Optimizing the immunization procedure of single-walled carbon nanotubes based vaccine against grass carp reovirus for grass carp

Journal Pre-proof Optimizing the immunization procedure of single-walled carbon nanotubes based vaccine against grass carp reovirus for grass carp

De-Kui Qiu, Yi-Jun Jia, Yu-Ming Gong, Yu-Ying Zheng, GaoXue Wang, Bin Zhu PII:

S0044-8486(20)33858-8

DOI:

https://doi.org/10.1016/j.aquaculture.2020.736152

Reference:

AQUA 736152

To appear in:

aquaculture

Received date:

8 September 2020

Revised date:

1 November 2020

Accepted date:

10 November 2020

Please cite this article as: D.-K. Qiu, Y.-J. Jia, Y.-M. Gong, et al., Optimizing the immunization procedure of single-walled carbon nanotubes based vaccine against grass carp reovirus for grass carp, aquaculture (2020), https://doi.org/10.1016/ j.aquaculture.2020.736152

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof

Optimizing the immunization procedure of Single-walled carbon nanotubes SWCNTsbased vaccine against Grass Carp Reovirus for grass carp De-Kui Qiu, Yi-Jun Jia, Yu-Ming Gong, Yu-Ying Zheng, Gao-Xue Wang, Bin Zhu* College of Animal Science and Technology, Northwest A&F University, Xinong Road 22nd, Yangling,

of

Shaanxi 712100, China

ro

*College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China

China. Tel./fax: +86 29 87092102.

Jo ur

na

lP

re

E-mail address: [email protected] (B. Zhu)

-p

*Corresponding author at: Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100,

Journal Pre-proof

Abstract Hemorrhagic disease caused by grass carp reovirus (GCRV) is considered to be one of the most serious threats to grass carp, resulting in significant economic loss in grass carp culture industry. This study was aimed at optimizing the immunization program of SWCNTs-vaccine (SWCNTs-M-VP4-3) controlling infectious GCRV, and then determining the best immunization program for grass carp, and

of

then providing reference for the commercial promotion and use of vaccines in aquaculture. Grass carp

ro

was vaccinated by immersion, then We designed an compete experiment to optimize different parameters affecting vaccination such as immunization immune time of bath immunization, antigen

-p

immune concentration, and fish immune density when grass carp was vaccinated by bath treatment

re

immunized. Our results showed that the highest relative percent survival (88.33%) was found in 12 h of

lP

immunization immune time, 10 mg L-1 of antigen immune concentration, and 15 fish per liter of fish

na

immune density compared to 100% mortality for control groups. And other immune responses (serum antibody production, enzyme activities, and immune genes expression) also demonstrated similar

Jo ur

results. These results indicated that the administration protocol which induce highest immune response of the host, had the highest vaccine effect against the disease. This study lays the foundation for providing reference for the commercial promotion and use of vaccines in aquaculture. the best immunization program is 12 h; 10 mg L-1; 15 fish per liter which can provide the best immune protection against GCRV for grass carp. Keywords: Grass carp reovirus (GCRV); Single-walled carbon nanotubes (SWCNTs); Grass carp; Immunization program

Journal Pre-proof

1.Introduction Hemorrhagic disease caused by grass carp reovirus (GCRV) is considered to be one of the most serious threats to grass carp, resulting in significant economic loss in grass carp culture industry (Chen et al., 2019; Rao et al, 2015). However, grass carp is extremely sensitive to GCRV-II resulting in more than 80% mortality rate and obstacle in world intensive cultivation (Tian et al., 2013; Fang et al., 1989).

of

Prevention of GCRV-II infection is essential for the development of the grass carp industry (Wang et al.,

ro

2015).

Vaccine is the most effective method controlling infection diseases in aquaculture and is

-p

considered to be an essential route to the reduction in use of antibiotics within the aquaculture industry

re

(Zhu et al., 2020; Su et al., 2018). In the present studies, the VP4 oral vaccine was provided for the fish

lP

(23 ± 2 g, 11 ± 1 cm) whose result showed protection with relative percentage survival reached (RPS)

na

about 47% (Jiang et al., 2019). However, subunit vaccine was provided for the fish (25-30 g) via injection whose RPS reached 82% (Tian et al., 2013). In recent years, there have been a lot of

Jo ur

researches on screening more effective antigen protein. But little study has been done on optimization of different parameters affecting vaccination, such as immunization immune time and antigen immune concentration.

