCycler 480 real-time PCR machine (Roche). Relative expression was calculated with the ΔΔCt method (Livak and Schmittgen, 2001) after normalization to the housekeeping gene hsp90 and expressed as log2 fold change (FC) between groups.

2.14. Fluorescent in situ hybridization In situ hybridization was performed as described (Hansen et al., 2013) using a custom designed 6-carboxyfluorescein (6-FAM) labelled miR-326 probe (probe sequence: 5’ 6-FAM/CTGGAGGAAGGGCCCAGAGG/3’ 6-FAM/ (Exiqon). Sections were rinsed for 10 min in TBS buffer containing 0.5% Triton X-100 (TBS-T) and incubated overnight with Maxima Probe/master mix (Thermo Scientific) containing the miR-326 probe. Hybridization was arrested with distilled water. Probe specificity was tested on parallel sections pre-treated with RNase A (Pharmacia Biotech). Buffer and RNAse A control were devoid of signal (not shown). For cellular phenotyping, the hybridized sections were rinsed in TBS-T for 10 min and blocked with 10% BSA for 30 min. Next, sections were incubated with anti-PDGFR antibody (1:100, eBioscience) for 1 h, rinsed in TBS for 10 min and incubated with goat anti rat-Alexa594 secondary antibody for 1 h (1:200, A11007, Invitrogen). After nuclear labeling with DAPI, sections were mounted in gelvatol. Control sections incubated with rat IgG2a secondary antibody only were devoid of signal (not shown). Four sections per mouse were imaged and 3 pictures/section were taken with an Olympus fluorescence microscope at 10X

magnification. PDGFR+ and PDGFR+miR326+ cells were counted using Image J software by an investigator blinded to the genotype.

2.15. Statistical Analysis EAE disease curves were compared using a two-way ANOVA followed by a Sidak’s multiple comparisons test. Flow cytometry, cytokine expression, western blotting and real-time PCR data were analyzed by one-way ANOVA followed by Bonferroni or Tukey tests for multiple comparisons. In case of single comparisons, normality was tested using the D’Agostino & Pearson normality test. If the data in each group were normally distributed, the Student’s t test was applied; if they were not normally distributed, they were analyzed using the non-parametric Mann-Whitney test. Data are expressed as mean ± SEM, and p-values equal or less than 0.05 were considered statistically significant. Statistical analyses were carried out with GraphPad Prism software. Detailed statistical analyses and animal numbers for each individual experiment are included in the figure legends.

3. Results

3.1. Ablation of oligodendroglial TNFR2 results in accelerated CNS immune cell infiltration and microglial activation following EAE CNP-cre:TNFR2fl/fl

mice

with

conditional

ablation

of

TNFR2

in

the

oligodendrocyte lineage were previously generated in our laboratory and extensively characterized (Madsen et al., 2016). Since CNPase is expressed at higher levels in oligodendrocytes at more advanced differentiation states, CNP-cre:TNFR2fl/fl mice exhibit TNFR2 ablation in about 90% of mature oligodendrocytes (OLs), and 30-40% of oligodendrocyte precursor cells (OPCs). Naïve adult mice show no abnormalities in locomotor performance, myelin and axon integrity, as well as basal expression of inflammatory and myelin-related genes compared to WT, TNFR2fl/fl and CNP-cre+/control mice (Madsen et al., 2016). When induced with MOG35-55 EAE, CNPcre:TNFR2fl/fl mice showed disease exacerbation resulting, chronically, in increased demyelination, widespread axonal loss, and impaired remyelination (Madsen et al., 2016). To test whether this outcome could be dependent on oligodendroglial TNFR2 modulating the immune-inflammatory response, we induced EAE in CNP-cre:TNFR2fl/fl mice along with TNFR2fl/fl control littermates, and performed biochemical and molecular assessments at the pre-onset and early acute (pre-peak) phases of EAE. Ablation of TNFR2 in CNP-cre:TNFR2fl/fl mice resulted in worsening of EAE (Fig. 1A), with significantly earlier disease onset (14.2±0.7 vs 16.7±0.9 dpi), higher peak disease score (3.3±0.9 vs 2.7±0.1) and higher cumulative disease index (CDI) (37.2±2.5 vs 26.2±3.3

at 25 dpi) (Table 2), in line with our previous findings (Madsen et al., 2016). Histological analysis of the thoracic spinal cord revealed minimal T lymphocyte infiltration (CD3+ cells) in both genotypes at 10 days post induction (dpi) before onset of clinical symptoms, with cells mainly confined to the meningeal compartment (Fig. 1B, C). By 14 dpi, T cells infiltrated the spinal cord parenchyma, with significantly higher accumulation in CNP-cre:TNFR2fl/fl mice compared to controls (Fig. 1B, C). Few peripherally derived myeloid cells (Iba1+CD45+ cells with round morphology, which include macrophages and neutrophils) were present in the spinal cord parenchyma at 10 dpi, with no difference between genotypes (Fig. 1D, orange arrows; Fig. 1E). By 14 dpi, their number increased and was significantly higher in CNP-cre:TNFR2fl/fl mice compared to TNFR2fl/fl controls (Fig. 1D, orange arrows; Fig. 1E). Similarly, other non-myeloid leukocyte populations (CD45+Iba1- cells with round morphology, which include T and B cells) were sparse at 10 dpi but increased at 14 dpi, with a marked and significant elevation in CNP-cre:TNFR2fl/fl mice over TNFR2fl/fl controls (Fig. 1D, white arrows; Fig. 1E). Microgliosis was also observed in CNP-cre:TNFR2fl/fl mice, as the number of Iba1+ microglia was significantly elevated in CNP-cre:TNFR2fl/fl mice compared to controls already at 10 dpi, and further increased at 14 dpi (Fig. 1D, yellow arrows; Fig. 1F). Oligodendroglial TNFR2 ablation did not affect the number on microglial cells in naïve conditions (Fig. 1F). It should be noted that, despite the presence of immune cells in the spinal cord parenchyma (particularly in CNP-cre:TNFR2fl/fl mice), no signs of demyelination were observed in either genotype both at 10 and 14 dpi (Supplementary Fig. 1).

The trafficking of immune cells into the CNS at the early EAE stage (14 dpi) was investigated by flow cytometry as well (Fig. 2). In the spinal cord, CNP-cre:TNFR2fl/fl mice had significantly higher numbers of macrophages, MHCII+ macrophages, neutrophils, and CD4+ and CD8+ T cells (Fig. 2A-C), which correlated with their significantly higher clinical score at this time point (Fig 1A). Furthermore, microgliosis was confirmed, as the number of CD45lowCD11b+ microglia was elevated, and so was the subpopulation expressing MHCII (Fig. 2D, E), in line with what measured by stereological counting (Fig. 1F). Since immune cell migration into the CNS during neuroimmune disease is facilitated by a leaky BBB, we sought to determine if the early and elevated entry of leukocytes in CNP-cre:TNFR2fl/fl mice could be due to increased BBB permeability. We assessed BBB permbility by measuring evans blue (EB) extravasation (Radu and Chernoff, 2013), and observed a robust and significant increase in the spinal cord of CNP-cre:TNFR2fl/fl mice at 10 dpi compared to TNFR2fl/fl controls (Fig 2F), immediately prior to the increased immune cell infiltration measured in this compartment (Fig 2A). This suggests that oligodendroglial TNFR2 could be modulating BBB permeability early in disease, thus influencing immune cell entry into the CNS and EAE development. In parallel with an elevated immune cell presence in the CNS, CNP-cre:TNFR2fl/fl mice had significantly reduced numbers of CD4+ T cells, CD8+ T cells, B cells, MHCII+ B cells and MHCII+ macrophages in the spleen (Fig. 3A, B). This is not due to intrinsic immunodeficiency of CNP-cre:TNFR2fl/fl mice, as their splenic immune cell numbers in naïve condition are similar to those of control mice (Fig. 3C). For T cells and macrophages, the reduction in number may be due to increased mobilization from the

