ORAI1 deficiency and lack of store-operated Ca2+ entry cause immunodeficiency, myopathy, and ectodermal dysplasia

ORAI1 deficiency and lack of store-operated Ca21 entry cause immunodeficiency, myopathy, and ectodermal dysplasia € ther,b Christie-Ann McCarl, BS,a,b* Capucine Picard, MD, PhD,c,f,g* Sara Khalil, BS,a* Takumi Kawasaki, PhD,a Jens Ro a h d,i c,d,j Alexander Papolos, BS, Jeffery Kutok, MD, Claire Hivroz, PhD, Francoise LeDeist, MD, PhD, Katrin Plogmann, DMD,k Stephan Ehl, MD,l Gundula Notheis, MD,n Michael H. Albert, MD,o Bernd H. Belohradsky, MD,n Janbernd Kirschner, MD,m Anjana Rao, PhD,b** Alain Fischer, MD,d,e,g** and Stefan Feske, MDa,b New York, NY, Boston, Mass, Paris, France, Montreal, Quebec, Canada, and Freiburg and Munich, Germany Background: Defects in the development or activation of T cells result in immunodeficiency associated with severe infections early in life. T-cell activation requires Ca21 influx through Ca21-release activated Ca21 (CRAC) channels encoded by the gene ORAI1. Objective: Investigation of the genetic causes and the clinical phenotype of immunodeficiency in patients with impaired Ca21 influx and CRAC channel function. Methods: DNA sequence analysis for mutations in the genes ORAI1, ORAI2, ORAI3, and stromal interaction molecule (STIM) 1 and 2, as well as mRNA and protein expression analysis of ORAI1 in immunodeficient patients. Immunohistochemical analysis of ORAI1 tissue distribution in healthy human donors. Results: We identified mutations in ORAI1 in patients from 2 unrelated families. One patient is homozygous for a frameshift nonsense mutation in ORAI1 (ORAI1-A88SfsX25), and a second patient is compound heterozygous for 2 missense mutations in ORAI1 (ORAI1-A103E/L194P). All 3 mutations abolish ORAI1 expression and impair Ca21 influx and CRAC channel function. The clinical syndrome associated with ORAI1 deficiency is characterized by immunodeficiency with a defect in the function but not in the development of lymphocytes, congenital myopathy, and anhydrotic ectodermal dysplasia with a defect in dental enamel calcification. In contrast with the limited clinical phenotype, we found ORAI1 protein expression in a wide variety of cell types and organs. Conclusion: Ca21 influx through ORAI1 is crucial for lymphocyte function in vivo. Despite almost ubiquitous ORAI1 expression, the channel has a nonredundant role in only a few

From athe Department of Pathology, New York University, Langone Medical Center; bthe Department of Pathology, Harvard Medical School, Program in Cellular and Molecular Medicine, ChildrenÕs Hospital Boston, and Immune Disease Institute; cthe Study Center of Primary Immunodeficiencies, Assistance Publique-Hoˆpitaux de Paris, dINSERM U768, and ethe Pediatric Hematology-Immunology Unit, Necker-Enfants Malades Hospital, Paris; fHuman Genetics of Infectious Disease INSERM U550, Necker Faculty, Paris; gParis Descartes University; hthe Department of Pathology, Brigham and WomenÕs Hospital, Boston; iINSERM U653 Curie Institut, Paris; jDe´partement de Microbiologie et dÕImmunologie et centre de recherche, Centre Hospitalier Universitaire Sainte-Justine, Universite´ de Montre´al; kthe Department of Operative Dentistry and Periodontology and lthe Center of Chronic Immunodeficiency and mthe Department of Neuropediatrics and Muscle Disorders, University of Freiburg; nthe Department of Infection and Immunity and othe Department of Pediatric Hematology/ Oncology, Dr von Haunersches Kinderspital, Ludwig-Maximilians-Universita¨t, Munich. *These authors contributed equally to this work. **These authors contributed equally to this work. Supported by National Institutes of Health grants (S.F., A.R.), a March of Dimes Foundation grant (S.F.), and an INSERM grant (A.F.).

cell types judging from the limited clinical phenotype in ORAI1-deficient patients. (J Allergy Clin Immunol 2009;124:1311-8.) Key words: ORAI1, STIM1, CRAC, calcium channel, Ca21, storeoperated Ca21 entry, T cells, immunodeficiency, signal transduction, congenital myopathy, anhydrotic ectodermal dysplasia, dental enamel, amelogenesis imperfecta

Severe combined immunodeficiency (SCID) is characterized by the absence or significant functional impairment of T, B, and/ or natural killer (NK) cells.1,2 Lymphocyte activation follows immunoreceptor engagement, which results in Ca21 signaling, proliferation, and cytokine gene expression.3 In T cells, Ca21 influx occurs after activation of phospholipase C g1 and release of Ca21 from intracellular endoplasmic reticulum (ER) stores. Release of stored Ca21 results in a transient increase in [Ca21]i and subsequently activation of the Ca21 release activated Ca21 (CRAC) channel in the plasma membrane.4 The Ca21 influx resulting from CRAC channel activation is called store-operated Ca21 entry (SOCE) because it depends on the depletion of ER Ca21 stores. The CRAC channel constitutes the major Ca21 influx channel in T cells and is encoded by ORAI1,3,4 a tetraspanning plasmamembrane protein that is structurally unrelated to other ion channels except its 2 paralogs ORAI2 and ORAI3. ORAI1 functions as the pore forming subunit of the CRAC channel.5-7 A missense mutation in ORAI1 (R91W) abolishes ORAI1 and CRAC channel function and causes SCID characterized by a severe defect in

Disclosure of potential conflict of interest: T. Kawasaki receives research support through the Uehara Postdoctoral Fellowship. J. Kirschner has received research support from the Muscular Dystrophy Network and the TREAT-NMD Network. A. Rao is a founder and advisor of CalciMedica and has received research support from the National Institutes of Health, JDRF, and GlaxoSmithKline. A. Fischer is a contractor for INSERM, the French National Research Agency, and the European Community. S. Feske is a founder and advisor of CalciMedica and has received research support from the National Institutes of Health/National Institute of Allergy and Infectious Diseases, the March of Dimes Foundation, and the Charles Hood Foundation. The rest of the authors have declared that they have no conflict of interest. Received for publication August 17, 2009; revised October 8, 2009; accepted for publication October 9, 2009. Reprint requests: Stefan Feske, MD, Department of Pathology, New York University Langone Medical Center, 550 First Avenue, New York, NY 10016. E-mail: [email protected]. 0091-6749/$36.00 Ó 2009 American Academy of Allergy, Asthma & Immunology. doi:10.1016/j.jaci.2009.10.007

1311

1312 MCCARL ET AL

Abbreviations used CRAC: Ca21 release activated Ca21 EDA: Ectodermal dysplasia with anhydrosis HSCT: Hematopoietic stem cell transplantation NK: Natural killer SCID: Severe combined immunodeficiency SNP: Single nucleotide polymorphism SOCE: Store-operated Ca21 entry STIM: Stromal interaction molecule

T-cell activation.8,9 ORAI1-CRAC channels are activated by the ER protein stromal interaction molecule (STIM)–1, which senses the ER Ca21 concentration and, on release of Ca21 from ER stores, multimerizes and binds to ORAI1.4 Lack of STIM1 expression in human patients because of a frameshift nonsense mutation in STIM1 severely impairs SOCE and causes immunodeficiency and autoimmunity associated with myopathy and abnormal enamel dentition.10 In addition to patients with ORAI1-R91W mutation and lack of STIM1 expression,8,10 defects in SOCE and CRAC channel function have been described in patients from 2 kindreds in which the underlying gene defect remained undefined.11,12 We here report 3 new mutations in ORAI1 in patients from 2 of the original kindreds that abolish ORAI1 protein expression and SOCE.11,12 These ORAI1 mutations and those in ORAI1 and STIM1 reported before8,10 collectively define the clinical phenotype associated with defects in CRAC channel function.

METHODS Case reports Case reports of patients P1 to P6 have been published.11-15 Follow-up data on all patients and clinical descriptions are provided in Table I, and Table E1 and Fig E1 in this article’s Methods in the Online Repository at www.jacionlinie.org.

Cells Simian virus (SV)-40-transformed fibroblasts from patients P4 and P6 and a healthy control and Ficoll-Paque (GE Healthcare, Piscataway, NJ)–isolated PBMCs from patient P6’s parents and controls were grown in RPMI 1640 (Mediatech, Manassas, Va).