Antigen epitope screening can improve the effect of vaccination against for virus infection (Jechlinger et al., 2014; Zhu et al., 2019). Qiu and Zhu have manufactured the vaccine of GCRV-JX02 and the vaccine of spring viremia of carp virus by antigen epitope screening, whose RPS were 76.7% and 69.23% (Qiu et al., 2020; Zhu et al., 2019). Thus, this is a promising method to improve RPS for vaccines. Nanomaterials such as carbon nanotubes (CNTs), particularly the functionalized water-soluble CNTs have a wide range of promising applications in vaccine delivery and therapy

Journal Pre-proof

Besides, based on previous studies., Our laboratory’s researches showed SWCNTs may represent a potentially efficient subunit vaccine carrier against viral pathogens of fish (Zhu et al., 2014; Zhu et al., 2015; Zhao et al., 2019; Zhao et al., 2020),. SWCNTs may represent a potentially efficient subunit vaccine carrier against viral pathogens of fish and it will provide broad prospects for application to aquatic vaccine.

of

In the study, based on previous research in our lab (Qiu et al., 2020), we used functionalized

ro

SWCNTs loaded with mannose modification for VP4-3 subunit vaccine (SWCNTs-M-VP4-3). Then we designed an compete experiment to optimize different parameters affecting vaccination such as

-p

immunization immune time of bath immunization, antigen immune concentration, and fish immune

re

density through bath immunization. The aim of this study provides a helpful plan for the effective use

lP

of vaccine in fish farming industry. Therefore, this study was carried out to determine the optimum

na

immunization immune time of bath immunization, antigen immune concentration, and fish immune density when immunized for SWCNTs-M-VP4-3, in order to providing reference for the commercial

Jo ur

promotion and use of vaccines in aquaculture. 2.Materials and Methods 2.1. Virus and fish

The virus of GCRV-II (GCRV-JX02) was isolated by our laboratory. Grass carp were purchased from a fish farm in Guangzhou Tiger Aquatic Development Co., Ltd (Guangdong Province, China), with the length of 1.5 ± 0.5 cm and the weights of 1.0 ± 0.2 g. The fish were fed daily with the aquatic commercial feed which is manufactured by Guangdong Evergreen Feed Industry Co., Ltd. The pH of bering water is 8.0 ± 0.2, dissolved oxygen is 6.0 ± 1.0, temperature is maintained at 26.0 ± 0.5°C. Prior to the experiments, grass carp acclimated to the new environment for 2 weeks. They were

Journal Pre-proof

acclimatized for 2 weeks prior to the experiments and were negative for GCRV infection as tested PCR detection (Zhang et al., 2003). Care of animals was in compliance with the guidelines of the Animal Experiment Committee, Northwest A&F University. 2.2. preparation of vaccine The preparation of SWCNTs-M-VP4-3 subunit vaccine was based on our previous studies (Qiu et

of

al., 2020; Zhao et al., 2020). Briefly, Then, the purified VP4-3 protein and functionalized mannose

ro

were dispersed in 1000 mL boracic acid buffer solution (0.2 M, pH=7.4) and stirred for 24 h (indoor temperature) to obtain the mannose modification for VP4-3 protein (M-VP4-3). The M-VP4-3

-p

combined with the functionalized SWCNTs were mixed and stirred for 72 h (indoor temperature)

re

through the amidation reactions. Afterwards, about the 40% of the SWCNTs-vaccines were made up of

na

2.3. Vaccination

lP

the target protein authenticated by BCA (BCA Protein Assay Kit, Beijing ComWin Biotech Co., Ltd).

Healthy grass carp (n=5040) was vaccinated by bath treatment. During bath experiment,

Jo ur

disease-free grass carp which was acclimatized for 2 weeks, was randomly divided into 28 groups (27 treatment groups and control groups) (per group with three parallel treatments) based on previous study (Zhao et al., 2020). What’s more, 27 treatment groups are named as special symbols shown in Table.1. Briefly, antigen concentration 5 mg L-1 10 mg L-1 and 20 mg L-1 are denoted by A1, A2, and A3 respectively; Fish density 15 fish/L, 30 fish/L and 60 fish/L are denoted by B1, B2, and B3 respectively; Immunization time 6 h, 12 h and 24 h are denoted by C1, C2, and C3 respectively. Besides, treatment groups consisted of a minimum number of 60 fish and all fish in a treatment group were vaccinated together. [Table 1]