peripheral immune organs and migration into the CNS. For B cells, though a parallel increase in CNS numbers was yet to be seen at this time point, a possible explanation is that after leaving the spleen they accumulated in other lymphoid organs (e.g. lymph nodes) prior to being dispatched to the CNS. Finally, neutrophil numbers do not change in the spleen, but were highly elevated in the cord. It is possible that since they are the first cells to mobilize and enter the CNS very early in disease, by 14 dpi their splenic numbers had already returned to steady state levels. Collectively these data show that at pre-onset and early stage (pre-peak) of EAE, both the innate immune response (sustained by microglia and myeloid cells) and the adaptive immune response (sustained by T cells) are upregulated in CNP-cre:TNFR2fl/fl mice where TNFR2 signaling is impaired in oligodendrocytes.

3.2.

Ablation

of

oligodendroglial

TNFR2

accelerates

expression

of

proinflammatory molecules and inflammasome activation following EAE To determine whether disease exacerbation and increased immune cell infiltration in the CNS were associated with changes in the CNS inflammatory profile, we evaluated cytokine and chemokine expression in the spinal cord of CNP-cre:TNFR2fl/fl and TNFR2fl/fl mice in naïve, acute (14 and 18 dpi), and chronic (35 dpi) EAE conditions by multiplex. We found the majority of molecules to be time-dependently upregulated after EAE in both genotypes, but to reach peak expression earlier (14 dpi) in CNPcre:TNFR2fl/fl mice (Fig. 4). This upregulation was especially evident for the cytokines TNF, IFN, IL1 and IL6 and the chemokines CXCL1, CCL5 and CCL2, which all have pro-inflammatory functions. Their expression was robustly upregulated at 14 dpi and

significantly different from control mice, which still maintained levels close to naïve conditions (Fig. 4). This profile is in line with the demonstrated increased presence of T cells and macrophages in CNP-cre:TNFR2fl/fl mice at 14 dpi. In contrast, no changes were observed for IL12p70 or for the anti-inflammatory cytokines IL4 and IL10 over time or between genotypes. Notably, expression of TNFR1, the receptor primarily responsive to solTNF, was also significantly upregulated in CNP-cre:TNFR2fl/fl mice at 14 dpi. This may be a consequence of the elevated infiltration of immune cells at this time, which are known to highly express TNFR1 (especially T cells), or to an increased expression in resident CNS cells, e.g. microglia, and may signify an enhancement of pro-inflammatory TNF effects. To further probe for changes in the inflammatory profile that could correlate with EAE exacerbation in CNP-cre:TNFR2fl/fl mice, we assessed inflammasome activation in the spinal cord. Inflammasomes are cytosolic multiprotein complexes that act as sensors of pathogens and stressors, and their activation has been associated with MS and disease exacerbation in EAE (Dumas et al., 2014; Inoue and Shinohara, 2013). We assessed by western blot the expression of key inflammasome components, including ASC, caspase-1, IL1 and their corresponding cleaved (active) forms, at various stages of EAE. Similar to cytokine expression, we observed a shift in the activation profile of the inflammasome components, with elevation of ASC and cleaved caspase-1 that peaked at 14 dpi in CNP-cre:TNFR2fl/fl mice. Peak elevation did not occur until 18 dpi in TNFR2fl/fl controls (Fig. 5A-C). At 14 dpi, both ASC and cleaved caspase-1 were significantly different in CNP-cre:TNFR2fl/fl mice compared to controls (Fig. 5B-D).

Collectively, these data further define a role for oligodendroglial TNFR2 in the suppression of the inflammatory response. Indeed, lack of TNFR2 leads to an increase in chemotactic factors mediating the recruitment of neutrophils, T cells and monocytes into the CNS, as well the production of neurotoxic cytokines. These may derive from the infiltrating immune cells as well as CNS resident cells.

3.3. TNFR2 signaling regulates the expression of inflammatory molecules in the oligodendrocyte lineage CNP-cre:TNFR2fl/fl mice have TNFR2 ablation throughout the oligodendrocyte lineage from OPCs to OLs. Hence to define TNFR2 immunomodulatory effect in each cell population we performed in vitro studies on OPCs and OLs isolated from WT and TNFR2-/- pups. TNFR2-/- were used instead of CNP-cre:TNFR2fl/fl mice to ensure that 100% of all OPCs and OLs obtained had TNFR2 ablation. Of note, our differentiated OLs expressed classic markers of maturation, specifically O4 and MBP, as we previously reported (Madsen et al., 2016) (Supplementary Fig. 2). We exposed cultured OPCs and OLs to a cocktail of Th1 cytokines (TNF/IFN/IL) to mimic the proinflammatory environment of MS/EAE or to PBS vehicle and measured gene expression by real-time RT-PCR. A 3h stimulation with TNF/IFN/IL induced robust inflammatory activation of both OPCs and OLs, with marked upregulation of Tnf and Il6 gene expression, as well as of a variety of chemokines, including Cxcl10 and Ccl5 (Fig. 6), independently of the genotype. TNFR2 ablation, however, affected OPCs and OLs differently. In OPCs, it resulted in significant reduction of the basal non-stimulated (NS) expression of select inflammatory genes, specifically Tnf, Il1 and Ccl5, a difference

that was not maintained following stimulation. Interestingly, Il6 and Cxcl1 (undetectable in non-stimulated conditions) were significantly lower in TNFR2-/- OPCs compared to WT after stimulation. Notably, expression of Tnfrsf1a (gene name for TNFR1) was upregulated after stimulation, but with no difference between WT and TNFR2-/- cells. In differentiated OLs, stimulation also increased gene expression of inflammatory mediators, e.g. Tnf, Il6, Cxcl10 and Ccl5, but with no differences between WT and TNFR2-/- OLs (Fig. 6). When we assessed the protein expression of immunomodulatory molecules in cultured OPCs (Fig. 7) and OLs (Fig. 8) by multiplex assay, we observed a different profile. In both genotypes most molecules were undetectable in unstimulated conditions and elevated upon stimulation. In stimulated OPCs, pro-inflammatory IFN was significantly upregulated in TNFR2-/- cells compared to WT, and so was IL10, which is known to have a potent anti-inflammatory function (Fig. 7). Differentiated OLs exposed to the cytokine cocktail showed increased production of inflammatory mediators (e.g. TNF, IFN, IL6, IL1, CXCL1), but with no differences between WT and TNFR2-/- OLs (Fig. 8), similarly to the gene expression studies. Collectively, these data indicate that even though both OPCs and OLs have inflammatory capacity, it appears TNFR2 is involved in the modulation of this process primarily in OPCs and not in OLs.

