ORAI1 mutations abolishing store-operated Ca2+ entry cause anhidrotic ectodermal dysplasia with immunodeficiency

ORAI1 mutations abolishing store-operated Ca21 entry cause anhidrotic ectodermal dysplasia with immunodeficiency Jayson Lian, BA,a* Mario Cuk, MD, PhD,b* Sascha Kahlfuss, MD,a* Lina Kozhaya, MA,c Martin Vaeth, PhD,a
de
ric Rieux-Laucat, PhD,d,e Capucine Picard, MD, PhD,e,f Melina J. Benson, MD,a Antonia Jakovcevic, MD,g Fre Karmen Bilic, MD,h Iva Martinac, MD,b Peter Stathopulos, PhD,i Imre Kacskovics, DVM, PhD,j Thomas Vraetz, MD,k Carsten Speckmann, MD,k,l Stephan Ehl, MD,k,l Thomas Issekutz, MD,m Derya Unutmaz, MD,c and Stefan Feske, MDa New York, NY; Zagreb, Croatia; Farmington, Conn; Paris, France; London, Ontario, and Halifax, Nova Scotia, Canada; Budapest, Hungary; and Freiburg, Germany GRAPHICAL ABSTRACT

From athe Department of Pathology, New York University School of Medicine; bthe Department of Pediatrics, University Hospital Centre Zagreb, University of Zagreb, School of Medicine, Zagreb; cthe Jackson Laboratory for Genomic Medicine, Farmington; dINSERM UMR 1163, Laboratory of the Immunogenetics of Pediatric Autoimmune Diseases, Paris; eINSERM UMR1163, Imagine Institute, Paris Descartes-Sorbonne Paris Cit
e University; fthe Study Center for Primary Immunodeficiencies, Necker-Enfants Malades Hospital, Assistance Publique H^opitaux de Paris (APHP), Necker Medical School, Paris; gthe Department of Pathology and Cytology and hthe Department of Laboratory Diagnostics, University Hospital Centre Zagreb; ithe Department of Physiology and Pharmacology, Schulich School of Medicine and Dentistry, Western University, London; jImmunoGenes, Budapest; kthe Department of Pediatric Hematology and Oncology, Center for Pediatrics, and lthe Center for Chronic Immunodeficiency, Medical Center, University of Freiburg, Faculty of Medicine, University of Freiburg; and mthe Division of Immunology, Department of Pediatrics, Dalhousie University, Halifax. *These authors contributed equally to this work. Supported by National Institutes of Health grants AI097302 (to S.F.), and AI065303 (to D.U.), postdoctoral fellowships KA 4514/1-1 (to S.K.) and VA 882/1-1 (to M.V.) by the

German Research Foundation (Deutsche Forschungsgemeinschaft, DFG), and BMBF grant 01 EO0803 by the German Federal Ministry of Education and Research (to S.E. and C.S.). Disclosure of potential conflict of interest: I. Kacskovics is founder and CEO of ImmunoGenes and has the following patents: issued—European Union: EP 2 097 444 B1, Hong Kong: 2007323049, Australia: AU2007323049, Canada: CA2670389, China: CN101595128 A, and Japan: JP2010510773 (A); pending—USPTO: 12515586. S. Feske is a cofounder of Calcimedica and a coinventor on the following issued patent: WO/2007/081804. The rest of the authors declare that they have no relevant conflicts of interest. Received for publication August 25, 2017; revised October 10, 2017; accepted for publication October 25, 2017. Corresponding author: Stefan Feske, MD, Department of Pathology, New York University School of Medicine, New York, NY 10016. E-mail: [email protected]. 0091-6749/$36.00 Ó 2017 American Academy of Allergy, Asthma & Immunology https://doi.org/10.1016/j.jaci.2017.10.031