Plasmids and transfections Internal ribsome entry site (IRES) green fluorescent protein (GFP)– containing bicistronic vectors for expression of myc-epitope tagged ORAI1, ORAI2, ORAI3, and STIM1 have been described.8,16 ORAI1 A88SfsX25, A103E, and L194P mutant plasmids were generated by overlap mutagenesis and used for retroviral transduction as described.8 Transduction efficiencies were evaluated by GFP expression and immunoblotting using anti-myc antibody (clone 9E10; Santa Cruz Biotechnology, Santa Cruz, Calif).

Genomic DNA sequencing Genomic DNA was isolated from cells by using standard methods. PCR was conducted by using primers flanking exons and splice sites of ORAI1, ORAI2, ORAI3, STIM1, and STIM2 (see this article’s Table E2 in the Online Repository at www.jacionline.org). PCR products were sequenced directly (Genewiz Inc, South Plainfield, NJ). Sequence alignments were performed by using TCoffee software (Swiss Institute of Bioinformatics, http://tcoffee. vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cgi) and sequence traces visualized by using Xplorer software v1.0 (dnaTools, Ft. Collins, Colo). Single

J ALLERGY CLIN IMMUNOL DECEMBER 2009

nucleotide polymorphism (SNP) searches were performed by using the dbSNP database (build 129; http://www.ncbi.nlm.nih.gov/SNP/).

Immunohistochemistry and antibodies For detection of ORAI1 in patient fibroblasts, cell pellets were fixed in 3% phosphate-buffered paraformaldehyde; permeabilized with 1x PBS, 0.5% Nonidet P-40, and 0.02% sodium azide; and incubated with affinity-purified anti-ORAI1 antibodies raised against aa 275-291 of human ORAI1. For immunofluorescence, a muscle biopsy sample of patient P2 was coincubated with antibodies to ORAI1 and myosin heavy-chain fast (MHCf; clone WBMHCf; Novocastra, Newcastle upon Tyne, United Kingdom) at 1:50 dilution; MHCf was detected by Alexa Fluor 488 goat anti-mouse IgG staining (Invitrogen, Carlsbad, Calif). For detection of ORAI1 in tissues from healthy donors, 5-mm sections of paraffin-embedded normal human tissue microarrays (FDA 801; US Biomax Inc, Rockville, Md) were incubated with anti-ORAI1 antibodies and prepared as described.17

Muscle biopsy A biopsy of patient P2’s vastus lateralis muscle was frozen in isopentane cooled in liquid nitrogen, and 10-mm cryostat sections were stained with standard histologic and histochemical techniques.18

Ca21 measurements Single-cell Ca21 imaging was performed as described.9 Traces in figures represent the mean [Ca21]i of 1 representative experiment; ;30 to 80 GFP1 cells per experiment were analyzed. Error bars represent SEMs. See additional Methods in the Online Repository.

RESULTS Homozygous A88SfsX25 ORAI1 frameshift nonsense mutation abolishes ORAI1 expression Ca21 influx and CRAC channel currents were reported to be undetectable in T cells from immunodeficient patient P4, resulting in severely impaired T-cell activation (see this article’s Table E1 in the Online Repository at www.jacionline.org).12 Genomic DNA sequence analysis revealed that patient P4 is homozygous for a nonsense mutation in exon 1 of ORAI1, resulting from the insertion of a single adenine between positions 258 and 259 (258-259insA) of the ORAI1 coding sequence (NM_32790; Fig 1, A). The mutation is not a known SNP and was not observed in 2 healthy siblings of patient P4 (B-V-4 and B-V-5 in this article’s Fig E1 in the Online Repository at www.jacionline.org) and DNA from 50 control individuals (100 chromosomes). DNA from his parents and his older brother (patient P3) was not available for analysis. The insertion causes a frame shift starting at amino acid residue 88 and premature termination at position 112 of ORAI1 protein (ORAI1-A88SfsX25) at the end of the first transmembrane domain (Fig 1, A). No mutations in ORAI2, ORAI3, STIM1, and STIM2 were found in patient P4. Northern blot analysis showed that ORAI1 mRNA transcripts were undetectable in patient P4 compared with cells from a healthy control (Fig 1, B), most likely because of nonsense-mediated mRNA decay. Fibroblasts from patient P4 also showed strongly reduced ORAI1 protein expression when cells were analyzed by immunohistochemistry using an anti-ORAI1 antibody (Fig 1, C). Because the antibody is directed against the C-terminus of ORAI1, we tested the possibility that a truncated ORAI1 fragment lacking the C terminus could be expressed. However, ectopic expression of an N-terminally myc-tagged version of mutant

MCCARL ET AL 1313

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

TABLE I. Clinical phenotypes of patients with ORAI1 mutations Patient

ORAI1 mutation SOCE / ICRAC Infections

P1 (A-IV-1)*

P2 (A-IV-2)

R91W R91W Undetectable Undetectable BCGitis, meningitis, No rotavirus enteritis, interstitial pneumonia, sepsis

P3 (B-V-1)

P4 (B-V-3)

P6 (C-II-3)

A88SfsX25 Undetectable Chronic diarrhea, chronic candidiasis, pneumonia, pyelonephritis, otitis Autoimmunity No No No Neutropenia and thrombocytopenia Developmental Failure to thrive, Failure to thrive Developmental Developmental delay, features Small thymus EDA: delay, Small thymus, amelogenesis Small thymus Facial dysmorphy, imperfecta type III, Defect posterior anhydrosis arch closing (C6-T6), clubfoot Other manifestations Congenital muscular Congenital muscular Congenital muscular Congenital muscular hypotonia, hypotonia hypotonia, hypotonia, Encephalopathy, Mydriasis Encephalopathy Spastic tetraparesis, Neonatal hypocalcemia Outcome Death at 11 mo from Alive (16 y) after Death at 5 mo from Death at 11 mo pneumonia and HSCT with pneumonia from progressive sepsis persisting encephalopathy, myopathy and fever, seizures EDA

nt A103E / L194P nt Undetectable Diarrhea, chlamydia Pneumonia, chronic pneumonia, diarrhea, toxoplasma cytomegalovirus encephalitis infection

Death at 8 mo

Alive (16 y) after HSCT with persisting myopathy and EDA

References

11

11

8,9,13-15

8,9,13,14

nt nt Chronic diarrhea and candidiasis, pneumonia, pyelonephritis

P5 (C-II-2)

12

12

No

No

Failure to thrive

Failure to thrive EDA: amelogenesis imperfecta type III, anhydrosis

Congenital muscular Congenital muscular hypotonia hypotonia, eczema neovascularization of cornea

BCG, Bacillus Calmette-Guerin; HSCT, hematopoietic stem cell transplantation; mo, month; nt, not tested; y, year. *See pedigrees in Fig E1.

ORAI1-A88SfsX25 in human embryonic kidney (HEK293) cells yielded only a weak single band observed at ;15 kD in SDSPAGE, corresponding to the predicted ORAI1 fragment (see this article’s Fig E2, A, in the Online Repository at www.jacionline.org). This fragment, if expressed at all endogenously, is very unlikely to be functional as an ion channel because it lacks transmembrane domains required for Ca21 conductance. Finally, reconstitution of patient fibroblasts with wild-type ORAI1, but not empty vector or STIM1, rescued Ca21 influx on stimulation with thapsigargin, an inhibitor of the sarco/endoplasmic reticulum Ca21adenosine triphosphatase (SERCA) that induces passive Ca21 store depletion and CRAC channel activation (Fig 1, D). Failure of STIM1 expression to rescue SOCE also argues against residual ORAI1 expression in the cells of patient P4 because coexpression of STIM1 and ORAI1 was shown to enhance CRAC channel function dramatically.19,20 Collectively, these data show that the nonsense mutation in ORAI1 is responsible for the lack of Ca21 influx in patient P4.