3.4. Ablation of oligodendroglial TNFR2 alters the gene expression profile of oligodendrocytes following EAE.

To identify pathways/signals regulated by TNFR2 in oligodendrocytes that could be directly or indirectly responsible for modulating the neuroinflammatory response in CNP-cre:TNFR2fl/fl mice, we evaluated the expression of genes known to be associated with MS pathology in OPCs/OLs isolated from the spinal cord in naïve conditions and at 14 dpi using a PCR array (Fig. 9A-D). First, we analyzed each genotype in EAE versus naïve conditions to assess how disease affected gene expression in this cell population. When comparing TNFR2fl/fl mice at 14 dpi EAE versus naïve conditions, we found only 2 genes differentially expressed (Fig. 9A). We observed a decrease in Plp1, indicative of reduced myelin integrity, and an increase in the adhesion molecule Icam-1, which is important for extravasation of immune cells into the CNS (Gerhardt and Ley, 2015). In contrast, when comparing CNP-cre:TNFR2fl/fl mice in EAE versus naïve conditiions, we found 25 differentially expressed genes (Fig. 9B). Similar to control mice, Plp1 was the only one downregulated. The upregulated genes included pro-inflammatory mediators (e.g. Il1, Cxcl10, Ccl5, Hif1), and signaling molecules of the JAK-STAT and MAPK pathways. This suggests that, in the absence of TNFR2, inflammatory activation of OPCs/OLs in response to EAE is exacerbated. When comparing the two genotypes, CNP-cre:TNFR2fl/fl mice had differential expression of 3 genes compared to TNFR2fl/fl controls under naïve conditions: myelin and lymphocyte protein (Mal) was downregulated, whereas the pro-inflammatory genes Il1 and Cxcl10 were upregulated (Fig. 9C). At 14 dpi EAE, we found 15 differentially expressed genes in CNPcre:TNFR2fl/fl mice compared to TNFR2fl/fl controls (Fig. 9D). Notably, half of these genes are associated with inflammation and apoptosis, e.g. Cd28, Fn1, Bax, Bcl2,

suggesting that ablation of TNFR2 in oligodendrocytes results in aberrant gene expression and disrupts the function of this cell lineage in neuroinflammatory conditions.

3.5. Ablation of oligodendroglial TNFR2 induces upregulation of HIF1 in oligodendrocytes after EAE. Hif1 was found to be one the genes significantly upregulated in TNFR2 ablated oligodendrocytes following EAE (Fig. 9B). Since its association with inflammation (Corcoran and O'Neill, 2016; Imtiyaz and Simon, 2010), we assessed Hif1 expression by immunohistochemistry in CNP-cre:TNFR2fl/fl and TNFR2fl/fl control mice at 14 dpi EAE. Upregulation of Hif1 expression in oligodendrocytes was observed in CNPcre:TNFR2fl/fl mice compared to controls at this time point (Fig. 10A), both in the gray and white matter, as demonstrated by the significantly higher number of Hif1+Olig2+ cells measured by stereological counting (Fig. 10B). To identify other inflammatory molecules regulated by oligodendroglial TNFR2 that could play a role in MS/EAE pathology, we assessed expression of microRNA miR326 by fluorescent in situ hybridization. Several reports associated miR326 with MS pathogenesis (Du et al., 2009; Honardoost et al., 2014) and our previous studies identified miR326 as significantly increased in TNFR2 ablated oligodendrocytes following EAE (Madsen et al., 2016). Although we found miR326 highly upregulated in PDGFR+ OPCs in EAE conditions, both acute (14 dpi) and sub-acute (25 dpi), we did not detect a difference between CNP-cre:TNFR2fl/fl and TNFR2fl/fl mice (Supplementary Fig. 3). This indicates that TNFR2 is not implicated in the regulation of miR326 at the OPC stage, but possibly at the mature oligodendrocyte stage.

4. Discussion In the present work, we demonstrate that TNFR2 signaling in oligodendrocytes plays a critical role in modulating the immune-inflammatory response driving the onset and early pathological events of EAE. We show that mice lacking oligodendroglial TNFR2 display earlier microglial activation and immune cell infiltration, leading to accelerated onset, higher peak and overall increased severity of EAE. Our findings identify a novel role for TNFR2 in the regulation of the immunomodulatory machinery of oligodendrocytes. Though it is known that glial activation and slow influx of immune cells precede the onset of clinical symptoms in EAE, the lack of TNFR2 in oligodendrocytes hastens this damaging immune-inflammatory response. Indeed, microglial activation, measured as increased microglial numbers in the spinal cord, was significantly elevated in CNPcre:TNFR2fl/fl mice compared to controls already at 10 dpi, prior to disease onset. This was further potentiated at 14 dpi and coincided with a markedly elevated influx of peripheral immune cells into the CNS. This suggests that TNFR2 ablated oligodendrocytes provide signals that contribute to microglia proliferation and activation. TNFR2 appears to operate as a modulator of the inflammatory potential of oligodendrocytes, especially OPCs, maintaining a homeostatic control over their ability to produce immunomodulatory factors, a role normally attributed to other glial cells, namely microglia and astrocytes. We cannot exclude that the absence of TNFR2 may be shifting the balance of TNF signaling towards TNFR1, which has pro-inflammatory functions, and lifts the brake on oligodendrocyte activation. This is supported by our earlier work demonstrating that TNFR2 has precisely this role in microglia during EAE

(Gao et al., 2017). Microglia lacking TNFR2 showed dysregulation of crucial homeostatic genes, such as TREM2 necessary for phagocytosis, and purinergic receptors and Siglecs important for surveillance function. Furthermore, TNFR2 ablated microglia showed an enhanced inflammatory profile, with upregulation of chemokines, cytokines and adhesion molecules (Gao et al., 2017). These findings indicate that TNFR2 acts similarly in microglia and oligodendrocytes to suppress immune activation. Oligodendrocytes are typically thought of as the target of damaging inflammation in MS. However, an increasing body of literature suggests they may be active participants in this process (Zeis et al., 2016). Indeed, OPCs are among the first responders to CNS injury (Simon et al., 2011), and are found within the glial scar even in non-demyelinating injuries (Freeman and Rowitch, 2013). In EAE, specific OPC and OL populations express genes involved in antigen processing and presentation via MHCI and MHCII (Falcao et al., 2018). Oligodendrocytes have also been shown to have phagocytic capacity and to be able to activate memory and effector CD4+ T cells in a MHCII-dependent manner (Falcao et al., 2018). Expression of immunomodulatory genes has been identified in populations of oligodendrocytes in the human brain affected by MS (Jäkel et al., 2019). Following toxin-induced demyelination in the CNS, adult OPCs become hypertrophic and revert their transcriptome to resemble that of neonatal OPCs (Moyon et al., 2015). In this state, they upregulate pro-inflammatory IL1 and CCL2, which, in addition to acting in a paracrine fashion towards neighboring cells, have also been shown to act in autocrine capacity to stimulate OPC migration (Moyon et al., 2015). Furthermore, when stimulated in vitro with Th1 and Th17 cytokines (IFN, TNF and IL17) OPCs upregulate the expression of a variety of inflammatory