1

2 LIAN ET AL

Background: Store-operated Ca21 entry (SOCE) through Ca21 release–activated Ca21 channels is an essential signaling pathway in many cell types. Ca21 release–activated Ca21 channels are formed by ORAI1, ORAI2, and ORAI3 proteins and activated by stromal interaction molecule (STIM) 1 and STIM2. Mutations in the ORAI1 and STIM1 genes that abolish SOCE cause a combined immunodeficiency (CID) syndrome that is accompanied by autoimmunity and nonimmunologic symptoms. Objective: We performed molecular and immunologic analysis of patients with CID, anhidrosis, and ectodermal dysplasia of unknown etiology. Methods: We performed DNA sequencing of the ORAI1 gene, modeling of mutations on ORAI1 crystal structure, analysis of ORAI1 mRNA and protein expression, SOCE measurements, immunologic analysis of peripheral blood lymphocyte populations by using flow cytometry, and histologic and ultrastructural analysis of patient tissues. Results: We identified 3 novel autosomal recessive mutations in ORAI1 in unrelated kindreds with CID, autoimmunity, ectodermal dysplasia with anhidrosis, and muscular dysplasia. The patients were homozygous for p.V181SfsX8, p.L194P, and p.G98R mutations in the ORAI1 gene that suppressed ORAI1 protein expression and SOCE in the patients’ lymphocytes and fibroblasts. In addition to impaired T-cell cytokine production, ORAI1 mutations were associated with strongly reduced numbers of invariant natural killer T and regulatory T (Treg) cells and altered composition of gd T-cell and natural killer cell subsets. Conclusion: ORAI1 null mutations are associated with reduced numbers of invariant natural killer T and Treg cells that likely contribute to the patients’ immunodeficiency and autoimmunity. ORAI1-deficient patients have dental enamel defects and anhidrosis, representing a new form of anhidrotic ectodermal dysplasia with immunodeficiency that is distinct from previously reported patients with anhidrotic ectodermal dysplasia with immunodeficiency caused by mutations in the nuclear factor kB signaling pathway (IKBKG and NFKBIA). (J Allergy Clin Immunol 2017;nnn:nnn-nnn.) Key words: Ca21 release–activated Ca21 channel, store-operated Ca21 entry, calcium, ORAI1, T cells, regulatory T cells, invariant natural killer T cells, immunodeficiency, combined immunodeficiency, anhidrotic ectodermal dysplasia

Ca21 is an important second messenger required for activation of lymphocytes and other cell types within and outside the immune system. Ca21 influx in lymphocytes is initiated by antigen receptor binding that results in activation of phospholipase Cg and production of inositol-1,4,5-trisphosphate (IP3), which binds to IP3 receptors in the endoplasmic reticulum (ER) membrane. Opening of IP3 receptors mediates release of Ca21 from the ER and activation of stromal interaction molecule (STIM) 1 and STIM2, which are located in the ER membrane.1,2 Activated STIM1 and STIM2 bind to ORAI1, a tetraspanning plasma membrane protein that forms the pore of the Ca21 release–activated Ca21 (CRAC) channel.3-5 Opening of the CRAC channel results in Ca21 influx or store-operated Ca21 entry (SOCE) because it is regulated by the filling state of ER Ca21 stores. SOCE is an essential Ca21 signaling pathway in lymphocytes and required for the activation of many Ca21-dependent enzymes and transcription

J ALLERGY CLIN IMMUNOL nnn 2017

Abbreviations used AIHA: Autoimmune hemolytic anemia ANA: Antinuclear antibody AR: Autosomal recessive CID: Combined immunodeficiency CMV: Cytomegalovirus CRAC: Ca21 release–activated Ca21 dOrai: Drosophila melanogaster Orai EDA: Anhidrotic ectodermal dysplasia EDA-ID: Anhidrotic ectodermal dysplasia with immunodeficiency EM: Electron microscopy ER: Endoplasmic reticulum FOXP3: Forkhead box P3 GAPDH: Glyceraldehyde-3-phosphate dehydrogenase HD: Healthy donor H&E: Hematoxylin and eosin HSCT: Hematopoietic stem cell transplantation iNKT: Invariant natural killer T IP3: Inositol-1,4,5-trisphosphate NF-kB: Nuclear factor kB NK: Natural killer PAS: Periodic acid–Schiff RSV: Respiratory syncytial virus SOCE: Store-operated Ca21 entry STIM: Stromal interaction molecule TCR: T-cell receptor TM: Transmembrane domain Treg: Regulatory T UCS: Unit citrate synthase