ORAI1 missense mutations A103E and L194P abolish ORAI1 protein expression T cells from patient P6 and his deceased brother, patient P5, displayed a severe proliferation defect (Table E1).11 Ca21 influx in T cells, B cells, platelets, and fibroblasts from patient P6 was reported to be profoundly impaired (Fig E2, B).11 Sequence analysis of genomic DNA from patient P6 demonstrated that he is compound heterozygous for 2 independent missense mutations in exon 2 of ORAI1. The C / A and T / C mutations at

positions 308 and 581 of the ORAI1 coding sequence, respectively, are not known SNPs and were not detected in 50 healthy controls (100 chromosomes; Fig 2, A). The missense mutations result in the substitution of an alanine with glutamate (A103E) and a leucine with proline (L194P) in the first and third transmembrane domains of ORAI1, respectively (Fig 2, A and E). Patient P6 inherited the mutated alleles from his father (C-I-1 in Fig E1; A103E) and his mother (C-I-2 in Fig E1; L194P),who are heterozygous for 1 but not the other mutation. Mutations in other genes including ORAI2, ORAI3, STIM1, and STIM2 were not observed in patient P6. The mutations had no effect on ORAI1 mRNA transcription (not shown), whereas ORAI1 protein expression was undetectable in fibroblasts from patient P6 by immunohistochemistry (Fig 2, B) and flow cytometry (not shown), suggesting that both ORAI1 mutations interfere with stable protein expression. To test this hypothesis, we ectopically expressed ORAI1-A103E and ORAI1-L194P separately in HEK293 cells by using bicistronic IRES-GFP vectors. Expression of either mutant protein was undetectable compared with wild-type ORAI1 despite normal IRES-mediated GFP protein expression from the same mRNA transcript (Fig 2, C). A dominant negative effect of the mutations on CRAC channel function was ruled out because Ca21 influx in T cells from patient P6’s parents, each heterozygous for 1 of the mutations, was normal (Fig E2, C), and ectopic expression of ORAI1-A103E or ORAI1-L194P in HEK293 cells had no effect on Ca21 influx (Fig E2, D). Reconstitution of patient P6’s fibroblasts with wild-type ORAI1, but not STIM1, ORAI2, or empty vector, rescued Ca21

1314 MCCARL ET AL

J ALLERGY CLIN IMMUNOL DECEMBER 2009

FIG 1. ORAI1 A88SfsX25 nonsense mutation abolishes ORAI1 expression in patient P4. A, Adenosine insertion (258-259insA) results in frame shift, premature termination (A88SfsX25), and altered amino acid sequence (red) of transmembrane domain 1 (TM1) in ORAI1 (shaded). B and C, Nondetectable ORAI1 mRNA (B) and protein (C) expression in P4 compared to control. D, Impaired Ca21 influx in fibroblasts from patient P4 (left) is restored by expression of ORAI1 (middle). Bar graphs represent averages of peak [Ca21]i from 4 to 6 experiments. TG, Thapsigargin; WT, wild-type; CTRL, control.

influx on stimulation with thapsigargin (Fig 2, D). Ectopic expression of ORAI3 partially restored SOCE, consistent with similar observations in cells of patient P2.16 Taken together, these findings show that 2 independent missense mutations in ORAI1 severely compromise stable ORAI1 protein expression, abolishing Ca21 influx and causing immunodeficiency.

Myopathy and anhydrotic ectodermal dysplasia in ORAI1-deficient patients The clinical immunodeficiency in patients lacking ORAI1 expression (patients P3 to P6) is very similar to that observed in patients (P1, P2) homozygous for an ORAI1-R91W missense mutation that abolishes ORAI1 function but not its expression (Table I; Table E1).8,14 All 6 ORAI1-deficient patients showed nonimmunologic symptoms as well. Both patients surviving after hematopoietic stem cell transplantation (HSCT; P2, P6) presented with ectodermal dysplasia with anhydrosis (EDA) characterized by severely dysplastic dental enamel and pronounced anhydrosis resulting in dry skin and heat intolerance; no hair abnormalities or pigmentation defects were observed (Fig 3, A-D). Hypocalcified amelogenesis imperfecta (type III) in patients P2 and P6 is caused by a failure of dental enamel matrix calcification resulting in use-dependent loss of the unusually

FIG 2. Two missense mutations abolish ORAI1 protein expression in patient P6. A, ORAI1 C308A and T581C mutations result in single amino acid substitutions A103E and L194P in transmembrane domain (TM)–1 and TM3 (shaded or boxed) of ORAI1, respectively. B and C, Undetectable endogenous (B) and ectopic (C) expression of ORAI1 protein in fibroblasts from P6 (B) and HEK293 cells transfected with ORAI1 mutants (C). glyc., glycosylated; WT, wild-type. D, Impaired Ca21 influx in nontransfected (nt) fibroblasts from patient P6 is restored by expression of ORAI1. Bar graphs represent averages of peak Ca21 influx from 4 to 6 experiments. E, Location of ORAI1 mutations in patients P4 and P6. WT, Wild-type; CTRL, control.

soft dental enamel of both deciduous and permanent teeth. All patients (P1-P6) had global muscular hypotonia since birth. In patients P2 and P6, the myopathy compromises the patients’ mobility and results in chronic pulmonary disease because of respiratory muscle insufficiency. Histologically, the myopathy in patient P2 is characterized by a variation in muscle fiber size with a predominance of type I fibers and atrophic type II fibers (Fig 3, E and F). Other histological abnormalities commonly found in myopathies were not observed in patient P2. Consistent with a role for ORAI1 in myocyte function,21-23 we found sarcolemmal expression of ORAI1 in muscle fibers

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

MCCARL ET AL 1315

FIG 3. EDA and myopathy in ORAI1-deficient patients. A, Normal hair in patient P6 (age 16 y). B-D, Hypocalcified amelogenesis imperfecta with significant loss of enamel substance in deciduous (B, patient P2 at age 6 y) and permanent (C, patient P2 at age 10.5 y; D, patient P6 at age 9.5 y) teeth. E-H, Atrophy of type II muscle fibers in patient P2 (age 5 y) by ATPase (E), nicotinamide adenine dinucleotide (NADH) (F), and aORAI1 (red)/ aMHC fast (green) staining (G and H). I and J, ORAI1 expression in normal human skeletal muscle. Pep, Blocking peptide.

FIG 4. Almost ubiquitous ORAI1 tissue expression. A, ORAI1 expression in human CD41, CD81, and CD191 T and B cells analyzed by flow cytometry. B-P, ORAI1 expression in tissues from healthy donors incubated with aORAI1 antibody. Shown are thymus (B-D), spleen (E), eccrine sweat glands (F), skin (G), adrenal gland (H), parathyroid gland (J), exocrine pancreas (K), pancreatic islet (L), liver (M), lung (N), kidney (O), and cerebellum (P). Specificity controls are shown in this article’s Fig E3 in the Online Repository at www.jacionline.org. A, Artery; BV, blood vessel; PALS, periarterial lymphoid sheath.

of wild-type controls and both type I and type II muscle fibers of patient P2 (Fig 3, G-J).

Almost ubiquitous ORAI1 protein expression The clinical syndrome associated with ORAI1 deficiency indicates that ORAI1-dependent SOCE is essential for the function and/or development of lymphocytes, skeletal muscle, and ectodermal derived tissues. ORAI1 mRNA expression and SOCE, however, have also been demonstrated in many other organs and cell types.16,24 No data on the cellular distribution

pattern of ORAI1 have been reported. We detected ORAI1 expression in CD41 and CD81 T cells and CD191 B cells consistent with the known role of ORAI1 in lymphocyte function (Fig 4, A). Immunohistochemical analysis showed that ORAI1 is expressed in a subset of cells in primary and secondary lymphoid organs such as thymus, spleen, and tonsils (Fig 4, B-E; data not shown). The strongest expression was observed in lymphoid cells in the periarterial lymphoid sheath of spleen (Fig 4, E) and the paracortical zone in tonsils (data not shown) consistent with ORAI1 expression in T cells. Outside the immune system, ORAI1 expression was found in a wide variety of cell types and organs

1316 MCCARL ET AL

(Fig 4), including those affected in the patients such as eccrine sweat glands (Fig 4, F) and other tissues not apparently affected in the patients such as skin, vascular endothelium, mucosal epithelial cells of the gastrointestinal tract, several endocrine and exocrine glands, hepatocytes, pneumocytes in the lung and kidney tubules (Fig 4). Of note is the almost complete absence of ORAI1 staining in the central nervous system consistent with previously reported low ORAI1 mRNA levels in the brain (http:// www.brain-map.org).16,25