genes (e.g. Il6, Ccl2, Cxcl10, Cxcl1, Mmp3, Mmp9) (Balabanov et al., 2007; Kang et al., 2013). Here we show that OLs have similar pro-inflammatory properties as OPCs. Indeed, after in vitro stimulation with a cocktail of cytokines typically found in the MS/EAE affected CNS (TNF, IL1, IFN), both OPCs and OLs upregulate gene expression of Tnf, Il1, Il6, Ccl2, Ccl5, Cxcl1 and Cxcl10. In fact, some of these genes (e.g. Tnf) were higher in stimulated OLs than OPCs. The evidence that increased microglia activation occurs as early as 10 dpi in CNP-cre:TNFR2fl/fl mice indicates that the immunomodulatory molecules produced by oligodendrocytes after EAE act locally on microglia accelerating activation. This idea is in line with recent observations by Scheld at al. showing that oligodendrocytes exposed to mitochondrial stressors robustly upregulate production of cytokines and chemokines (e.g. IL6) and induce pro-inflammatory activation of microglia (Scheld et al., 2019). We speculate that, after an initial priming by oligodendrocytes, microglia, and possibly astrocytes, take over as master inflammatory/immunomodulatory players and produce the bulk of mediators responsible for attracting immune cells in large numbers into the CNS. Indeed, at 14 dpi in the spinal cord of CNP-cre:TNFR2fl/fl mice the cytokines TNF, IL1, IL6, IFN, IL2, and the chemokines CXCL1, CCL5 and CCL2 were markedly upregulated compared to TNFR2fl/fl control mice, where production was almost undetectable. Sources of these mediators are likely glia and infiltrating immune cells combined (Brambilla, 2019; Voet et al., 2019). It appears that CCL2, CCL5 and CXCL1 act as early chemoattractants released by astrocytes (Boven et al., 2000; Karim et al., 2018; Miyagishi et al., 1997; Moreno et al., 2014; Omari et al., 2009; Ransohoff et al., 1993; Van Der Voorn et al., 1999) and microglia (Farez et al., 2009; Gao et al., 2017;

Olson and Miller, 2004). As they are responsible for recruiting myeloid cells (macrophages, neutrophils) and T cells into the CNS, their upregulation fits well with the timing of the dramatic increase in leukocyte influx observed in CNP-cre:TNFR2fl/fl mice. Whether any of these oligodendrocyte mediators are regulated by TNFR2 and trigger the cascade of events leading to accelerated EAE still needs to be fully elucidated. The increased infiltration of immune cells found at 14 dpi in the spinal cord of CNP-cre:TNFR2fl/fl versus TNFR2fl/fl mice was preceded not only by increased microglial activation, but also by elevated BBB permeability measured at 10 dpi in the spinal cord, prior to onset of clinical symptoms. Opening of the BBB is a prerequisite for the trafficking of immune cells into the CNS, and occurs as a consequence of inflammation (Ransohoff and Engelhardt, 2012). Therefore, it is likely that inflammatory mechanisms driven by TNFR2 ablated oligodendrocytes influence BBB changes that account for the early and enhanced immune infiltration. This may occur through indirect activation of astroglia and microglia. The early and potentiated inflammatory response in CNP-cre:TNFR2fl/fl mice also correlated with a significantly elevated inflammasome activation at 14 dpi in the spinal cord. Indeed, ASC, a key component of the inflammasome, as well as its downstream effectors pro-caspase 1, caspase 1 and pro-IL1 were highly upregulated in CNPcre:TNFR2fl/fl mice compared to controls at 14 dpi. Consistent with these findings, IL1, the end product of the inflammasome, was highly increased at 14 dpi in the spinal cord of CNP-cre:TNFR2fl/fl mice as measured by multiplex assay. By 18 dpi, the levels of these inflammasome components decreased, whereas they reached their peak in TNFR2fl/fl mice, yet again demonstrating early inflammatory activation in CNP-

cre:TNFR2fl/fl mice. The inflammasome is highly active in myeloid cells as well as T cells, where it regulates Th17 and Th1 responses in EAE (Gris et al., 2010; Levesque et al., 2016). Therefore, it is likely that the increased inflammasome activation measured in CNPcre:TNFR2fl/fl mice is caused by the higher trafficking of these cell populations into the CNS. The inflammasome is also active in oligodendrocytes during CNS disease (Jang et al., 2016), but whether it is modulated by TNFR2 in our model remains to be determined. Our in vitro experiments with cultured OPCs and OLs showed that both populations have inflammatory capacity as they increase cytokine and chemokine expression after stimulation with pro-inflammatory cytokines. Unlike in OPCs, no difference was observed in OLs between WT and TNFR2 ablated cells, suggesting that inflammatory activation of OLs may be a TNFR2-independent process. However, we cannot exclude that expression of other factors is altered. For instance, since TNFR2 has been associated with cell survival and resolution of inflammation, TNFR2 in OLs may promote the expression of beneficial anti-inflammatory and pro-survival factors. Surprisingly, cultured OPCs lacking TNFR2 showed, in non-stimulated conditions, downregulation of prototypical MS/EAE-associated inflammatory genes, such as Tnf and Il1 and the mechanisms of this effect are yet to be determined. After stimulation, TNFR2-/- OPCs showed downregulation of Cxclx1 and Il6. Although both have a known pro-inflammatory role, they have also been shown to play neuroprotective functions by reducing inflammation and recruiting reparative OPCs to the site of demyelination (Karim et al., 2018; Petkovic et al., 2016). Additionally, it has been shown that MS lesions with high OL preservation, display highly elevated IL6 expression, suggesting a

protective role for this cytokine (Schonrock et al., 2000). Hence, reduced expression of IL6 and CXCL1 by TNFR2 ablated OPCs may result in reduced repair. The fact that TNFR2 seems to have a role in modulating the proinflammatory capacity of OPCs but not OLs may be dependent on its higher expression levels in OPCs compared to OLs (Zhang et al., 2014). Additionally, OPCs and OLs have unique specialized functions in CNS homeostasis, supported by remarkably distinct gene expression profiles. Thus, it is not surprising that TNFR2 signaling may play differential roles in the two populations. We demonstrated that pro-inflammatory activation of oligodendrocytes was not restricted to the in vitro setting but, most significantly, occurred in vivo, in line with recent

studies

(Falcao

et

al.,

2018).

Gene

expression

profiling

comparing

oligodendrocytes sorted from CNP-cre:TNFR2fl/fl versus control mice in naïve conditions showed significant upregulation of Il1 and Ccxl10, indicating that TNFR2 may indeed be directly involved in the modulation of these molecules. Oligodendrocytes sorted from CNP-cre:TNFR2fl/fl mice at 14 dpi showed increased expression of numerous inflammatory mediators and intracellular signaling molecules when compared to naïve mice. Interestingly, fibronectin 1 (Fn1) and elements of the JAK-STAT signaling pathway were elevated in comparison to oligodendrocytes from TNFR2fl/fl mice. This suggests that transcriptional regulation of these factors may be downstream of TNFR2. Upregulation of Il1 and Cxcl10 in oligodendrocytes from CNP-cre:TNFR2fl/fl versus TNFR2fl/fl mice was not maintained after EAE, likely because expression in TNFR2 ablated cells already peaked, and by 14 dpi is returning to baseline. This interpretation

is supported by our finding of early microglial activation detected at 10 dpi, which is induced by “stressed” TNFR2 ablated oligodendrocytes. The transcription factor Hif1 was elevated in CNP-cre:TNFR2fl/fl mice as a consequence of EAE, even though no difference was observed with respect to TNFR2fl/fl controls. Given the vast literature reporting a role for Hif1 in autoimmune demyelination and its expression in oligodendrocyte lineage cells, we analyzed Hif1 protein expression in the spinal cord at 14 dpi by immunohistochemistry. Hif1 was highly upregulated throughout the cord in CNP-cre:TNFR2fl/fl mice compared to TNFR2fl/fl controls. More specifically, Olig2+ oligodendrocytes showed markedly increased Hif1 immunoreactivity. Hif1 is an important regulator of the cellular responses to hypoxia (Semenza, 2012). In MS, high oligodendroglial expression of Hif1 was observed in pattern III ischemic-type lesions (Aboul-Enein et al., 2003), considered to develop as a consequence of primary oligodendropathy (Lucchinetti et al., 2000). Since its expression was correlated with increased myelin loss, it has been suggested that Hif1 plays a pathogenic role in MS. Several reports show that Hif1, by positively regulating the expression of VEGF and IL1, promotes BBB permeability in EAE (Argaw et al., 2006). Taken together, our data suggest that Hif1 directly produced by TNFR2 deficient oligodendrocytes or by other CNS cells (e.g. activated astrocytes and microglia) may participate in accelerating and propagating inflammatory activation leading to early EAE onset in CNP-cre:TNFR2fl/fl mice. In conclusion, we report a novel role for TNFR2 as a modulator of oligodendrocyte

immune-inflammatory

function

in

CNS

neurological

disease.