factors that control the differentiation, proliferation, and function of cells in the immune system.6 The importance of SOCE for immunity is apparent from autosomal recessive (AR) null mutations in ORAI1 and STIM1 genes that cause a combined immunodeficiency (CID) syndrome characterized by recurrent and severe viral, bacterial, and fungal infections (Table I).3,7-13 In contrast to patients with severe combined immunodeficiency who lack T cells, B cells, or both,14 numbers of T and B cells are largely normal in STIM1and ORAI1-deficient patients.15 However, the function of T cells, natural killer (NK) cells, and potentially other immune cells is impaired. In addition, patients present with lymphoproliferation (lymphadenopathy and hepatosplenomegaly) and autoimmunity that is characterized by hemolytic anemia, thrombocytopenia, or both associated with autoantibodies against red blood cells and platelet glycoproteins.10 In addition to immune dysregulation, patients lacking SOCE experience congenital muscular hypotonia, defects in dental enamel development, and anhidrosis.15 It is noteworthy that the clinical phenotypes of patients with AR ORAI1 and STIM1 mutations are very similar (although ORAI1 mutations can cause a more severe immunodeficiency requiring hematopoietic stem cell transplantation [HSCT] within the first year of life). Because of the conserved clinical phenotype resulting from ORAI1 and STIM1 mutations, we have named the resulting disease syndrome CRAC channelopathy.16 ORAI1 and STIM1 mutations are rare, and limited patient material is available to study the effects of impaired CRAC channel function on immune cell populations and function.9 Therefore the full clinical spectrum and immune dysfunction associated with CRAC channel dysfunction remains to be carefully studied. The identification

LIAN ET AL 3

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

TABLE I. Summary of clinical and laboratory findings in patients P1 to P4 Patient P1 (A-II-1)

Patient

Inheritance Type of mutation ORAI1 mutation ORAI1 expression

AR 1nt deletion (c.del541C) p.V181SfsX8

Patient P2 (B-II-1)

Patient P3 (C-II-2)

Patient P4 (C-II-1)

Patient P5*

Patient P6*

AR Missense (c.T581C)

AR Missense (c.G292C)

AR Missense (c.G292C)

AR Missense (c.C271T)

AR Missense (c.C271T)

p.L194P

p.G98R

p.G98R

p.R91W

p.R91W

mRNA: normal Protein: abolished

mRNA: normal Protein: abolished

mRNA: NT Protein: NT

mRNA: normal Protein: normal

mRNA: normal Protein: normal

SOCE SOCE defect observed in: Infections Rotavirus enteritis, Pneumocystis jirovecii pneumonia

Abolished Fibroblasts

Abolished Fibroblasts and T cells

NT NT

Abolished Fibroblasts and T cells

Klebsiella pneumoniae and Candida albicans sepsis, Staphylococcus aureus pneumonia, CMV pneumonitis, Enterobacter cloacae sepsis, Norovirus and Salmonella enteritidis gastroenteritis, bacterial meningitis