DISCUSSION The ORAI1-deficient patients described here represent all patients known to date with CRAC channel dysfunction caused by mutations in ORAI1. Their clinical phenotypes illustrate the in vivo role of ORAI1 in human beings and together with patients lacking STIM1 expression10 define a new disease syndrome resulting from a defect in SOCE and CRAC channel function.11,12 The mutations described in this study cause a human null phenotype for ORAI1 by interfering with mRNA expression as in the case of the A88SfsX25 frameshift nonsense mutation in patient P4 or protein stability and expression as in the case of the ORAI1-A103E and ORAI1-L194P missense mutations in patient P6. The A103E substitution introduces a negative charge in close proximity to E106—a Ca21 binding site in the CRAC channel pore5-7—likely resulting in electrostatic repulsion and destabilization of the first transmembrane a helix (Fig 2, A). Substitution of L194 with proline at the end of the third transmembrane domain is likely to break or kink the transmembrane a helix, resulting in the destabilization of protein expression.26,27 Clinically, ORAI1 deficiency is characterized by a severe defect in adaptive immune responses resulting in life-threatening infections with viral, bacterial, and fungal pathogens; congenital myopathy; and EDA with defects in enamel dentition and sweat production (Table I). The immunodeficiency is very similar to SCID but—unlike in the majority of SCID cases—lymphocyte development is unperturbed. Numbers of T cells and T-cell subsets, B cells, and NK cells in the peripheral blood of patients were normal, suggesting that lymphocyte differentiation including the selection and maturation of T cells occurs independently of ORAI1 (Table E1).11,12,14 These findings are consistent with normal lymphocyte development observed in STIM1-deficient patients 10 and Orai1 and Stim1–deficient mice.28-31 By contrast, T-cell activation is severely compromised in all 6 patients as skin delayed-type hypersensitivity reactions in vivo, and proliferative responses to a variety of stimuli in vitro are reduced or absent, consistent with the severe defect in cytokine production in T cells of patients P1 and P2 reported previously.13,14 T cells from patients P4 and P6, but not those from patients P1 and P2, proliferated normally after phorbol 12-myristate 13-acetate (PMA) and ionomycin treatment. The discrepancy may be a result of a potential inhibitory effect of mutant ORAI1-R91W on residual ORAI2 or ORAI3 Ca21 channels that have been implicated in Ca21 influx in mouse T cells and the function of which may be sufficient to induce proliferation.31 Given the important role of Ca21 influx for B-cell and NK-cell function32-35 and ORAI1 expression in both cell types at least in mice,36 the SOCE defect documented in B cells from patients P237 and P6 (Fig E2)11 and a potential SOCE defect in NK cells may contribute to the patients’ immunodeficiency.

J ALLERGY CLIN IMMUNOL DECEMBER 2009

Autoimmunity was observed in only 1 (patient P4) out of 6 ORAI1-deficient patients who presented with neutropenia and thrombocytopenia. By contrast, all STIM1-deficient patients showed autoimmune symptoms, and 1 patient was observed to have reduced numbers of CD41 forkhead box protein 3 (Foxp3)– positive regulatory T cells.10 Numbers of regulatory T cells in ORAI1-deficient patients could not be evaluated because blood samples preceding HSCTwere not available. A plausible explanation for the absence of autoimmunity in most ORAI1-deficient patients is that 4 of the 6 patients (P1, P3-P5) died in their first year of life, presumably before the onset of autoimmune disease, and the 2 surviving patients (P2, P6) received HSCT at 4 months of age, preventing autoimmunity. Taken together, our findings demonstrate that ORAI1, SOCE, and CRAC channel function are required for T-cell activation but largely dispensable for T-cell development. The nonimmunologic symptoms observed in ORAI1-deficient patients overlap with those found in patients lacking STIM1, strongly indicating that the phenotype is a result of a defect in SOCE and CRAC channel function. All ORAI1-deficient patients have congenital myopathy characterized by global muscular hypotonia and, in 1 patient, atrophy of type II muscle fibers. These observations suggest that SOCE is required for skeletal muscle function and/or differentiation. SOCE in murine skeletal myotubes is mediated by ORAI1 and STIM122,23 and contributes to the refilling of sarcoplasmic reticulum Ca21 stores,38,39 thus ensuring the muscle’s ability to undergo repeated cycles of excitation-contraction coupling mediated by Ca21 release from the sarcoplasmic reticulum (SR). In addition, SOCE may be critical for skeletal muscle differentiation because it is involved in the expression of 2 early markers of myoblast differentiation, myocyte enhancer factor-2 (MEF2) and myogenin,21 and presumably the activation of the Ca21-dependent transcription factor nuclear factor of activated T cells (NFAT).40 Myoblasts of Stim1 and SOCE–deficient mice not fatigued rapidly but also showed severe morphologic abnormalities consistent with a developmental defect.23 Ectodermal dysplasia with anhydrosis was observed in the 2 surviving ORAI1-deficient patients (P2, P6) and all STIM1deficient patients, indicating that SOCE is important for eccrine sweat gland function and/or development (skin biopsies from ORAI1-deficient patients to distinguish between these possibilities could not be obtained) and ameloblast function during calcification of the enamel matrix. Encephalopathy was observed only in patients P3 and P4, not in the other ORAI1-deficient (and STIM1-deficient) patients. It is therefore unlikely to be a common feature of ORAI1 deficiency but is potentially a result of an additional genetic defect in a notably inbred kindred or infection with a neurotrophic pathogen, a relatively common complication in patients with defects in T-cell mediated immunity. EDA with immunodeficiency caused by mutations in ORAI1 (and STIM1)10 differs from EDA with immunodeficiency caused by mutations in nuclear factor k light-chain-enhancer of activated B cells (NFkB) essential modulator (NEMO)41-43 and nuclear factor k light-chain-enhancer of activated B cells inhibitor alpha (IkBa)44 in that the latter are both characterized by hypodontia, conical teeth in all, and sparse scalp hair in some of the patients. In addition, some patients with mutations in IkBa and NEMO, but not ORAI1 (and STIM1), show a hyper-IgM phenotype with decreased serum IgG and increased IgM. Whereas the hypermorphic IkBa mutation impairs T-cell proliferation similar to

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

ORAI1 (and STIM1) deficiency, only IkBa but not ORAI1-deficient patients lack gd and memory ab T cells44. The limited clinical spectrum of ORAI1 deficiency contrasts with the almost ubiquitous expression of ORAI1 (Fig 4)16 and reports describing SOCE and CRAC channel function in many cell types outside the immune system.24,45-48 Explanations for the absence of more extensive disease in the ORAI1-deficient patients include that ORAI1 plays a redundant role for SOCE in many tissues and can be functionally replaced by, for instance, ORAI2 or ORAI3, and that SOCE coexists with nonstore-operated Ca21 influx. ORAI2 and ORAI3 can form Ca21 channels when coexpressed ectopically with STIM1,49,50 but direct evidence for a physiological role of endogenous ORAI2 and ORAI3 in vivo is still missing. In summary, the ORAI1 mutations described in this study together with the phenotypes of ORAI1-deficient and STIM1deficient patients reported earlier8,10 define the clinical syndrome associated with defects in CRAC channel function and provide valuable insight into the role of ORAI1 and SOCE in human beings in vivo. We thank Dr R. Hirschhorn for healthy control DNA samples, Dr A. Freundorfer for images of patient P6’s teeth, Dr M. Schlesier for reviewing patient data, and C. Jacques and C. Harre for their technical help with culturing cells.

Key messages d

Frameshift nonsense and missense mutations in the Ca21 channel gene ORAI1 abolish ORAI1 protein expression and Ca21 channel function.

d

ORAI1 deficiency is defined clinically by immunodeficiency, myopathy, and EDA with a defect in dental enamel calcification.

d

ORAI1 is almost ubiquitously expressed in human tissues despite the limited clinical phenotype of ORAI1 deficiency indicating a nonredundant role for ORAI1 in store-operated Ca21 influx in T cells, skeletal muscle, and some ectodermal-derived tissues.

REFERENCES 1. Fischer A. Human primary immunodeficiency diseases. Immunity 2007;27:835-45. 2. Geha RS, Notarangelo LD, Casanova JL, Chapel H, Conley ME, Fischer A, et al. Primary immunodeficiency diseases: an update from the International Union of Immunological Societies Primary Immunodeficiency Diseases Classification Committee. J Allergy Clin Immunol 2007;120:776-94. 3. Feske S. Calcium signalling in lymphocyte activation and disease. Nat Rev Immunol 2007;7:690-702. 4. Lewis RS. The molecular choreography of a store-operated calcium channel. Nature 2007;446:284-7. 5. Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG. Orai1 is an essential pore subunit of the CRAC channel. Nature 2006;443:230-3. 6. Vig M, Beck A, Billingsley JM, Lis A, Parvez S, Peinelt C, et al. CRACM1 multimers form the ion-selective pore of the CRAC channel. Curr Biol 2006;16:2073-9. 7. Yeromin AV, Zhang SL, Jiang W, Yu Y, Safrina O, Cahalan MD. Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nature 2006;443:226-9. 8. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, et al. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006;441:179-85.