Furthermore, our findings highlight a critical role for oligodendrocytes in the early events

of EAE pathogenesis, demonstrating they are not simply the target of inflammation but rather work in concert with other glial cells to initiate the immune-inflammatory response. Our work indicates that potentiation of TNFR2 activation in the CNS during the early phases of CNS autoimmunity may prove beneficial to dampen the detrimental inflammatory response and improve clinical outcomes.

Author contributions PMM and HLD conducted most of the experiments, analyzed data and drafted the manuscript; YF performed stereological counting; JPDRV and RWK performed inflammasome western blots; BHC performed fluorescent in situ hybridization; DGE and KLL performed and analyzed multiplex experiments; RB conceived the study, analyzed data and wrote the manuscript. All co-authors reviewed and edited the manuscript.

Conflict of Interest All authors declare no competing financial interests. It should be disclosed that JPDRV and RWK are co-founders and managing members of InflamaCORE, LLC. JPDRV and RWK are also members of the Scientific Advisory Board of ZyVersa Therapeutics.

Figure legends

Figure 1. Lack of oligodendroglial TNFR2 leads to EAE exacerbation. (A) Clinical disease course of CNP-cre:TNFR2fl/fl and TNFR2fl/fl mice following MOG35–55-induced EAE. Results are represented as daily mean clinical score ± SEM of 17-23 mice/group from 3 independent experiments; F(24,912)=3.039, p≤0.0001, two-way ANOVA, Sidak’s multiple-comparison’s

test:

*p=0.0430,^p=0.0209,#p=0.0148,

**p=0.0067.

(B)

Representative confocal images of CD3+ T cells (white arrows) in the thoracic spinal cord at 10 and 14 dpi. Scale bar: 40 m. (C) Stereological quantification of CD3+ T cells in the thoracic spinal cord at 10 dpi and 14 dpi [t(6)=2.751, n=4-5/group, *p=0.0333, ttest]. (D) Representative confocal images of infiltrating leukocytes and microglia in the thoracic spinal cord at 10 and 14 dpi. Yellow arrows: ramified CD45+Iba1+ microglia; white arrows: CD45+ infiltrating non-myeloid cells; orange arrows: round CD45+Iba1+ infiltrating myeloid cells (macrophages/neutrophils). Scale bar: 20 m. (E) Stereological quantification of infiltrating CD45+Iba1- non-myeloid cells [t(7)=2.506, n=4-5/group, *p=0.0406, t-test] and CD45+Iba1+ myeloid cells [t(7)=2.864, n=4-5/group,* p=0.0242, ttest] in the spinal cord at 10 and 14 dpi. (F) Stereological quantification of Iba1+ microglia in the thoracic spinal cord in naïve conditions [n=3/group] and at 10 dpi [t(7)=3.486, n=4-5/group, *p=0.0102, t-test] and 14 dpi [t(8)=2.749, n=5/group, *p=0.0251, t-test].

Figure 2. Ablation of oligodendroglial TNFR2 increases the infiltration of immune cells into the CNS following EAE. (A-E) Flow cytometric analysis of immune cell

populations in the spinal cord of TNFR2fl/fl and CNP-cre:TNFR2fl/fl mice at 14 dpi; n=79/group. CD4+ T cells [t(13)=2.748, p=0.0166, t-test]; CD8+ T cells [t(13)=2.246, p=0.0427, t-test]; macrophages [t(13)=2.292, *p=0.0182, t-test]; MHCII+ macrophages [*p=0.0289, Mann-Whitney test]. Macrophages were identified as CD45hCD11b+Lys6Gcells and neutrophils as CD45hCD11b+Lys6G+ cells. (B) Representative flow cytometry plot of MHCII+ macrophages and neutrophils in the spinal cord at 14 dpi. (C) Representative flow cytometry plot of CD4+ and CD8+ T cells in the spinal cord at 14 dpi. (D) Flow cytometric quantification of microglia [t(13)=2.457, *p=0.0288, t-test] and MHCII+ microglia [t(13)=3.112, *p=0.0083, t-test] in the spinal cord at 14 dpi. (E) Representative flow cytometry plot of total and MHCII+ microglia in the spinal cord at 14 dpi. (F) Spectrophotometric quantification of Evans Blue extravasation into spinal cord [t(18)=2.469, *p=0.0238, t-test] and brain at 10 dpi; n=10/group from 2 independent experiments. SC: spinal cord.

Figure 3. Ablation of oligodendroglial TNFR2 reduces the number of immune cells in the spleen following EAE. (A) Flow cytometric analysis of immune cell populations in the spleen of TNFR2fl/fl and CNP-cre:TNFR2fl/fl mice at 14 dpi; CD4+ T cells [t(16)=2.254, *p=0.0386, t-test]; CD8+ T cells [t(16)=2.496, *p=0.0239, t-test]; B220+ B cells [t(16)=11.39, ****p<0.0001, t-test]; MHCII+B220+ B cells [t(16)=4.674, ***p=0.0003, t-test];

MHCII+

macrophages

[t(16)=2.725,

*p=0.015,

t-test];

n=7-9/group.

(B)

Representative flow cytometry plots of CD4+ and CD8+ T cells, total and MHCII+ B cells, and total and MHCII+ macrophages in the spleen at 14dpi. B cells are selected as CD45+B220+, macrophages are selected as CD45hCD11b+Lys6G-. (C) Flow cytometric

analysis of immune cell populations in the spleen of naïve TNFR2fl/fl and CNPcre:TNFR2fl/fl mice; n=7-8/group.

Figure 4. Ablation of oligodendroglial TNFR2 accelerates the timing of expression of proinflammatory molecules following EAE. Quantification of cytokines and chemokines in the spinal cord of naïve CNP-cre:TNFR2fl/fl and TNFR2fl/fl mice and 14, 18 and 35 dpi by multiplex assay. TNFR1 [t(6)=2.675, *p=0.0368, t-test]; TNF [t(6)=4.319, **p=0.0050, t-test]; IFN [t(6)=2.809, *p=0.0308, t-test]; IL1 [t(6)=3.374, *p=0.0150, ttest]; IL6 [t(6)=2.735, *p=0.0339, t-test]; IL2 [t(6)=3.098, *p=0.0212, t-test]; CXCL1 [t(6)=3.033, *p=0.023, t-test]; CCL5 [t(5)=3.655,*p=0.0147, t-test]; CCL2 [t(6)=4.44, **p=0.0044, t-test]; n=4/group.