Autoimmunity

NR

Anemia, thrombocytopenia

Lymphocytes

na€ıve CD45RA1 Normal T cells Y

RSV and rotavirus, Pseudomonas therapy-resistant aeruginosa, CMV pneumonias, Staphylococcus Stenotrophomonas aureus, Klebsiella maltophilia, pneumoniae, extended-spectrum bStreptococcus lactamase–producing pneumoniae, Klebsiella pneumoniae, Aspergillus Candida albicans, fumigatus, Candida Aspergillus fumigatus, albicans, RSV, BCGitis after adenovirus, vaccination influenza, parainfluenza, disseminated CMV sepsis with encephalitis, pneumonitis, colitis, chorioretinitis and adrenalitis, BCGitis after vaccination, Acinetobacter baumannii, Enterococcus faecalis, rotavirus, adenovirus Coombs-positive AIHA, Coombs-positive AIHA, anti-cardiolipin antiphospholipid antibodies, ANA and syndrome ANCA (anticardiolipin and anti–b2-glycoprotein 1 antibodies), autoimmune neutropenia and thrombocytopenia 1 1 CD41 T cells [ CD4 T cells[, CD8 CD81 T cells Y T cells Y, naive CD45RA1 T cells Y, CD41CD251Foxp31 Treg cells Y

Abolished Fibroblasts, T cells, B cells Rotavirus enteritis

Lymphocyte function Antibodies

T-cell IFN-g production Y proliferation YY Oligoclonal Hyper/ IgA [, IgM [, dysgammaglobulinemia l chains [, (IgA, IgG, IgM [) no seroconversion

T-cell proliferation Y

Myopathy

Congenital Congenital muscular muscular hypotonia, mydriasis hypotonia with type 2 muscle fiber atrophy, esotropia

Congenital muscular hypotonia, mydriasis, partial iris hypoplasia

mRNA: normal Protein: abolished Abolished Fibroblasts

IgE [

BCGitis, meningitis, rotavirus enteritis, interstitial pneumonia, gastrointestinal sepsis

NR

ANA1

CD31HLA-DR1 [, CD41CD291 [

CD31HLA-DR1 [, CD41CD291 [ CD41CD251Foxp31 Treg cells Y, iNKT cells Y, gd T cells [

IFN-g and IL-4 T-cell proliferation Y production Y Cytokine production Y IgA/IgG inversion, Normal to [ IgE [, IgM, IgG, IgA immunoglobulin against red blood levels cells and platelets No specific antibody response

T-cell proliferation Y Cytokine production Y Normal to [ immunoglobulin levels No specific antibody response

Congenital muscular Congenital muscular hypotonia, mydriasis hypotonia, mydriasis

Congenital muscular hypotonia

(Continued)

4 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

TABLE I. (Continued) Patient P1 (A-II-1)

Patient

EDA

Patient P2 (B-II-1)

Anhidrosis, Anhidrosis, sparse/ dental enamel thin/brittle hair hypoplasia, Teeth: NR  mild hypotrichosis

Other Pathologic complications fractures after trivial traumata, mineral bone density Y Outcome HSCT at 13 mo

Hepatosplenomegaly, lymphadenopathy

Deceased at 7.5 mo

Patient P3 (C-II-2)

Patient P4 (C-II-1)

Patient P5*

Anhidrosis, dry and Anhidrosis, dry and NR  exfoliate skin, exfoliate skin, sparse/ sparse/thin/brittle thin/brittle hair, hair, dental enamel Hypocalcified hypoplasia amelogenesis imperfecta (type III) Hepatosplenomegaly, Hepatosplenomegaly, Small thymus CNS: atrophy of deep lymphadenopathy white matter around peritrigonal area of the brain HSCT at 7 mo; postDeceased at 2.5 y HSCT complications: CMV infections, AIHA, skin GVHD, hepatic veno-occlusive disease, BCGitis

Deceased at 11 mo

Patient P6*

Anhidrosis, hypocalcified amelogenesis imperfecta (type III)

Bronchiectasis

First HSCT at 4 mo; loss of donor chimerism and CMV infection at 19 y; isolation of PBMCs before second HSCT at 20 y

ANCA, Antineutrophil cytoplasmic antibody; NR, not reported; NT, not tested. *For detailed case reports of patients P5 and P6, see Feske et al (1996)12 and Feske et al (2000).13  Patient died before complete dentition.