MCCARL ET AL 1317

9. Feske S, Prakriya M, Rao A, Lewis RS. A severe defect in CRAC Ca21 channel activation and altered K1 channel gating in T cells from immunodeficient patients. J Exp Med 2005;202:651-62. 10. Picard C, McCarl CA, Papolos A, Khalil S, L€uthy K, Hivroz C, et al. STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med 2009;360:1971-80. 11. Le Deist F, Hivroz C, Partiseti M, Thomas C, Buc HA, Oleastro M, et al. A primary T-cell immunodeficiency associated with defective transmembrane calcium influx. Blood 1995;85:1053-62. 12. Partiseti M, Le Deist F, Hivroz C, Fischer A, Korn H, Choquet D. The calcium current activated by T cell receptor and store depletion in human lymphocytes is absent in a primary immunodeficiency. J Biol Chem 1994;269:32327-35. 13. Feske S, Draeger R, Peter HH, Eichmann K, Rao A. The duration of nuclear residence of NFAT determines the pattern of cytokine expression in human SCID T cells. J Immunol 2000;165:297-305. 14. Feske S, Muller JM, Graf D, Kroczek RA, Drager R, Niemeyer C, et al. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in T lymphocytes of two male siblings. Eur J Immunol 1996;26: 2119-26. 15. Schlesier M, Niemeyer C, Duffner U, Henschen M, Tanzi-Fetta R, Wolff-Vorbeck G, et al. Primary severe immunodeficiency due to impaired signal transduction in T cells. Immunodeficiency 1993;4:133-6. 16. Gwack Y, Srikanth S, Feske S, Cruz-Guilloty F, Oh-hora M, Neems DS, et al. Biochemical and functional characterization of Orai proteins. J Biol Chem 2007;282: 16232-43. 17. Rodig SJ, Savage KJ, Nguyen V, Pinkus GS, Shipp MA, Aster JC, et al. TRAF1 expression and c-Rel activation are useful adjuncts in distinguishing classical Hodgkin lymphoma from a subset of morphologically or immunophenotypically similar lymphomas. Am J Surg Pathol 2005;29:196-203. 18. Dubowitz V. Muscle biopsy: a practical approach. London: Bailliere Tindall; 1985. 19. Peinelt C, Vig M, Koomoa DL, Beck A, Nadler MJ, Koblan-Huberson M, et al. Amplification of CRAC current by STIM1 and CRACM1 (Orai1). Nat Cell Biol 2006;8:771-3. 20. Soboloff J, Spassova MA, Tang XD, Hewavitharana T, Xu W, Gill DL. Orai1 and STIM reconstitute store-operated calcium channel function. J Biol Chem 2006; 281:20661-5. 21. Darbellay B, Arnaudeau S, Konig S, Jousset H, Bader C, Demaurex N, et al. STIM1- and Orai1-dependent store-operated calcium entry regulates human myoblast differentiation. J Biol Chem 2009;284:5370-80. 22. Lyfenko AD, Dirksen RT. Differential dependence of store-operated and excitation-coupled Ca21 entry in skeletal muscle on STIM1 and Orai1. J Physiol 2008;586:4815-24. 23. Stiber J, Hawkins A, Zhang ZS, Wang S, Burch J, Graham V, et al. STIM1 signalling controls store-operated calcium entry required for development and contractile function in skeletal muscle. Nat Cell Biol 2008;10:688-97. 24. Parekh AB, Putney JW, Jr. Store-operated calcium channels. Physiol Rev 2005;85: 757-810. 25. Huang YH, Hoebe K, Sauer K. New therapeutic targets in immune disorders: ItpkB, Orai1 and UNC93B. Expert Opin Ther Targets 2008;12:391-413. 26. Orzaez M, Salgado J, Gimenez-Giner A, Perez-Paya E, Mingarro I. Influence of proline residues in transmembrane helix packing. J Mol Biol 2004;335:631-40. 27. Yohannan S, Yang D, Faham S, Boulting G, Whitelegge J, Bowie JU. Proline substitutions are not easily accommodated in a membrane protein. J Mol Biol 2004; 341:1-6. 28. Beyersdorf N, Braun A, Vogtle T, Varga-Szabo D, Galdos RR, Kissler S, et al. STIM1-independent T cell development and effector function in vivo. J Immunol 2009;182:3390-7. 29. Gwack Y, Srikanth S, Oh-Hora M, Hogan PG, Lamperti ED, Yamashita M, et al. Hair loss and defective T- and B-cell function in mice lacking ORAI1. Mol Cell Biol 2008;28:5209-22. 30. Oh-Hora M, Yamashita M, Hogan PG, Sharma S, Lamperti E, Chung W, et al. Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol 2008;9:432-43. 31. Vig M, DeHaven WI, Bird GS, Billingsley JM, Wang H, Rao PE, et al. Defective mast cell effector functions in mice lacking the CRACM1 pore subunit of store-operated calcium release-activated calcium channels. Nat Immunol 2008;9:89-96. 32. Caraux A, Kim N, Bell SE, Zompi S, Ranson T, Lesjean-Pottier S, et al. Phospholipase C-gamma2 is essential for NK cell cytotoxicity and innate immunity to malignant and virally infected cells. Blood 2006;107:994-1002. 33. Cassatella MA, Anegon I, Cuturi MC, Griskey P, Trinchieri G, Perussia B. Fc gamma R(CD16) interaction with ligand induces Ca21 mobilization and phosphoinositide turnover in human natural killer cells: role of Ca21 in Fc gamma R(CD16)-induced transcription and expression of lymphokine genes. J Exp Med 1989;169:549-67.

1318 MCCARL

34. King LB, Freedman BD. B-lymphocyte calcium influx. Immunol Rev 2009;231:265-77. 35. Scharenberg AM, Humphries LA, Rawlings DJ. Calcium signalling and cell-fate choice in B cells. Nat Rev Immunol 2007;7:778-89. 36. Feske S. ORAI1 and STIM1 deficiency in human and mice: roles of store-operated Ca21 entry in the immune system and beyond. Immunol Rev 2009;231:189-209. 37. Feske S, Giltnane J, Dolmetsch R, Staudt LM, Rao A. Gene regulation mediated by calcium signals in T lymphocytes. Nat Immunol 2001;2:316-24. 38. Kurebayashi N, Ogawa Y. Depletion of Ca21 in the sarcoplasmic reticulum stimulates Ca21 entry into mouse skeletal muscle fibres. J Physiol 2001;533:185-99. 39. Launikonis BS, Rios E. Store-operated Ca21 entry during intracellular Ca21 release in mammalian skeletal muscle. J Physiol 2007;583:81-97. 40. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev 2003;17:2205-32. 41. Doffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, et al. X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling. Nat Genet 2001;27:277-85. 42. Jain A, Ma CA, Liu S, Brown M, Cohen J, Strober W. Specific missense mutations in NEMO result in hyper-IgM syndrome with hypohydrotic ectodermal dysplasia. Nat Immunol 2001;2:223-8. 43. Zonana J, Elder ME, Schneider LC, Orlow SJ, Moss C, Golabi M, et al. A novel Xlinked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK-gamma (NEMO). Am J Hum Genet 2000;67:1555-62.

J ALLERGY CLIN IMMUNOL DECEMBER 2009

44. Courtois G, Smahi A, Reichenbach J, Doffinger R, Cancrini C, Bonnet M, et al. A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. J Clin Invest 2003;112: 1108-15. 45. Abdullaev IF, Bisaillon JM, Potier M, Gonzalez JC, Motiani RK, Trebak M. Stim1 and Orai1 mediate CRAC currents and store-operated calcium entry important for endothelial cell proliferation. Circ Res 2008;103:1289-99. 46. Bergmeier W, Oh-Hora M, McCarl CA, Roden RC, Bray PF, Feske S. R93W mutation in Orai1 causes impaired calcium influx in platelets. Blood 2009; 113:675-8. 47. Braun A, Varga-Szabo D, Kleinschnitz C, Pleines I, Bender M, Austinat M, et al. Orai1 (CRACM1) is the platelet SOC channel and essential for pathological thrombus formation. Blood 2009;113:2056-63. 48. Potier M, Gonzalez JC, Motiani RK, Abdullaev IF, Bisaillon JM, Singer HA, et al. Evidence for STIM1- and Orai1-dependent store-operated calcium influx through ICRAC in vascular smooth muscle cells: role in proliferation and migration. FASEB J 2009;23: 2425-37. 49. DeHaven WI, Smyth JT, Boyles RR, Putney JW, Jr. Calcium inhibition and calcium potentiation of Orai1, Orai2, and Orai3 calcium release-activated calcium channels. J Biol Chem 2007;282:17548-56. 50. Lis A, Peinelt C, Beck A, Parvez S, Monteilh-Zoller M, Fleig A, et al. CRACM1, CRACM2, and CRACM3 are store-operated Ca21 channels with distinct functional properties. Curr Biol 2007;17:794-800.