Figure 5. Ablation of oligodendroglial TNFR2 accelerates the timing of inflammasome activation after EAE. (A) Representative western blot for NLRP3 inflammasome components and targets in whole spinal cord homogenates from TNFR2fl/fl (C) and CNP-cre:TNFR2fl/fl (cKO) mice at 14 dpi. (B-D) Protein quantification: (B) ASC [t(6)=2.77, *p=0.0324, t-test]; (C) cleaved caspase 1 [t(6)=5.267, **p=0.0019, ttest]; (D) IL1 [t(6)=2.818, *p=0.0304, t-test]; n=4/group.

Figure 6. Gene expression of cytokines and chemokines in cultured OPCs and OLs. Gene expression profiling of cultured primary OPCs and OLs from WT and TNFR2-/- mice following a 3h stimulation with TNF/IL1/IFN or exposed to PBS vehicle alone; TNF [t(22)=2.570, *p=0.0175, t-test]; IL1 [t(20)=2.192, *p=0.0404, t-test]; CCL5

[t(22)=2.153, *p=0.0426, t-test]; CXCL1 [t(10)=2.551, p=0.0288, t-test]; IL6 [t(9)=3.234, *p=0.0103, t-test]; n=5-12/group, NS: non-stimulated, exposed to PBS vehicle alone.

Figure 7. Protein expression of cytokines and chemokines in cultured OPCs. Multiplex analysis of cytokines and chemokines (in pg/mg of cells) produced by cultured primary OPCs from WT and TNFR2-/- mice following a 3h stimulation with TNF/IL1/IFN or exposed to PBS vehicle alone; IFN [t(2)=5.299, p=0.0338, t-test]; IL10 [t(4)=3.555, p=0.0237, t-test], n=2-3/group. NS: non-stimulated, exposed to PBS vehicle alone.

Figure 8. Protein expression of cytokines and chemokines in cultured OLs. Multiplex analysis of cytokines and chemokines (in pg/g of cells) produced by cultured primary OLs from WT and TNFR2-/- mice following a 3h stimulation with TNF/IL1/IFN or exposed to PBS vehicle alone; n=4/group. NS: non-stimulated, exposed to PBS vehicle alone.

Figure 9. Ablation of oligodendroglial TNFR2 alters the gene expression profile of oligodendrocytes following EAE. (A-D) Differentially expressed genes in spinal cord oligodendrocytes sorted from TNFR2fl/fl (controls) and CNP-cre:TNFR2fl/fl (cKO) mice in naïve conditions and 14 dpi EAE. Changes in gene expression are expressed as log2 fold change (log2FC). All genes shown have significantly altered expression levels with p≤0.05 (Student’s t-test); n=3-4/group.

Figure 10: TNFR2 ablated oligodendrocytes show elevated HIF1 expression compared to control oligodendrocytes following EAE. (A) Immunohistochemical staining for HIF-1 in the spinal cord of TNFR2fl/fl and CNP-cre:TNFR2fl/fl mice at 14 dpi. White arrows show HIF-1 colocalization with the oligodendrocyte lineage marker Olig2. Scale bar: 100 m. (B) Stereological quantification of Hif1+Olig2+ cells: results are expressed as absolute number/mm3 (top panel) [t(5)=2.712, n=3-4/group, p=0.0422, ttest] or as percentage of the total olig2+ population (bottom panel) [t(5)=3.017, n=34/group, p=0.0295, t-test].

Table 1. Primers for real-time PCR gene amplification Gene

Primer Sequence

Product

Optimal Atemp

Length -actin

F: 5’ CTAGACTTCGAGCAGGAGATGG 3’

141 bp

55.9°C

123 bp

56.6°C

91 bp

56.2°C

128 bp

50.7°C

102 bp

53.4°C

113 bp

57.2°C

81 bp

53.1 °C

86 bp

52.9 °C

R: 5’ CAAGAAGGAAGGCTGGAAAAGAG 3’ TNF

F: 5’ AGGCACTCCCCCAAAAGATG 3’ R: 5’ TCACCCCGAAGTTCAGTAGACAGA 3’

TNFR1

F: 5’ GCCCGAAGTCTACTCCATCATTTG 3’ R: 5’ GGCTGGGGAGGGGGCTGGAGTTAG 3’

IFN

F: 5’ GCCAGATTATCTCTTTCTACCTCA 3’ R: 5’CTTTTTCGCCTTGCTGTTGC 3’

IL1

F: 5’ CTTCAAATCTCACAGCAGCACATC 3’ R: 5’ CCACGGGAAAGACACAGGTAG 3’

CXCL10

F: 5’ GCCGTCATTTTCTGCCTCATCCT 3’ R: 5’ CTCATTCTCACTGGCCCGTCATC 3’

CCL5

F: 5 TGCCCACGTCAAGGAGTATTTCTA’ 3’ R: 5’ TGGCGGTTCCTTCGAGTGACAA 3’

CCL2

F: 5’ CCCCACTCACCTGCTGCTAC 3’ R: 5’ CCTGCTGCTGGTGATTCTCTT 3’

Table 2. EAE parameters Incidence TNFR2fl/fl

20 of 28

Onset (Day) 16.7 ± 0.9

CNP-cre:TNFR2fl/fl

17 of 22

14.2 ± 0.7*

Peak Disease (Day) 20.4 ± 0.9

Peak Disease (Score) 2.7 ± 0.1

Cumulative Disease Index (CDI) 26.2 ± 3.3

18.2 ± 0.6

3.3 ± 0.9***

37.2 ± 2.5^

Comparison of CNP-cre:TNFR2fl/fl mice vs TNFR2fl/fl mice; *p=0.0389, ^p=0.0131, ***p=0.0003, Mann-Whitney test.

Acknowledgments We thank Shaffiat Karmally and Dr. Jianjun Shi for their help with mouse colony management and genotyping. This work was supported by the Italian Multiple Sclerosis Foundation (FISM) grants 2012/R/2 and 2015/R/7 (RB); NIH NINDS grant 1RO1NS094522-01 (RB); The Miami Project To Cure Paralysis (RB); the Danish Multiple Sclerosis Society (PMM); Fonden til Lægevidenskabens Fremme (PMM); the Foundation for Research in Neurology (PMM);

References Aboul-Enein, F., Rauschka, H., Kornek, B., Stadelmann, C., Stefferl, A., Bruck, W., Lucchinetti, C., Schmidbauer, M., Jellinger, K., Lassmann, H., 2003. Preferential loss of myelin-associated glycoprotein reflects hypoxia-like white matter damage in stroke and inflammatory brain diseases. J Neuropathol Exp Neurol 62, 25-33. Argaw, A.T., Zhang, Y., Snyder, B.J., Zhao, M.L., Kopp, N., Lee, S.C., Raine, C.S., Brosnan, C.F., John, G.R., 2006. IL-1beta regulates blood-brain barrier permeability via reactivation of the hypoxia-angiogenesis program. J Immunol 177, 5574-5584. Arnett, H.A., Mason, J., Marino, M., Suzuki, K., Matsushima, G.K., Ting, J.P., 2001. TNF alpha promotes proliferation of oligodendrocyte progenitors and remyelination. Nat Neurosci 4, 1116-1122. Balabanov, R., Strand, K., Goswami, R., McMahon, E., Begolka, W., Miller, S.D., Popko, B., 2007. Interferon-gamma-oligodendrocyte interactions in the regulation of experimental autoimmune encephalomyelitis. J Neurosci 27, 2013-2024. Black, R.A., Rauch, C.T., Kozlosky, C.J., Peschon, J.J., Slack, J.L., Wolfson, M.F., Castner, B.J., Stocking, K.L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K.A., Gerhart, M., Davis, R., Fitzner, J.N., Johnson, R.S., Paxton, R.J., March, C.J., Cerretti, D.P., 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385, 729-733. Boven, L.A., Montagne, L., Nottet, H.S., De Groot, C.J., 2000. Macrophage inflammatory protein-1alpha (MIP-1alpha), MIP-1beta, and RANTES mRNA semiquantification and protein expression in active demyelinating multiple sclerosis (MS) lesions. Clin Exp Immunol 122, 257-263.