and characterization of CRAC channel mutations is essential to understand the molecular regulation of CRAC channels and their role in human immunity and the physiologic function of other organs. Here we identify 4 patients from unrelated kindreds with 3 novel AR mutations in ORAI1. All mutations resulted in abolished ORAI1 protein expression and SOCE. ORAI1 mutations were associated with impaired T-cell function and reduced numbers of invariant natural killer T (iNKT) and Treg cells, whereas gd T cells and NK cell subsets were altered in their composition. Reduced lymphocyte function and composition likely contribute to CID, whereas decreased Treg cell numbers might account for their lymphoproliferation and autoimmunity. All 4 patients had amelogenesis imperfecta and anhidrosis. Null mutations in ORAI1 represent a new form of anhidrotic ectodermal dysplasia with immunodeficiency (EDA-ID) that is distinct from EDA-ID observed in patients with mutations in genes (IKBKG and NFKBIA) mediating nuclear factor kB (NF-kB) signaling.17,18

METHODS Patients Case reports for patients P1 to P4 and P6 are provided in the Methods section in this article’s Online Repository at www.jacionline.org and summarized in Table I.

Cell culture Fibroblasts from patients and healthy donors (HDs) were cultured in RPMI 1640 medium supplemented with 10% FCS, 1% L-glutamine, 1% HEPES, and 1% penicillin/streptomycin (all from Mediatech, Manassas, Va). SOCEdeficient PBMCs from patients P3 and P6 before their first and second HSCTs, respectively, and an HD were isolated from whole blood by means of Ficoll density centrifugation (GE Healthcare, Marlborough, Mass) and stimulated with irradiated buffy coat cells, irradiated B cells, PHA (1 mg/mL), and rhIL-2 (50 U/mL) for 10 to 12 days.

Flow cytometry For immune phenotyping of patients’ blood, 5 3 105 fresh or frozen PBMCs from patients and HDs were incubated with antibodies against cell-surface proteins and the fixable Viability Dye eFluor506 (eBioscience, Carlsbad, Calif), followed by antibody staining of intracellular molecules with the IC staining kit (eBioscience, Carlsbad, Calif). A complete list of antibodies and conjugated fluorochromes can be found in Table E1 in this article’s Online Repository at www.jacionline.org. Samples were acquired on a LSRII flow cytometer (BD Biosciences, San Jose, Calif) and analyzed by using FlowJo software (TreeStar, Ashland, Ore). The gating strategy for the identification of NK, iNKT, and gd T cells is shown in Fig E1 in this article’s Online Repository at www.jacionline.org. For ORAI1 cell-surface protein expression, fibroblasts from patients and HDs were stained with an Alexa Fluor 647–conjugated anti-human ORAI1 mAb (2C1.1) that recognizes an epitope in the second extracellular loop of ORAI1 (kind gift of H. McBride; Amgen, Thousand Oaks, Calif). Unstained cells served as negative controls.

Time-lapse Ca21 imaging Ca21 imaging was performed, as described previously.19 Briefly, cells were loaded with Fura-2 AM (Invitrogen, Carlsbad, Calif) and stimulated as indicated in the figures. Fura-2 emission ratios (F340/380) were calculated every 5 seconds for > 30 cells per experiment analyzed as indicated in figure legends. Additional methods and case reports are available in the Methods section in this article’s Online Repository.