Correction With regard to the September 2009 article entitled ‘‘Come`l-Netherton syndrome defined as primary immunodeficiency’’ (J Allergy Clin Immunol 2009;124:536-43), the description of the SPINK5 mutation of patient #9 in Table I is incorrect. Allele (2) should be 66611G>A (intron8), not 60311G>A (intron8). The mutation can also be designated as IVS811g>a.

MCCARL 1318.e1

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

METHODS Patients Kindred A: patients P1 and P2. Since the first reporting, both patients—born to consanguineous Turkish parents—were identified to be homozygous for a missense mutation in ORAI1 (ORAI1-R91W),E1 and follow-up of patient P2 over a period of 15 years revealed a complex syndrome of immunodeficiency, EDA, and myopathy (Table I). Patient P1 (A-V-1, Fig E1) had recurrent infections since birth, including BCGitis after vaccination, rotavirus enteritis, pneumonia, and meningitis.E2,E3 He failed to thrive, presented with muscular hypotonia, and died from pneumonia and gastrointestinal sepsis at 11 months of age before an appropriate bone marrow donor could be identified (Table I). Patient P2 (A-V-2, Fig E1) was treated with recombinant IL-2 and intravenous immunoglobulins (IVIg) in the first months of lifeE2,E4; he received a HSCT at 4 months of age and does not have frequent or severe infections. Total lymphocyte counts and numbers of T, B, and NK cells were normal in patients P1 and P2; an increase in activated CD31 HLA-DR1 and CD41 CD291 memory T cells was observed in both patients P1 and P2 (Table E1). T-cell proliferation in vitro was severely compromised in both patients.E2,E3 Serum immunoglobulin levels were normal or elevated because of recurrent infections, but no seroconversion after diphteria-tetanus (dT) vaccination was observed. Congenital myopathy was present in patients P1 and P2 and initially manifested as insufficient head control. Patient P2 later in life started to show generalized muscle weakness (31–4/5 on the Medical Research Council (MRC) scale), reduced walking distance, difficulty in climbing stairs, a positive Gower sign, ptosis, and hypernasal speech caused by velopharyngeal weakness. Respiratory muscle insufficiency in patient P2 results in retention of bronchial secretion, a predisposition to recurrent chest infections, and bronchiectasis. EDA in patient P2 is characterized by an enamel dentition defect and severe anhydrosis with heat intolerance, intermittent fever, dry skin, and pathological sweat provocation tests since early childhood. Severely dysplastic dental enamel of deciduous and permanent teeth with hypocalcification of the enamel matrix and painful exposure of yellow dentin led to the diagnosis of hypocalcified amelogenesis imperfecta (Fig 3, B and C). Other characteristic features of amelogenesis imperfecta such as hypodontism, oligodontism, conical teeth, taurodontism, or of EDA such as sparse scalp hair and eyebrows, were not observed.E5-E7 The neurologic and mental development of patient P2 is normal. Kindred B: patients P3 and P4. P3 (B-V-1, Fig E1) was born to consanguineous French parents and had recurrent infections since 2 weeks of age including chronic diarrhea, mucocutaneous candidiasis, pneumonia, and bacterial pyelonephritis (Table I).E8 Patient P3 presented with congenital muscular hypotonia (characterized by decreased conduction speed in an electromyogram recorded at 10 months of age), developmental delay, and idiopathic encephalopathy. He died of pneumonia at 5 months of age. Patient P4 (B-V-3, Fig E1) presented at birth with facial dysmorphy, a defect in posterior arch closing (C6-T6), club foot (talipes equinovarus), and hypocalcemia (Table 1).E8 During the first year of his life, he had a progressive failure to thrive and recurrent infections including chronic diarrhea, pneumonia, oral and digestive candidiasis, otitis, and pyelonephritis. Despite a small thymus, total lymphocyte counts and numbers of T and B cells were normal. By contrast, T-cell proliferation was strongly reduced in response to all tested stimuli except phorbol 12-myristate 13-acetate (PMA) plus ionomycin (Table E1).E8 At 7 months of age, he developed chronic neutropenia and thrombocytopenia (Table I; Table E1). Total serum immunoglobulin levels were moderately elevated because of recurrent infections, but seroconversion after vaccination was absent. Myopathy in patient P4 manifested as congenital global hypotonia with poor head control and spastic tetraparesis. An electromyogram recorded at 8 months of age was normal. In addition, patient P4 presented with progressive idiopathic encephalopathy characterized by developmental delay, seizures, and a myelinization delay observed by MRI at 5 months of age. He died at 11 months of age because of fever, seizures, and progressive encephalopathy.

Kindred C: patients P5 and P6. Patient P5 (C-II-2, Fig E1) was born to unrelated, healthy parents of German origin and presented with failure to thrive, muscular hypotonia, and immunodeficiency (Table I). He died at 8 months of age from protracted bloody diarrhea, Chlamydia pneumonia, and Toxoplasma encephalitis.E9 Lymphocyte counts and numbers of T cells, especially activated CD31 HLA-DR1 T cells, were elevated in patient P5 one month before his death; T-cell proliferation in vitro was impaired (Table E1). Patient P6 (C-II-2, Fig E1), the younger brother of patient P5, also showed a failure to thrive and had chronic diarrhea, pneumonia, and cytomegalovirus infection in the first months of his life (Table I).E9 His lymphocyte numbers were normal but showed a significant increase in CD41CD291 and CD41CD45RO1 activated and memory T cells (Table E1). Proliferation of T cells from patient P6 was strongly impaired in vitro. His serum immunoglobulin levels were normal to elevated. At 4 months of age, patient P6 was treated by HSCT using bone marrow from his healthy sister (C-II-1, Fig E1), which resulted in sustained mixed chimerism, partial reconstitution of lymphocyte proliferation, and IVIg dependence. Follow-up of patient P6 over a period of 16 years revealed that he has myopathy and ectodermal dysplasia. Myopathy in patient P6 is characterized by global muscular hypotonia with hypernasal speech and loss of independent ambulation at ;15 years of age and is associated with scoliosis and pectus excavatum. Respiratory muscle insufficiency results in chronic pulmonary disease characterized by bronchiectasy, recurrent pneumonia, pulmonary hypertension, and increased CO2 retention requiring O2 therapy. EDA in patient P6 is characterized by severely dysplastic dental enamel (hypocalcified amelogenesis imperfecta; Fig 3, D), dry skin with anhydrosis, and heat intolerance since birth. Scalp hair, eyebrows, and eyelashes developed normally in patient P6 (Fig 3, A); a microscopic analysis of a hair sample did not reveal abnormalities such as reduced hair shaft thickness, trichorrhexis nodosa, or pili torti.E10 Because of the severity of the enamel defect, all deciduous teeth were extracted, and permanent molars were capped with crowns. Other tooth defects or symptoms associated with EDA (see case report for patients P1 and P2) were not observed in patient P6. At 8 years of age, patient P6 developed a monoclonal EBV-associated posttransplant lymphoproliferative disorder that was diagnosed as polymorphic B-cell lymphoma of host origin as confirmed by karyotyping. It was treated by a second HSCT, resulting in complete donor chimerism with normal lymphocyte function. At 16 years of age, patient P6 is showing neovascularization of the cornea of both eyes. His neurologic and mental development is normal. Research was approved by the Institutional Review Boards at New York University Medical Center and Hoˆpital Necker-Enfants Malades. Written informed consent was obtained from the patients’ parents.