Brambilla, R., 2019. The contribution of astrocytes to the neuroinflammatory response in multiple

sclerosis

and

experimental

autoimmune

encephalomyelitis.

Acta

Neuropathol. Brambilla, R., Ashbaugh, J.J., Magliozzi, R., Dellarole, A., Karmally, S., Szymkowski, D.E., Bethea, J.R., 2011. Inhibition of soluble tumour necrosis factor is therapeutic in experimental autoimmune encephalomyelitis and promotes axon preservation and remyelination. Brain 134, 2736-2754. Constantinescu, C.S., Farooqi, N., O'Brien, K., Gran, B., 2011. Experimental autoimmune encephalomyelitis (EAE) as a model for multiple sclerosis (MS). Br J Pharmacol 164, 1079-1106. Corcoran, S.E., O'Neill, L.A., 2016. HIF1alpha and metabolic reprogramming in inflammation. J Clin Invest 126, 3699-3707. Dostert, C., Grusdat, M., Letellier, E., Brenner, D., 2019. The TNF Family of Ligands and Receptors: Communication Modules in the Immune System and Beyond. Physiol Rev 99, 115-160. Du, C., Liu, C., Kang, J., Zhao, G., Ye, Z., Huang, S., Li, Z., Wu, Z., Pei, G., 2009. MicroRNA miR-326 regulates TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis. Nat Immunol 10, 1252-1259. Dumas, A., Amiable, N., de Rivero Vaccari, J.P., Chae, J.J., Keane, R.W., Lacroix, S., Vallieres, L., 2014. The inflammasome pyrin contributes to pertussis toxin-induced IL-1beta

synthesis,

neutrophil

intravascular

encephalomyelitis. PLoS Pathog 10, e1004150.

crawling

and

autoimmune

Falcao, A.M., van Bruggen, D., Marques, S., Meijer, M., Jakel, S., Agirre, E., Samudyata, Floriddia, E.M., Vanichkina, D.P., Ffrench-Constant, C., Williams, A., Guerreiro-Cacais,

A.O.,

Castelo-Branco,

G.,

2018.

Disease-specific

oligodendrocyte lineage cells arise in multiple sclerosis. Nat Med 24, 1837-1844. Farez, M.F., Quintana, F.J., Gandhi, R., Izquierdo, G., Lucas, M., Weiner, H.L., 2009. Toll-like receptor 2 and poly(ADP-ribose) polymerase 1 promote central nervous system neuroinflammation in progressive EAE. Nat Immunol 10, 958-964. Freeman, M.R., Rowitch, D.H., 2013. Evolving concepts of gliogenesis: a look way back and ahead to the next 25 years. Neuron 80, 613-623. Gao, H., Danzi, M.C., Choi, C.S., Taherian, M., Dalby-Hansen, C., Ellman, D.G., Madsen, P.M., Bixby, J.L., Lemmon, V.P., Lambertsen, K.L., Brambilla, R., 2017. Opposing Functions of Microglial and Macrophagic TNFR2 in the Pathogenesis of Experimental Autoimmune Encephalomyelitis. Cell Rep 18, 198-212. Gerhardt, T., Ley, K., 2015. Monocyte trafficking across the vessel wall. Cardiovasc Res 107, 321-330. Grell, M., et al., 1995. The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80 kDa tumor necrosis factor receptor. Cell 83, 793-802. Grell, M., Wajant, H., Zimmermann, G., Scheurich, P., 1998. The type 1 receptor (CD120a) is the high-affinity receptor for soluble tumor necrosis factor. Proc Natl Acad Sci U S A 95, 570-575. Gris, D., Ye, Z., Iocca, H.A., Wen, H., Craven, R.R., Gris, P., Huang, M., Schneider, M., Miller, S.D., Ting, J.P., 2010. NLRP3 plays a critical role in the development of

experimental autoimmune encephalomyelitis by mediating Th1 and Th17 responses. J Immunol 185, 974-981. Hansen, T.B., Jensen, T.I., Clausen, B.H., Bramsen, J.B., Finsen, B., Damgaard, C.K., Kjems, J., 2013. Natural RNA circles function as efficient microRNA sponges. Nature 495, 384-388. Hofman, F.M., Hinton, D.R., Johnson, K., Merrill, J.E., 1989. Tumor necrosis factor identified in multiple sclerosis brain. J Exp Med 170, 607-612. Holtmann, M.H., Neurath, M.F., 2004. Differential TNF-signaling in chronic inflammatory disorders. Curr Mol Med 4, 439-444. Honardoost, M.A., Kiani-Esfahani, A., Ghaedi, K., Etemadifar, M., Salehi, M., 2014. miR-326 and miR-26a, two potential markers for diagnosis of relapse and remission phases in patient with relapsing-remitting multiple sclerosis. Gene 544, 128-133. Imtiyaz, H.Z., Simon, M.C., 2010. Hypoxia-inducible factors as essential regulators of inflammation. Curr Top Microbiol Immunol 345, 105-120. Inoue, M., Shinohara, M.L., 2013. NLRP3 Inflammasome and MS/EAE. Autoimmune Dis 2013, 859145. Jäkel, S., Agirre, E., Falcão, A.M., van Bruggen, D., Lee, K.W., Knuesel, I., Malhotra, D., ffrench-Constant, C., Williams, A., Castelo-Branco, G., 2019. Altered human oligodendrocyte heterogeneity in multiple sclerosis. Nature. Jang, J., Park, S., Jin Hur, H., Cho, H.J., Hwang, I., Pyo Kang, Y., Im, I., Lee, H., Lee, E., Yang, W., Kang, H.C., Won Kwon, S., Yu, J.W., Kim, D.W., 2016. 25hydroxycholesterol

contributes

to

cerebral

inflammation

of

X-linked

adrenoleukodystrophy through activation of the NLRP3 inflammasome. Nat Commun 7, 13129. Kang, Z., Wang, C., Zepp, J., Wu, L., Sun, K., Zhao, J., Chandrasekharan, U., DiCorleto, P.E., Trapp, B.D., Ransohoff, R.M., Li, X., 2013. Act1 mediates IL-17induced EAE pathogenesis selectively in NG2+ glial cells. Nat Neurosci 16, 14011408. Karim, H., Kim, S.H., Lapato, A.S., Yasui, N., Katzenellenbogen, J.A., Tiwari-Woodruff, S.K., 2018. Increase in chemokine CXCL1 by ERbeta ligand treatment is a key mediator in promoting axon myelination. Proc Natl Acad Sci U S A 115, 6291-6296. Kemanetzoglou, E., Andreadou, E., 2017. CNS Demyelination with TNF-alpha Blockers. Curr Neurol Neurosci Rep 17, 36. Kriegler, M., Perez, C., DeFay, K., Albert, I., Lu, S.D., 1988. A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF. Cell 53, 45-53. Levesque, S.A., Pare, A., Mailhot, B., Bellver-Landete, V., Kebir, H., Lecuyer, M.A., Alvarez, J.I., Prat, A., de Rivero Vaccari, J.P., Keane, R.W., Lacroix, S., 2016. Myeloid cell transmigration across the CNS vasculature triggers IL-1beta-driven neuroinflammation during autoimmune encephalomyelitis in mice. J Exp Med 213, 929-949. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402408.