Journal Pre-proof

2.4. Measurement of specific antibody For analyses of the presence of specific antibodies, vaccinated and control fish (5 fish per group) were sampled weekly until up to 4 weeks post vaccination for antibody determination. Serum sample preparation and determination were according to previous method (Qiu et al., 2020; Yang et al., 2013). The supernatant was collected and stored at -20°C until use. Fish sample was diluted 1:1000

of

immediately and used as antibody before use with coating solution of ELISA. Plate were incubated

ro

with 1% bovine serum albumin (BSA) in PBS for 1 h at 37°C to block non-specific binding sites. Purified recombinant VP4-3 protein was used as antigen. Anti his-tag monoclonal antibody was used as

-p

primary antibody and HRP antibody conjugated as secondary antibody, diluted 1:2500 immediately

re

before use with PBS containing 5% skimmed milk, followed by color development using

na

microplate reader.

lP

tetramethylbenzidine, TMB as colorimetric substrate. The plate was read at 450 nm with a precision

2.5 Measurement of enzyme activity

Jo ur

Alternative complement activity was determined and calculated using the method of Sunyer and Tort (Sunyer et al., 1995) with modifications as described by Yeh et al. (Yeh et al., 2008). The superoxide dismutase (SOD), total anti-oxidation capacity (T-AOC), acid phosphatase (ACP) and alkaline phosphatase (AKP) activities were measured by using the assay Kits (JianCheng Bioengineering Institute, Nanjing, China). Details of the procedures were described earlier (Yeh et al., 2008). 2.6 qRT-PCR analysis of expression of immune genes Total RNA from grass carp kidney (21 d) were prepared by Trizol lysis according to the manufacture's protocol (Invitrogen, USA) as described previously. The expression of a set of immune

Journal Pre-proof

genes was determined using quantitative real-time PCR (qRT-PCR). 18s served as an internal reference gene to normalize the mRNA expression (Su et al., 2011). The primers (Qiu et al., 2020) for each gene are listed in Table.2. Real-time PCR protocol, conditions and cycling program are 95°C 1 min, 58°C 30 s and 72°C 30 s. All qRT-PCR reactions were performed for in triplicates, and the data for each sample were expressed relative to the expression level of 18s by using 2-ΔΔCt method (Livak et al., 2001).

of

[Table 2]

ro

2.7 Challenge

At 28 days post-vaccination, vaccinated fish and control groups were transferred to new tanks and

-p

challenged by being injected intramuscularly with 100 μL 4.0 × 10 6 TCID50 mL−1 of live GCRV (JX02)

re

in saline buffer, and then mortality rates were recorded daily over 15 days after challenge. Dead fish

lP

were collected daily, recorded, and examined for clinical signs of GCRV-II. The relative percentage

na

survival (RPS) was also calculated according to Amend's method (Amend, 1981). Relative percentage survival (RPS) = 1 - [% mortality rate (vaccinated fish)/% mortality rate (control fish)] × 100.

Jo ur

2.8. Statistical analysis

All statistical analyses were performed using SPSS 15.0 software (SPSS Inc., USA). Differences in antibody titers, and transcription levels of the immune genes were analyzed with one-way analysis of variance; differences in mortality were determined with Chi-square test. In all cases, the differences were considered significant at P < 0.05. 3.Results 3.1. Serum antibody production To compare the humoral immune response elicited by control groups and treatment groups, we also evaluated the specific antibodies of sera samples obtained from vaccinated fish during 1-4 weeks

Journal Pre-proof

post-initiation vaccination by ELISA. In Fig.1, it is shown that the antibody level increased with antigen vaccine concentration and the prolongation of immunization time, the antibody peaked at 21 d post-initiation vaccination for each group and declined thereafter. Meanwhile, the highest levels of antibody can be found in A2B1C2 (group M, 12 h, 10 mg L-1, 15 fish per liter). Consequently, when the antigen vaccine concentration and fish immunization density are constant, the longer the

of

immunization time, the higher the serum antibody titer; When the antigen vaccine concentration and

ro

immunization time are constant, the lower the fish immunization density, the higher the serum antibody titer; However, When the fish immunization density and immunization time are constant, the higher the

-p

antigen vaccine concentration, the serum antibody titer has no significant difference.

re

[Fig.1]

lP

3.2. Immune response induced by vaccine

na

ACP, AKP, T-AOC and SOD activity assay in different treatment groups and control groups are shown in Fig.2. The results showed that all immune parameters in vaccinated groups were significantly

Jo ur

higher than those in the control groups and the peak value was also found in A2B1C2 (group M, 12 h, 10 mg L-1, 15 fish per liter).