Cell lines B cells from patients P2 and P6 were transformed with EBV as described.E11 Polyclonal T-cell lines were established from PBMCs of patient P6’s parents as described.E1

Northern blotting Northern blots were performed by using standard protocols. Briefly, total RNAwas extracted from patient and control fibroblasts by using Trizol reagent (Invitrogen, Carlsbad, Calif). 10 mg total RNA was separated by electrophoresis on a denaturing 1.2% agarose/formaldehyde gel and transferred onto Hybond-N1 nylon membrane (GE Healthcare). An ORAI1-specific hybridization probe recognizing the 39 untranslated region was generated by PCR using the following primers: 59 CCCTTCCAGTGCTTTGGCCTTA, 59 GTGTCACACACACATGTACACACTC. The probe was labeled with [a-32P] dCTP (Perkin Elmer, Waltham, Mass) by using the random prime Ladderman Labeling Kit (TaKaRa; Otsu, Shiga, Japan) and purified with Sephadex G50 spin columns (GE Healthcare).

1318.e2 MCCARL

Immunoblotting Western blots were performed by using standard protocols. Briefly, total cell lysates were obtained from patient and control fibroblasts and separated by SDS-PAGE as described.E12 Nitrocellulose membranes were incubated with the following antibodies: rabbit polyclonal, affinity-purified anti-human ORAI1 antibody generated by using standard protocols (Open Biosystems, Huntsville, Ala), anti-actin (sc-1616; Santa Cruz), and anti-GFP (sc-8334; Santa Cruz).

Immunohistochemistry Normal human microarrays and patient cells were incubated with affinitypurified anti-ORAI1 antibody (1:25) in DAKO diluent for 1 hour followed by anti-rabbit horseradish peroxidase–conjugated antibody (Envision detection kit; DAKO, Carpinteria, Calif). For peptide block, anti-ORAI1 antibody was preincubated with the immunizing peptide at a 1:1 molar ratio for 20 minutes at 4 8C. Slides were counterstained with hematoxylin. Images were acquired by using an inverted Olympus IX71 microscope with 320, 340, and 363 objectives and a SPOT RT Color digital CCD camera (Diagnostic Instruments, Sterling Heights, Mich) with SPOT imaging software (version 3.5.9).

Single cell calcium imaging Fibroblasts were grown directly on UV-sterilized coverslips and loaded with 3 mM fura-2 acetoxymethyl (AM) ester. T and B cells were loaded with 1 mM fura-2AM and attached to coverslips by using poly-L-lysine. Cells were analyzed by time-lapse videoimaging on an Axiovert S200 epifluorescence microscope (Zeiss, Thornwood, NY) using OpenLab imaging software (Improvision, Waltham, Mass; Fig 1, D) and an IX81 epifluorescence microscope (Olympus, Center Valley, Pa) using Slidebook imaging software v4.2 (Olympus; Fig 2, D, and Fig E2). Standard extracellular Ringer solution contained (in mM): 155 NaCl, 4.5 KCl, 1 MgCl2, 10 D-glucose, 5 Na-HEPES (pH 7.4), and different concentrations of 2 CaCl2 as indicated in the figures. Ca21-free Ringer was prepared by substituting MgCl2 for CaCl2. Cells were stimulated with thapsigargin (1 mM EMD Biosciences, San Diego, Calif). [Ca21]i was estimated from the relation  21 
 Ca i 5 K  ðR-Rmin Rmax 2RÞ K*, Rmin, and Rmax were measured in control fibroblasts in situ as previously described.E1

J ALLERGY CLIN IMMUNOL DECEMBER 2009

REFERENCES E1. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, et al. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006;441:179-85. E2. Feske S, Muller JM, Graf D, Kroczek RA, Drager R, Niemeyer C, et al. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in T lymphocytes of two male siblings. Eur J Immunol 1996;26: 2119-26. E3. Schlesier M, Niemeyer C, Duffner U, Henschen M, Tanzi-Fetta R, Wolff-Vorbeck G, et al. Primary severe immunodeficiency due to impaired signal transduction in T cells. Immunodeficiency 1993;4:133-6. E4. Feske S, Draeger R, Peter HH, Eichmann K, Rao A. The duration of nuclear residence of NFAT determines the pattern of cytokine expression in human SCID T cells. J Immunol 2000;165:297-305. E5. Vierucci S, Baccetti T, Tollaro I. Dental and craniofacial findings in hypohidrotic ectodermal dysplasia during the primary dentition phase. J Clin Pediatr Dent 1994;18:291-7. E6. Pinheiro M, Freire-Maia N. Ectodermal dysplasias: a clinical classification and a causal review. Am J Med Genet 1994;53:153-62. E7. Zonana J. Hypohidrotic (anhidrotic) ectodermal dysplasia: molecular genetic research and its clinical applications. Semin Dermatol 1993;12:241-6. E8. Partiseti M, Le Deist F, Hivroz C, Fischer A, Korn H, Choquet D. The calcium current activated by T cell receptor and store depletion in human lymphocytes is absent in a primary immunodeficiency. J Biol Chem 1994;269: 32327-35. E9. Le Deist F, Hivroz C, Partiseti M, Thomas C, Buc HA, Oleastro M, et al. A primary T-cell immunodeficiency associated with defective transmembrane calcium influx. Blood 1995;85:1053-62. E10. Rouse C, Siegfried E, Breer W, Nahass G. Hair and sweat glands in families with hypohidrotic ectodermal dysplasia: further characterization. Arch Dermatol 2004; 140:850-5. E11. Feske S, Giltnane J, Dolmetsch R, Staudt LM, Rao A. Gene regulation mediated by calcium signals in T lymphocytes. Nat Immunol 2001;2:316-24. E12. Feske S, Prakriya M, Rao A, Lewis RS. A severe defect in CRAC Ca21 channel activation and altered K1 channel gating in T cells from immunodeficient patients. J Exp Med 2005;202:651-62. E13. Bennett RL, Steinhaus KA, Uhrich SB, O’Sullivan CK, Resta RG, LochnerDoyle D, et al. Recommendations for standardized human pedigree nomenclature. Pedigree Standardization Task Force of the National Society of Genetic Counselors. Am J Hum Genet 1995;56:745-52. E14. Gwack Y, Srikanth S, Oh-Hora M, Hogan PG, Lamperti ED, Yamashita M, et al. Hair loss and defective T- and B-cell function in mice lacking ORAI1. Mol Cell Biol 2008;28:5209-22.

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

FIG E1. Pedigrees of immunodeficient patients with mutations in ORAI1. Kindred A, pedigree of patient P1 (A-IV-1) and patient P2 (A-IV-2) as reported in reference.E1 Note that heterozygous carriers (dotted symbols) are healthy. Kindred B, pedigree of patient P3 (B-V-1) and patient P4 (B-V-3).E8 Kindred C, pedigree of patient P5 (C-II-2) and patient P6 (C-II-3).E9 Black symbols depict patients, strike-through symbols deceased individuals. E?, No DNA available for sequencing.E13 WT, wild-type.

MCCARL 1318.e3

1318.e4 MCCARL

J ALLERGY CLIN IMMUNOL DECEMBER 2009

FIG E2. Ectopic expression of ORAI1 mutants and SOCE in patient P6 and his parents. A, Strongly impaired ectopic protein expression of myc-tagged ORAI1-A88SfsX25 in HEK293 cells compared with wild-type (WT) ORAI1. glyc, Glycosylated. B and C, SOCE is undetectable in EBV-transformed B cells of patient P6 (B) but normal in T cells of his parents (Mo, mother; Fa, father) in C compared with controls (CTRL). [Ca21]i was measured in response to thapsigargin (TG) stimulation as described in Fig 1. Bar graphs show averages of initial rates of Ca21 influx (B) and peak [Ca21]i (C) after readdition of 0.5 and 0.2 mM Ca21, respectively, from 4 to 6 independent experiments. D, ORAI1-A103E and ORAI1-L194P mutations do not have a dominantnegative effect on SOCE mediated by WT-ORAI1 and STIM1 when ectopically coexpressed in HEK293 cells. Bar graphs show averages of peak Ca21 influx from 2 independent experiments. F340/380, Fura-2 emission ratio after excitation at 340 and 380 nm.

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

FIG E3. Specificity controls for ORAI1 detection by immunohistochemistry. A and B, Keratinocytes of E16.5 embryos from wild-type C57BL/6 but not Orai1-/- mice E14 show ORAI1 staining after incubation with antiORAI1 antibody. C, ORAI1 detection in a muscle biopsy from a healthy donor with anti-ORAI1 antibody (top) is abolished by preincubation of antibody with the immunizing peptide (bottom). D-P, No ORAI1 expression was detected when the same tissue sections shown in Fig 4 were stained with anti-ORAI1 antibody preincubated with the immunizing peptide for 20 minutes on ice at a 1:1 molar ratio (antibody:peptide). For details see Fig 4. D-F, thymus; G, spleen; H, skin; I, adrenal gland; J, parathyroid gland; K, exocrine pancreas; L, pancreatic islet; M, liver; N, lung; O, kidney; P, cerebellum.