Lucchinetti, C., Bruck, W., Parisi, J., Scheithauer, B., Rodriguez, M., Lassmann, H., 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann Neurol 47, 707-717. Madsen, P.M., Clausen, B.H., Degn, M., Thyssen, S., Kristensen, L.K., Svensson, M., Ditzel, N., Finsen, B., Deierborg, T., Brambilla, R., Lambertsen, K.L., 2015. Genetic ablation of soluble tumor necrosis factor with preservation of membrane tumor necrosis factor is associated with neuroprotection after focal cerebral ischemia. J Cereb Blood Flow Metab. Madsen, P.M., Motti, D., Karmally, S., Szymkowski, D.E., Lambertsen, K.L., Bethea, J.R., Brambilla, R., 2016. Oligodendroglial TNFR2 Mediates Membrane TNFDependent Repair in Experimental Autoimmune Encephalomyelitis by Promoting Oligodendrocyte Differentiation and Remyelination. J Neurosci 36, 5128-5143. Madsen, P.M., Sloley, S.S., Vitores, A.A., Carballosa-Gautam, M.M., Brambilla, R., Hentall, I.D., 2017. Prolonged stimulation of a brainstem raphe region attenuates experimental autoimmune encephalomyelitis. Neuroscience 346, 395-402. Miyagishi, R., Kikuchi, S., Takayama, C., Inoue, Y., Tashiro, K., 1997. Identification of cell types producing RANTES, MIP-1 alpha and MIP-1 beta in rat experimental autoimmune encephalomyelitis by in situ hybridization. J Neuroimmunol 77, 17-26. Moreno, M., Bannerman, P., Ma, J., Guo, F., Miers, L., Soulika, A.M., Pleasure, D., 2014. Conditional ablation of astroglial CCL2 suppresses CNS accumulation of M1 macrophages and preserves axons in mice with MOG peptide EAE. J Neurosci 34, 8175-8185.

Moss, M.L., Jin, S.L., Milla, M.E., Bickett, D.M., Burkhart, W., Carter, H.L., Chen, W.J., Clay, W.C., Didsbury, J.R., Hassler, D., Hoffman, C.R., Kost, T.A., Lambert, M.H., Leesnitzer, M.A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L.K., Schoenen, F., Seaton, T., Su, J.L., Becherer, J.D., et al., 1997. Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385, 733-736. Moyon, S., Dubessy, A.L., Aigrot, M.S., Trotter, M., Huang, J.K., Dauphinot, L., Potier, M.C., Kerninon, C., Melik Parsadaniantz, S., Franklin, R.J., Lubetzki, C., 2015. Demyelination causes adult CNS progenitors to revert to an immature state and express immune cues that support their migration. J Neurosci 35, 4-20. Olson, J.K., Miller, S.D., 2004. Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs. J Immunol 173, 3916-3924. Omari, K.M., Lutz, S.E., Santambrogio, L., Lira, S.A., Raine, C.S., 2009. Neuroprotection and remyelination after autoimmune demyelination in mice that inducibly overexpress CXCL1. Am J Pathol 174, 164-176. Petkovic, F., Campbell, I.L., Gonzalez, B., Castellano, B., 2016. Astrocyte-targeted production of interleukin-6 reduces astroglial and microglial activation in the cuprizone

demyelination

model:

Implications

for

myelin

clearance

and

oligodendrocyte maturation. Glia 64, 2104-2119. Probert, L., 2015. TNF and its receptors in the CNS: The essential, the desirable and the deleterious effects. Neuroscience 302, 2-22. Radu, M., Chernoff, J., 2013. An in vivo assay to test blood vessel permeability. J Vis Exp, e50062.

Ransohoff, R.M., Engelhardt, B., 2012. The anatomical and cellular basis of immune surveillance in the central nervous system. Nature reviews. Immunology 12, 623635. Ransohoff, R.M., Hamilton, T.A., Tani, M., Stoler, M.H., Shick, H.E., Major, J.A., Estes, M.L., Thomas, D.M., Tuohy, V.K., 1993. Astrocyte expression of mRNA encoding cytokines IP-10 and JE/MCP-1 in experimental autoimmune encephalomyelitis. FASEB J 7, 592-600. Scheld, M., Fragoulis, A., Nyamoya, S., Zendedel, A., Denecke, B., Krauspe, B., Teske, N., Kipp, M., Beyer, C., Clarner, T., 2019. Mitochondrial Impairment in Oligodendroglial Cells Induces Cytokine Expression and Signaling. J Mol Neurosci 67, 265-275. Schonrock, L.M., Gawlowski, G., Bruck, W., 2000. Interleukin-6 expression in human multiple sclerosis lesions. Neurosci Lett 294, 45-48. Selmaj, K., Raine, C.S., Cannella, B., Brosnan, C.F., 1991. Identification of lymphotoxin and tumor necrosis factor in multiple sclerosis lesions. J Clin Invest 87, 949-954. Semenza, G.L., 2012. Hypoxia-inducible factors in physiology and medicine. Cell 148, 399-408. Sharief, M.K., Hentges, R., 1991. Association between tumor necrosis factor-alpha and disease progression in patients with multiple sclerosis. N Engl J Med 325, 467-472. Simon, C., Gotz, M., Dimou, L., 2011. Progenitors in the adult cerebral cortex: cell cycle properties and regulation by physiological stimuli and injury. Glia 59, 869-881. Suvannavejh, G.C., Lee, H.O., Padilla, J., Dal Canto, M.C., Barrett, T.A., Miller, S.D., 2000. Divergent roles for p55 and p75 tumor necrosis factor receptors in the

pathogenesis of MOG(35-55)-induced experimental autoimmune encephalomyelitis. Cell Immunol 205, 24-33. Taoufik, E., Tseveleki, V., Chu, S.Y., Tselios, T., Karin, M., Lassmann, H., Szymkowski, D.E., Probert, L., 2011. Transmembrane tumour necrosis factor is neuroprotective and regulates experimental autoimmune encephalomyelitis via neuronal nuclear factor-kappaB. Brain 134, 2722-2735. Van Der Voorn, P., Tekstra, J., Beelen, R.H., Tensen, C.P., Van Der Valk, P., De Groot, C.J., 1999. Expression of MCP-1 by reactive astrocytes in demyelinating multiple sclerosis lesions. Am J Pathol 154, 45-51. Voet, S., Prinz, M., van Loo, G., 2019. Microglia in Central Nervous System Inflammation and Multiple Sclerosis Pathology. Trends Mol Med 25, 112-123. Zeis,

T.,

Enz,

L.,

Schaeren-Wiemers,

N.,

2016.

The

immunomodulatory

oligodendrocyte. Brain research 1641, 139-148. Zhang, Y., Chen, K., Sloan, S.A., Bennett, M.L., Scholze, A.R., O'Keeffe, S., Phatnani, H.P., Guarnieri, P., Caneda, C., Ruderisch, N., Deng, S., Liddelow, S.A., Zhang, C., Daneman, R., Maniatis, T., Barres, B.A., Wu, J.Q., 2014. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929-11947.

Highlights - Mice with TNFR2 ablation in oligodendrocytes show accelerated microglia activation ahead of earlier EAE onset - TNFR2 modulates the immune-inflammatory function of oligodendrocytes in EAE - Oligodendrocytes, in concert with other glial cells, play a critical role in the early events driving CNS autoimmune disease