RESULTS Identification of patients with novel mutations in ORAI1 We investigated gene defects in 4 patients from 3 independent kindreds who presented with a combination of severe infections in the first year of life, muscular hypotonia, tooth defects, and anhidrosis. Patient P1 (A-II-1; Fig 1, A) was born to consanguineous parents. Early after birth, he suffered from viral infections and at 6 months had a severe Pneumocystis jirovecii pneumonia (for details, see case report in the Methods section in this article’s Online Repository and Table I). In addition to immunodeficiency,

LIAN ET AL 5

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

A

C

E

B

D

F

G

H

I

FIG 1. Three novel AR ORAI1 mutations associated with CRAC channelopathy. A-F, Pedigrees (Fig 1, A, C, and E) and mRNA/protein sequences of ORAI1 mutations (Fig 1, B, D, and F) identified in 3 unrelated kindreds. Fig 1, A and B, Patient P1 (A-II-1) of kindred A is homozygous for a single nucleotide deletion (c.del541C) in exon 2 of ORAI1 that results in a frameshift and premature stop codon in TM3 of ORAI1 protein (p.V181SfsX8). Fig 1, C and D, Patient P2 (B-II-1) is homozygous for a single nucleotide transition (c.T581C) in exon 2 of ORAI1 that results in a single amino acid substitution in TM3 (p.L194P). Fig 1, E and F, Patient P3 (C-II-2) and his sister, patient P4 (C-II-1), are homozygous for a single nucleotide transversion (c.G292C) in exon 1 of ORAI1 that results in a single amino acid substitution in TM1 (p.G98R). In Fig 1, A, C, and E, solid symbols represent patients, dots in open symbols represent confirmed heterozygous carriers, and double lines indicate consanguinity. G, Homology model of the hexameric human ORAI1 protein structure modeled on the Drosophila melanogaster Orai crystal structure.21 Tertiary structure of the ORAI1 hexamer from the side (top) and extracellular side of the plasma membrane (PM) revealing the channel pore (bottom). The inner (IN) and outer (OUT) leaflets of the PM are indicated; TM domains are color coded (TM1, yellow; TM2, orange; TM3, green; and TM4, blue). Amino acid residues mutated in patients P1 to P4 are shown in color (V181, red; L194, magenta; and G98, blue). H and I, Structure models of wild-type (top) and mutant (bottom) ORAI1 (Fig 1, H, p.G98R; Fig 1, I, p.L194P). Models orient the mutant side chains in positions homologous to the wild-type residues and do not show an experimentally determined structure of mutant proteins.

6 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

1.25

CTRL P1

1.0

0.50

0.5

0.25

0.8 0.6 0.4

0.02

0.01

0.2 0.0

B

400

600

Time (s)

0

2 1.00

0

800

E

20 mM Ca2+

Time (s)

2

1.00

TG

0

0

0

100 200 300 400 500 600

20 mM Ca2+

CT RL P1 P +O 1 P1 RA +S I1 TI M 1

200

P1 P +O 1 P1 RA +S I1 TI M 1

0

CT RL

0

1.0

P1+ORAI1 P1+STIM1

1.5

Ca2+ Influx Rate

Peak [Ca2+]i

1.2

TG

F340/380

0.75

G

1 20 mM Ca 2+

0

2.0

TG

1.00

F340/380

D

1 20 mM Ca 2+

0

F(340/380)/s

1

F-F0 (340/380)

A

H

TG

Peak [Ca2+]i

0.8

Ca2+ Influx Rate

0.02

P2+ORAI1 P2+STIM1

0.50

0.6

F(340/380)/s

0.75

F-F0 (340/380)

CTRL P2

0.75

F340/380

F340/380

0.7 0.5 0.4

0.01

0.3

0.50

0.2 0.1

C

200

Time (s)

0

2 1.00

600

20 mM Ca2+

100 200 300 400 500 600

Time (s)

2

0

20 mM Ca2+

RL P2 AI1 IM1 R T CT +O +S P2 P2

RL P2 AI1 IM1 R T +O +S P2 P2

CT

Ca2+ Influx Rate

Peak [Ca2+]i 0.8 0.7

P3+ORAI1 P3+STIM1

0.75

0.50

I

TG

1.00

CTRL P3

0.75

F 1.25

TG

0.0

0

0

F340/380

F340/380

400

0.50

0.02

0.6

F(340/380)/s

0

0.25

F-F0 (340/380)

0.25

0.5 0.4 0.3 0.2

0.01

0.1

Time (s)