MCCARL 1318.e5

1318.e6 MCCARL

J ALLERGY CLIN IMMUNOL DECEMBER 2009

TABLE E1. Immunologic parameters of patients with ORAI1 mutations Patient

Age at analysis (mo) Lymphocytes (3,700-9,000/mL) T cells (%) CD31 (N: 51-77) CD41 (N: 35-56) CD81 (N: 12-23) CD45RA1/CD41 (N: 77-94) CD45RO1/CD41 (N: 3-16) CD291/CD41 (N: 10-25) HLA-DR1/CD31 (N: 1-7) TCRab (N: 90-100 of CD31) TCRgd (N: 0-10 of CD31) NK cells (%) CD161 CD561/CD31 (N: 3-18) B cells (%) CD201 (N: 15-32) CD191 (N: 11-41) T-cell proliferation (cpm 3 1023) PHA ConA OKT3 OKT3 1 CD28 PMA 1 ionomycin Tetanus toxoid PPD Candidin CMV Serum Ig (mg/mL) IgG (2.3-5.5) IgA (0.1-0.6) IgM (0.3-0.9) Specific antibodies Tetanus Poliovirus Diphtheria References

P1 (A-IV-1)

P2 (A-IV-2)

5 9,600/mL

1 6,800/mL

85 70 11 71

75 {60-85} 46 {41-68} 24 {9-23} 73

49 18

26 8 {1-38}

P3 (B-V-1)

P4 (B-V-3)

P5 (C-II-2)

P6 (C-II-3)

4 Normal

7 4,350/mL

7 16,000/mL

4 5,000/mL

70 54 17

88 64 20

60 30 29 34 61 48

14 96 3

4

14

12

2 20

33 [80] 5 [68] 0.9 [130] 0.04 [3] 1.1 [5.3] 1.1 [2.9]

27.2 11.4 11.6 1 1 3.3 0.9

[71.2] [50.5] [45.4] [31] [30] [4.0] [1.3]

6

6

2

13

4 [50]

16.9 [50]

13.0 [57]

2 [67]

1.4 [30]

1.1 [66]

34 [37] 0 [31]

46.0 [36.3] 14.0 [30.3] 2.0 [10]

0 [10]

0.5 [10]

6 [10] 72.0 [31.3]

7.76 2.79 2.01

5 1.75 5.5

11.4 7.0 1.6

6.6 1.8 0.5

Normal Normal Low

Negative

Negative 

Negative

Negative E1,E2,E11,E12

Negative  E1,E2,E11,E12

E8

Negative Negative E8

E9

E9

CMV, Cytomegalovirus; ConA, concanavalin A; mo, month; OKT3, mouse monoclonal anti-CD3 antibody; PMA, phorbol 12-myristate 13-acetate; PPD, purified protein derivative; y, year. Normal values (N) for children between 3 and 6 months of age in ( ) in the first column.13,14 Numbers in [ ] in represent day controls for T-cell proliferation. Normal values for children <1 month of age in { }. Alphanumeric symbols in parentheses after patient names at the top of the table refer to pedigrees shown in Fig E1.  Skin delayed-type hypersensitivity reactions to tetanus and diphtheria tested at 2.5 months of age.

MCCARL 1318.e7

J ALLERGY CLIN IMMUNOL VOLUME 124, NUMBER 6

TABLE E2. Primers used for amplification of genomic DNA and sequencing of human ORAI1, ORAI2, ORAI3, STIM1, and STIM2

STIM1 Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exons 9/10 Exon 11 Exon 12 STIM2 Exon 1 Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon Exon

2 3 4 5 6 7 8 9 10 11 12

ORAI1 Exon 1 Exon 1 Exon 2 Exon 2 ORAI2 Exon 1 Exon 2 Exon 3 ORAI3 Exon 1 Exon 1 Exon 2 Exon 2

59 Primer sequence

39 Primer sequence

PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ

AAGCTGGGACTTGATCCTTTG ATGCTAGAAGCTAAGGATGCTG GAATGTGTTATGGCTAGCTAGAG ATGTGGTAAATATTAAGGTCAGCATGAC CAATCACCAAGAGCTAGAAGTG TCTGTTATGGAAGGCTTCATAGAG AGCTGTCATTTTCCTCTTTGATGC AAAGCAGATAAGAAGTCTGAGTTCTG GCCTTTCTCATTTATTCCATTCTCG ATTCTCCAGATTGGCATTAGAGG TCCTTGTCTTCTCGTGTTGTC

CATGTACAAACCTAGATTTCAACTTGC GAAGAGGCTGTCTAAGTAGC ATGTTCTTCTAAGGCCAAGTTGC TTAACTGGCCAGAGCAATCTG TGGAAATAGTATAGGTGCTATCTTGC AGTTTTGGAAGGATGATGCAGC TGACTCTAGAACATAGTCTTTGGATC ACCACCAGGATATCTCTTCAC CATCTGCTGTTTAAGCACAACAG CTTCAGAACTGAAAGACTGTCC AACAGCAACTAAGACATGCACTG

PCR SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ PCR1SEQ

AAGACGCCGTACCTTTCTACC TAACCGGAACCAATGAACGC ACATAACTCCTGGTTGTAGTTGC GGTGGCGTTACGATTAGTAGC GGCTTTCTTCTTCTCATAGAGTGC CTAAGTTTGCACTGAAGAGG GAATTTTAAAAGGCTAGAGCTTGTGC GCTTTCCCTGTCATTTGAACC AAGATGCACTTGAAGCTCAGC TTGGAATGCAGGGATATCTTGG CATGTATTGCCTTTTTTCAGTGCC TCAGTAAAGGGAGATGAAACAGTG F1:CAGCATTGAGTTTTGAGAAGCC F2:GTGAACTGGCTGACTTGATGG F3:GAAAACCCGCGCTTTTATTATGG F4:CATAAGTGATTTGGTTACTGCAATGC

TGAAAAGGAAAGACGTCCGG AGATGCTGACCTCTGCACG GTTGAAGATGAAGGCAATGAGC AACTTTAGGCTCTCAGACATGC GATTGGCCAAAAGTTGACCC CTGTTAGGCTCTATTGCTTCATGC GGTTCAAATGACAGGGAAAGC AAGACAGTGAAGATGGCAAGG ACCTGAATCAGATATGAAGCAGC CAATACATGAACAGACACTGGC AACCCAATTTTTTCTCACAGATTTCG GTCTGTGGTACCTTGATATGTAGC R1:GCCCCAATGGAGTTACATTCC R2:ATGCAGTTCAAGAAGCTTCCC R3:TGTTCATCCAAACATCCATCTGC R4:GGATAGTAGTATTTGACCTGCTTGC

PCR SEQ PCR SEQ

ACAACAACGCCCACTTCTTGGTGG AGCATGCAAAACAGCCCAGG TCTTGCTTTCTGTAGGGCTTTCTG TGACAGGAGGAGAGCTAGG

TGCTCACGTCCAGCACCTC ACGGTTTCTCCCAGCTCTTC TCTCAAAGGAGCTGGAAGTGC AAGAGATCCTCCTGCCTTGG

PCR1SEQ PCR1SEQ PCR1SEQ

CCTGGTTGCCTTGGCAGCGGCT CTGGACGACAGAGTGAGACACTG AGAACATGGGTGAGTCCTGCCAG

CCGAGCGTCCCCGGTCCAATTC GCACTGATAGAGTCGTCCTCTTAG CAGGAGAAGTCATCCAGTCCTTATGG

PCR SEQ PCR SEQ

AGGGATTTGGAAGTGTGGACACCTG CTTGGATAACGTTCTTGGTGGGTAG ACCAGAACAGAACAGAGCCTTTGC GTATCAGTGATGTATCCCGATAGGC

CGTAAGAAGGGACTTGCTCAGTCC CTGTCTCCCTTGGGACCTGTTTAC TGTTAGCATCTGACAGGGTTACACC TCCTGTCCACCCAAACTTGCCAC

Reference gene assembly (and gene ID) numbers: ORAI1: NT_009775 (84876), ORAI2: NT_007933 (80228), ORAI3: NT_010393 (93129), STIM1: NT_009237 (6786), STIM2: NT_006316 (57620). ‘‘SEQ’’ indicates that primers were used for sequencing.