[Fig.2]

3.3. Immune genes expression The qRT-PCR analysis of the transcription were used to examine the effect of vaccination on the expression of immune genes encoding immunoglobulin M (IgM), tumor necrosis factor α (TNF-α), type I interferon (I-IFN), cluster of differentiation 8α (CD8α). The results showed that all genes also presented tendency of up-regulation. Some of the genes significantly exhibited the trend of enhance (Fig.3, 5-13 folds) in vaccinated fish compared with control groups. There was no difference between

Journal Pre-proof

the different constructs used. In addition, the highest expression levels of all examined genes were also obtained in group A2B1C2 (group M, 12 h, 10 mg L-1, 15 fish per liter). [Fig.3] 3.4. Protection of vaccinated fish For control groups, the mortalities were first observed at 3-day after challenge and the RPS were observed at 0% at 10 days after challenge. With the change of immunization immune time (6 h, 12 h,

ro

of

24 h), antigen immune concentration (5 mg L-1, 10 mg L-1, 20 mg L-1), and fish immune density (15 fish per liter, 30 fish per liter, 60 fish per liter), the RPS of immune groups were shown in Table.3 and

-p

Fig.4. The highest RPS (88.33%) occurred in group A2B1C2 (group M) with 12 h, 10 mg L-1, 15 fish

re

per liter. Obviously, effects of immunization immune and fish immune density are directly related to

4.Discussion

Jo ur

na

and immune genes expression).

lP

RPS. The result of RPS is consistent with other results (serum antibody production, enzyme activities,

[Fig.4] [Table.3]

Vaccination is considered as an optimal method of protecting aquaculture animals from diseases and reducing losses in aquaculture (Li et al., 2015; Wang et al., 2016; Valero et al., 2016; Zhu et al., 2017; Yang et al., 2016; Zhang et al., 2018; Rao et al., 2015). Grass Carp Reovirus (GCRV) still restrict the development of aquaculture, especially grass carp, leading to huge economic losses to culturist. The highest mortality mainly occurs at the larval stage, it is important to vaccinate as early as possible. In order to increase the immune effect of vaccine, more and more researchers chose the method of antigen epitope screening to improve immune effect and reduce cost of vaccine production

Journal Pre-proof

(Li et al., 2016; Lee et al., 2017; Huang et al., 2019; Mou et al., 2014; Qiu et al., 2020; Zhu et al., 2019). But there are few studies looking at the optimization of different parameters affecting vaccination, such as using different fish immune of the vaccine to immunize the fish for different immunization immune time which what will happen to the immune effect of vaccine. In this study, we used functionalized SWCNTs loaded with mannose modification for VP4-3

of

subunit vaccine (SWCNTs-M-VP4-3). The challenge test showed that the treatment grass carp had a

ro

lower percentage of mortality rates in comparison with control groups. Then we designed an compete experiment to optimize different parameters affecting vaccination and A2B1C2 (group M, 12 h, 10 mg

-p

L-1, 15 fish per liter) gives gave the highest RPS of 88.33%. These findings are corroborated by

re

specific serum antibodies. In addition, the antibody levels in A2B1C2 group, giving the highest RPS,

lP

were higher than other groups (Fig.4; Table.3). Meanwhile, the specific antibody response was

na

significantly increases and persists up to 4 weeks of post immunization (Fig.1). These results revealed that when the immunization immune time and antigen immune concentration are constant, the lower

Jo ur

the fish immune density, the higher the serum antibody response and RPS. Obviously, the lower the fish immune density, the immunized fish can get more vaccines in each unit, so the immune response to the fish is stronger. What’s more, the lower the fish immune density, it was not responding to hypoxia for fish. When the fish immune density and antigen immune concentration are constant, the longer the immunization immune time, the higher the serum antibody response and RPS, which was attributed to SWCNTs could load with mannose modification for subunit vaccine to enter the fish body repeatedly and stimulate the fish body to produce an immune response continuously after long immunization immune time. But, immune responses of 24 h were lower comparison to immune responses of 12 h because longer immunization immune time could lead to hypoxia and stress response

Journal Pre-proof

for fish. However, when the fish immune density and immunization immune time are constant, with the increase in antigen immune concentration, the immune response did not increase significantly. The results shown the similar results compared to others’ studies (Zhao et al., 2020). According to the above results, fish immune density had the greatest effect on the immune response of vaccine, followed by immunization immune time.

of

This study found that immune parameters, e.g., SOD activity, and ACP assay were significantly

ro

increased after vaccination. Subsequently, the ACP activities, SOD activities, AKP activities, T-AOC activities were examined (2.4-8.3 folds, Fig.2). AKP and ACP has long been used as an important