0

0

L +O P3 P3 RA +S I1 TI M 1

100 200 300 400 500 600

P3

0

TR

Time (s)

600

C

400

L P3 +O P3 P3 RA +S I1 TI M 1

200

TR

0

C

0.25

0.25

FIG 2. ORAI1 mutations abolish SOCE. A-C, SOCE measurements in fibroblasts of patients P1, P2, and P3 and an HD control subject (CTRL). Cells were loaded with Fura-2 and stimulated with thapsigargin (TG) in the absence of extracellular Ca21, followed by readdition of 20 mmol/L (mM) Ca21. Traces show intracellular Ca21 levels (F340/380) recorded by using time-lapse microscopy and represent the average 6 SEM of more than 64 cells from 1 representative experiment. D-F, Fibroblasts from patients P1, P2, and P3 were retrovirally transduced with bicistronic vectors encoding wild-type ORAI1 (internal ribosome entry site [IRES]–green fluorescent protein [GFP]) or STIM1 (IRES-GFP). Intracellular Ca21 levels in GFP1 fibroblasts were measured, as described in Fig 2, A-C. Shown are Ca21 traces from 1 representative experiment; more than 30 cells were analyzed. G-I, Bar graphs show means 6 SEMs of peak intracellular Ca21 levels after TG stimulation and readdition of 20 mmol/L Ca21 (left) and the Ca21 influx rate in the first 20 seconds after readdition of Ca21 (right). Ca21 traces in Fig 2, A-F, and bar graphs in Fig 2, G-I, are representative of 2 (patients P2 and P3) and 3 (patient P1) independent experiments.

patient P1 presented with congenital muscular hypotonia and symptoms of EDA (see below). Because his symptoms were consistent with CRAC channelopathy caused by mutations in either ORAI1 or STIM1,9,10,15,20 we performed genomic DNA sequencing of both genes. Patient P1 was homozygous for a single cytosine nucleotide deletion at position 541 of the ORAI1 mRNA (c.del541C). Both parents were heterozygous for the same mutation (Fig 1, A, and see Fig E2, A, in this article’s Online Repository at www.jacionline.org). The ORAI1 c.del541C mutation results in a frameshift and subsequent premature stop codon (p.V181SfsX8) in the third transmembrane domain (TM3) of the ORAI1 protein (Fig 1, B).

Patient P2 (B-II-1; Fig 1, C) was born to nonrelated parents. She presented acutely at 2 months of age with meningitis, pneumonia, and gastroenteritis. Her clinical condition was characterized by opisthotonus, tachycardia, tachypnea, hyperpyrexia, vomiting, diarrhea, and dehydration. At 3.5 months, patient P2 deteriorated because of sepsis, massive bilateral Staphylococcus aureus pneumonia, and cytomegalovirus (CMV) pneumonitis. Patient P2 continued to experience multiple life-threatening infections with viral, bacterial, and fungal pathogens to which she succumbed at 7.5 months (see case report in the Methods section in this article’s Online Repository and Table I). Genomic DNA sequencing revealed that she was

LIAN ET AL 7

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

A

D CTRL

0.006

ns

0.004 0.002 0.000

CTRL

P1

B

P1

100

100

800

80

80

600

60

60

40

40

20

20

0

10

2

10

3

10

4

5

10

0

(p=0.002)

**

Δ MFI

relative ORAI1 mRNA expression

0.008

400 200

10

2

3

10

10

4

10

0

5

CTRL

P1

E CTRL

0.006 0.004 0.002 0.000

C

CTRL

relative ORAI1 mRNA expression

0.008

P2

0.006 0.004 0.002 0.000

CTRL

100

80

80

60

60

40

40

20

20

0

10

2

10

F

ns

P3

P2

100

3

10

4

10

5

0

80

80

60

60

40

40

20

20 10

2

10

3

10

4

10

5

0

*

400 200

10

2

10

3

10

4

10

P3 100

(p=0.02)