-p

indicator the ability of macrophage activation to intracellularly digest antigens engulfed in the

re

vertebrate immune system (Hao et al., 2017; Hao et al., 2018). SOD can eliminate superoxide radicals

lP

which is an important antioxidant enzyme and reduces intracellular oxidative stress levels (Aytekin et

na

al., 2017). The total anti-oxidation capacity is an important factor for initiating the host immune response by inducing innate immunity and regulating acquired immunity (Wang et al., 2015). Some

Jo ur

immune-related genes (TNF-α, I-IFN, CD8α and IgM) expression were also examined (5-13 folds, Fig.3). The TNF-α is one of the main pro-inflammatory cytokines produced in response to a broad type of bacterial, viral and fungal infections, and has plays a crucial role in activating and orchestrating the immune response in order to protect the host organism from pathogens (Grasso et al., 2015). The IgM expression was increased significantly in the kidney of vaccinated fish. Some investigators have reported that the IgM expression would be intensively increase in many tissues and organs from the second week after immunization and maintained almost one month, which as corresponding with our findings (Tian et al., 2009). 5.Conclusion

Journal Pre-proof

In summary, our results indicated that the administration protocol which induce highest immune response of the host, had the highest vaccine effect against the disease. This study lays the foundation for providing reference for the commercial promotion and use of vaccines in aquaculture. the best immunization program is 12 h, 10 mg L-1 and 15 fish per liter which can provide the best immune protection against GCRV for grass carp. This study lays the foundation for following up vaccine

of

development against grass carp reovirus infection.

ro

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Program No.

-p

31602204), the Excellent Young Talents Program of Northwest A&F University (2452018029), and

re

the Special Funds for Talents in Northwest A & F University to B. Zhu (Program No. Z111021510).

lP

Reference

na

Amend, D.F., 1981. Potency testing of fish vaccines. Dev. Biol. Stand 49, 447-454. Aytekin, T., Kargın, F., Çoğun, H.Y., 2017. The effect of copper on superoxide dismutase (SOD)

Jo ur

activity in tissues of Nile fish (Oreochromis niloticus). Toxicology Letters, 280, S315. Chen, D.D., Yao, Y.Y., Cui, Z.W., Zhang, X.Y., Guo, X.Z., Zhou, Y.Y., 2019. Comparative study of the immunoprotective effect of two grass carp-sourced Bacillus subtilis spore-based vaccines against grass carp reovirus. Aquaculture 504, 88-95. Fang, Q., Ke, L.H., Cai, Y.Q., 1989. Growth characteristics and high titer culture of grass carp hemorrhage virus (GCHV)-873 in vitro. Virologica Sinica. 4(3), 315. Grasso, V., Padilla, D., Bravo, J., Román, L., Rosario, I., Acosta, B., Vega, B., El Aamri, F., Escuela, O., Ramos-Vivas, J., 2015. Immunization of sea bream (Sparus aurata) juveniles against Photobacterium damselae subsp. piscicida by short bath: effect on some pro-inflammatory

Journal Pre-proof

molecules and the Mx gene expression. Fish Shellfish Immunol. 46, 292–296. Hao, K., Chen, X.H., Qi, X.Z., Yu, X.B., Du, E.Q., Ling, F., Zhu, B., Wang, G.X., 2017. Protective immunity of grass carp induced by DNA vaccine encoding capsid protein gene (vp7) of grass carp reovirus using bacterial ghost as delivery vehicles. Fish and shellfish Immunol. 64, 414-425. Hao. K., Chen, X.H., Qi, X.Z., Zhu, B., Wang, G.X., Ling, F., 2018. Display of GCRV vp7 protein on

of

the surface of Escherichia coli and its immunoprotective effects in grass carp (Ctenopharyngodon

ro

idella). Fish and shellfish Immunol. 72, 199-209.

Huang, Y., Wang, B., Peng, Z., Tang, N., Chen, W.X., 2019. Hepatitis B virus surface gene mutants in

-p

immunoprophylaxis-failed infants from Southern China. J. Med. Virol. 91 (6), 1069-1075.

re

Jechlinger, W., 2014. Optimization and delivery of plasmid DNA for vaccination. Expert Rev.

lP

Vaccines 5, 803–825.

na

Jiang, H.Y., Bian, Q., Zeng, W.W., Ren, P.L., Sun, H.C., Lin, Z.P., 2019. Oral delivery of Bacillus subtilis spores expressing grass carp reovirus vp4 protein produces protection against grass carp

Jo ur

reovirus infection. Fish Shellfish Immunol. 84, 768-780. Lee, S.W., Wu, C.K., Plieskatt, J.L., Miura, K., Hickey, J.M., King, C.R., 2017. N-terminal Pfs230 domain produced in baculovirus as a biological active transmission-blocking vaccine candidate. Clin. Vaccine Immunol. 24 (10), e00140-17. Li, X.J., Gao, Y., Zhang, W.Q., Zhang, C., 2015. Screening and identification of antigen epitope of hB7- H4 recognized by monoclonal antibody with 12 phage display peptide library. Letters In Biotech. 26 (4), 505-509. Li, T.T., Xiu, B.B., Guo, X.D., Zhang, G.R., 2016. Screening and identification of immunodominant epitope of human serum albumin. J. Int. Pharm Res. 43 (5), 1002-1007.

Journal Pre-proof Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) method. Methods 25 (4), 402-408. Mou, H., Gao, M.X., Pan, J.R., Zhi, Y.X., Zhao, J., Liu, C.C., 2014. Selection and Identification of Critical Amino Acids in Epitope 187-202 of Pen a1. Scientia Agricultura Sinica. 47 (9), 1793-1801.

of

Qiu, D.K., Zhao, Z., Ma, R., Guo, Z.R., Jia, Y.J., Zhang, C., Wang, G.X., Zhu, B., 2020. Antigen

ro

epitope screening of Grass Carp Reovirus and its protectively immunity assessment for grass carp. Aquaculture 515.

-p

Rao, Y.L., Su, J.G., 2015. Insights into the antiviral immunity against grass carp (Ctenopharyngodon

re

idella) reovirus (GCRV) in grass carp. Journal of Immunology Research 2015, 670437.

lP

Su, J.G., Zhang, R.F., Dong, J., Yang, C.R., 2011. Evaluation of internal control genes for qRT-PCR

na

normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 30 (3), 830-835.

84-95.

Jo ur

Su, H., Su, J.G., 2018. Cyprinid viral diseases and vaccine development. Fish Shellfish Immunol. 83,

Sunyer, J.O., Tort, L., 1995. Natural hemolytic and bactericidal activities of sea bream sparus aurata serum are effected by the alternative complement pathway. Vet. Immunol. Immunopathol. 45 (3-4), 333-345. Tian, J.Y., Sun, B.J., Luo, Y.P., Zhang, Y.G., Nie, P., 2009. Distribution of IgM, IgD and IgZ in Mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation. Aquaculture 288, 14–21.

Journal Pre-proof

Tian, Y.Y., Ye, X., Zhang, L.L., Deng, G.C., Bai, Y.Q., 2013. Development of a novel candidate subunit vaccine against Grass carp reovirus Guangdong strain (GCRV-GD108). Fish Shellfish Immunol. 35 (2), 351-356. Valero, Y., Awad, E., Buonocore, F., Arizcun, M., Esteban, M.Á., Meseguer, J., 2016. An oral chitosan DNA vaccine against nodavirus improves transcription of cell-mediated cytotoxicity and

of

interferon genes in the European sea bass juveniles gut and survival upon infection. Dev. Comp.

ro

Immunol. 65, 64-72.

Wang, B.W., Chen, M.L., Wang, B.H., Zhang, M.A., GE, W.H., Cheng, F.S., 2015. Effects of dietary

-p

zinc on immunity, antioxidant capacity and MT-I mRNA gene expression level and their factor

re

correlation analysis of 5-15 weeks old goose. Scientia Agricultura Sinica. 48 (9), 1825-1835.

lP

Wang, R.H., Xiao, T.Y., Zeng, L.B., Liu, X.Y., Zhou, Y., Ma, J., 2016. Generation and use of

456, 9-15.

na

Edwardsiella ictaluri, ghosts as a vaccine against enteric septicemia of catfish (ESC). Aquaculture

Jo ur

Wang, Y., Liu, G.L., Li, D.L., Ling, F., Zhu, B., Wang, G. X., 2015. The protective immunity against grass carp reovirus in grass carp induced by a DNA vaccination using single walled carbon nanotubes as delivery vehicles. Fish Shellfish Immunol. 47 (2), 732-742. Yang, D., Liu, Q., Ni, C., Li, S., Wu, H., Wang, Q., 2013. Gene expression profiling in live attenuated Edwardsiella tarda vaccine immunized and challenged zebrafish: insights into the basic mechanisms of protection seen in immunized fish. Dev. Comp. Immunolo. 40 (2), 132-141. Yang, Q., Pan, Y.L., Wang, K.Y., Wang, J., He, Y., Wang, E.L., 2016. OmpN, outer membrane proteins of Edwardsiella ictaluri are potential vaccine candidates for channel catfish (Ictalurus punctatus). Mol. Immunol. 78, 1-8.

Journal Pre-proof

Yeh, S.P., Chang, C.A., Chang, C.Y., Liu, C.H., Cheng, W., 2008. Dietary sodium alginate administration affects fingerling growth and resistance to streptococcus sp. and iridovirus, and juvenile non-specific immune responses of the orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol. 25 (1-2), 19-27. Zhang, C., Zhao, Z., Gao, G.Y., Li, J., Wang, G.X., Zhu, B., 2018. Immune response and protective

of

effect against spring viremia of carp virus induced by intramuscular vaccination with a

ro

SWCNTs-DNA vaccine encoding matrix protein. Fish Shellfish Immunol. 79, 256–264. Zhang, Q. Y., 2003. Detection of grass carp hemorrhage virus (GCHV) from vietnam and comparison

-p

with GCHV strain from China. High Technology Letters 9 (2), 7-13.

re

Zhao, Z., Xiong, Y., Zhang, C., Jia, Y.J., Qiu, D.K., Wang, G.X., Zhu, B., 2020. Optimization of the

lP

efficacy of a SWCNTs-based subunit vaccine against infectious spleen and kidney necrosis virus

na

in mandarin fish. Fish and Shellfish Immunol. 106, 190-196. Zhao, Z., Zhang, C., Jia, Y.J., Qiu, D.K., Lin, Q., Li, N., Huang, Z.B., Fu, X.Z., Wang, G.X., Zhu, B.,

Jo ur

2019. Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine. Fish and Shellfish Immunol. 92, 133-140.

Zhu, B., Liu, G.L., Gong, Y.X., Ling, F., Song, L.S., Wang, G.X., 2014. Single-walled carbon nanotubes as candidate recombinant subunit vaccine carrier for immunization of grass carp against grass carp reovirus. Fish Shellfish Immunol. 41 (2), 279-293. Zhu, B., Liu, G.L., Gong, Y.X., Ling, F., Song, L.S., Wang, G.X., 2015. Protective immunity of grass carp immunized with DNA vaccine encoding the vp7 gene of grass carp reovirus using carbon nanotubes as a carrier molecule. Fish Shellfish Immunol. 42, 325-334.

Journal Pre-proof

Zhu, B., Zhang, C., Yang, B., Guo, Z.R., Zheng, Y.Y., Gong, Y.M., Wang, G.X., 2019. Preliminary screening and immunogenicity analysis of antigenic epitopes of spring viremia of carp virus. Fish and Shellfish Immunol. 94, 833-841. Zhu, B., Zhang, C., Zhao, Z., Wang, G.X., 2020. Targeted delivery of mannosylated nanoparticles improve prophylactic efficacy of immersion vaccine against fish viral disease. Vaccines 8, 87.

of

Zhu, L., Yang, Q., Huang, L., Wang, K., Wang, X., Chen, D., 2017. Effectivity of oral recombinant

Jo ur

na

lP

re

-p

ro

DNA vaccine against Streptococcus agalactiae in Nile tilapia. Dev. Comp. Immunol. 77, 77-87.

Journal Pre-proof Figure captions Fig. 1. The levels of serum antibody in the vaccinated grass carp. Serum was collected from the fish at (A) 7, (B) 14, (C) 21 and (D) 28 d post-vaccination, and serum antibodies against recombinant VP4-3 was determined by ELISA. Three replicates were set for the tests, with three fish per replicate. Data are means for three assays and presented as the means ± SE.

of

**P < 0.01; *P < 0.05.

ro

Fig. 2. Changes of immune parameters in the vaccinated grass carp: (A) ACP activities; (B)

-p

AKP activities; (C) T-AOC and (D) SOD activities. Data are represented as mean ± SE. ** P <

lP

re

0.01; *P < 0.05. Three replicates were set for the tests, with three fish per replicate.

na

Fig. 3. qRT-PCR analysis of the expression of immune genes in grass carp vaccinated with different vaccine formulations. Samples were collected from the fish at 21 d post-vaccination.

Jo ur

Data are means for three assays and presented as the means ± SE. Values that were significantly different from the control which are indicated by asterisks (one-way ANOVA, **P <

0.01; *P < 0.05).

Fig. 4. The relative percentage survival of vaccinated fish. Grass carp were vaccinated and then challenged with GCRV compared with the control groups.

Journal Pre-proof Table. 1 Immune program

15 fish/L (B1)

30 fish/L (B2)

60 fish/L (B3)

C

D

K

G

L

M

N

O

P

A2B1C3 A2B2C3 A2B3C3

U

V

W

X

-p re lP na

H

I

A3B1C2 A3B2C2 A3B3C2 Q

R

A3B1C3 A3B2C3 A3B3C3

ro

T

F

A2B1C2 A2B2C2 A2B3C2

A1B1C3 A1B2C3 A1B3C3 S

E

A3B1C1 A3B2C1 A3B3C1

Y

of

B

A2B1C1 A2B2C1 A2B3C1

A1B1C2 A1B2C2 A1B3C2 J

24 h (C3)

20 mg L-1 (A3)

A1B1C1 A1B2C1 A1B3C1 A

12 h (C2)

10 mg L-1 (A2)

Jo ur

6 h (C1)

5 mg L-1 (A1)

Z

1

Journal Pre-proof Table 1 Primers used for the analysis of mRNA expression by qRT-PCR Accession no.

18s

EU047719

IgM

DQ417927

TNF-α

EU047718

I-IFN

AB196166

CD8α

GQ355586

Primer sequences (from 5’ to 3’) Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

ATTTCCGACACGGAGAGG CATGGGTTTAGGATACGCTC TCCTGCGGTGTGCGACTCAAAAC GCTGAGGCATCGGAGGCACAT TGTGCCGCCGCTGTCTGCTTCACGCT GATGAGGAAAGACACCTGGCTGTAGA GGTGAAGTTTCTTGCCCTGACCTTAG CCTTATGTGATGGCTGGTATCGGG GAGTCTCTGCACGGATCTAT GTGTAGTGTTCCGAATTTAAGT

Jo ur

na

lP

re

-p

ro

of

Genes

Product size (bp) 90 170 291 173 172

Journal Pre-proof Table 2 Relative percentage survival (RPS) of fish challenged with GCRV-II Group

RPS (15 d)

PBS

0% 61.67% ± 1.18%

A1B2C1 (B)

50.00% ± 2.04%

A1B3C1 (C)

42.98% ± 2.48%

A2B1C1 (D)

57.50% ± 2.04%

A2B2C1 (E)

49.17% ± 1.24%

A2B3C1 (F)

46.49% ± 1.18%

A3B1C1 (G)

60.83% ± 1.18%

A3B2C1 (H)

58.33% ± 1.18%

A3B3C1 (I)

55.00% ± 2.04%

of

A1B1C1 (A)

A1B1C2 (J)

ro

A1B2C2 (K) A1B3C2 (L) A2B1C2 (M)

-p

A2B2C2 (N) A2B3C2 (O)

re

A3B1C2 (P) A3B2C2 (Q)

A1B3C3 (U) A2B1C3 (V) A2B2C3 (W) A2B3C3 (X) A3B1C3 (Y) A3B2C3 (Z) A3B3C3 (1)

na

A1B2C3 (T)

Jo ur

A1B1C3 (S)

lP

A3B3C2 (R)

Values are expressed as mean ± S.D; three replicates were included.

75.00% ± 2.04% 69.17% ± 1.18% 68.33% ± 1.18% 88.33% ± 2.36% 75.83% ± 1.18% 70.00% ± 2.04% 72.50% ± 2.04% 74.17% ± 1.18% 62.50% ± 2.04% 79.17% ± 1.18% 59.65% ± 1.24% 50.83% ± 2.36% 71.67% ± 3.12% 66.67% ± 1.18% 65.83% ± 3.12% 73.33% ± 1.18% 58.77% ± 1.24% 58.56% ± 1.27%

Journal Pre-proof Highlights ► These results revealed that fish immune density had the greatest effect on the immune response of SWCNTs-M-VP4-3 vaccine, followed by immunization immune time. ► The optimum immunization time immune duration, antigen concentration immune dose, and fish immune density SWCNTs-M-VP4-3 were 12 h, 10 mg L-1 and 15 fish per liter for grass carp.

of

► The vaccine was manufactured by the core of dominant antigen epitope of GCRV-JX02

ro

connecting with functionalized mannose and SWCNTs, and its protective effects on grass carp

Jo ur

na

lP

re

-p

against GCRV-JX02 infection by bath treatment were assessment.

Journal Pre-proof Author Statement De-Kui Qiu: performing the experiments Gao-Xue Wang: provide experimental materials; oversight for the research activity execution.

Jo ur

na

lP

re

-p

ro

of

Bin Zhu: formulation or evolution of overarching research goals and aims.

Journal Pre-proof Dear Editors: We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of the manuscript entitled. Best Regards! De-Kui Qiu, Xue-Gao Wang, Bin Zhu. College of Animal Science and Technology, Northwest A&F University, Yangling, 712100.

of

Shaanxi, China.

Jo ur

na

lP

re

-p

ro

E-mail address: [email protected] (G.-X. Wang); [email protected] (B. Zhu).