600

CTRL

100

0

800 Δ MFI

ns

0

5

800

CTRL

P2

(p=0.004)

**

600

Δ MFI

relative ORAI1 mRNA expression

0.008

400 200 0

10

2

10

3

10

4

10

5

CTRL

P3

ORAI1 αORAI1

unstained

FIG 3. ORAI1 mutations abolish protein expression. A-C, Bar graphs show means 6 SEMs of ORAI1 mRNA isolated from fibroblasts of patients P1 (Fig 2, A), P2 (Fig 2, B), and P3 (Fig 2, C) compared with HD control fibroblasts (CTRL) and measured by using quantitative real-time PCR. D-F, Flow cytometric analysis of ORAI1 (red) at the surfaces of fibroblasts from patients P1 (Fig 3, D), P2 (Fig 3, E), and P3 (Fig 3, F) and HD control fibroblasts (CTRL) using an antibody against the second extracellular domain of ORAI1. Unstained fibroblasts were used as controls (gray). Bar graphs show the average of D mean fluorescence intensities (DMFIs; calculated as MFIORAI1 2 MFIunstained control) 6 SEM. Data in Fig 3, A-C and D-F, represent 2 independent experiments for each patient. Statistical significance was calculated by using the unpaired Student t test: *P < .05 and **P < .01.

homozygous for an AR missense mutation (c.T581C) in ORAI1. Both parents of patient P2 and her sister were heterozygous for the same mutation (Fig 1, C, and see Fig E2, B). The c.T581C mutation causes substitution of a single amino acid (p.L194P) in TM3 of the ORAI1 protein (Fig 1, D). Patient P3 (C-II-2; Fig 1, E) was born to nonrelated parents and soon after birth had acute bronchiolitis caused by respiratory syncytial virus (RSV). In the first months of his life, he experienced various recurrent viral and bacterial infections, including persistent CMV infection (see the case report in the Methods section in this article’s Online Repository at www.jacionline.org and Table I). Genomic DNA sequencing revealed that patient P3 is homozygous for a missense mutation (c.G292C) in ORAI1. The mutation results in substitution of a single amino acid (p.G98R) within TM1 of ORAI1 protein (Fig 1, F). Both parents of patient P3 and a healthy brother were heterozygous for the same mutation, whereas his older sister, patient P4 (C-II-1), was homozygous for the same ORAI1 p.G98R mutation (Fig 1, E, and see Fig E2, C). From

approximately 3.5 months of age, she had frequent, severe, and prolonged respiratory tract infections caused by various bacterial, fungal, and viral pathogens, including CMV (see the case report in the Methods section in this article’s Online Repository and Table I). In her second year of life, patient P4 developed respiratory failure requiring mechanical ventilation. She continued to have multiple infections, including CMV, that caused pneumonitis, chorioretinitis with blindness, colitis, and encephalitis, from which she died at age 2.5 years. In addition, patient P4 had life-threatening antiphospholipid syndrome (APS) and multiple episodes of autoimmune hemolytic anemia (AIHA) and thrombocytopenia associated with gastrointestinal bleeding.

Modeling of ORAI1 mutations on the crystal structure of Drosophila melanogaster Orai The scaled Combined Annotation-Dependent Depletion scores of the 3 ORAI1 mutations were 35.0 (patient P1), 26.5

8 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

A

B

D

C

E

LIAN ET AL 9

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

(patient P2), and 32.0 (patients P3 and P4), indicating that they are within the top 1% (patient P2) and 0.1% (patients P1, P3, and P4) of the most deleterious variants in the human genome. To understand the effects of the mutations on ORAI1 function, we generated a homology model of the human ORAI1 protein structure that is based on the Drosophila melanogaster Orai (dOrai) crystal structure.21 Like dOrai, ORAI1 is a tetraspanning plasmamembrane protein that assembles into a functional hexameric CRAC channel complex.3,21,22 The channel pore is formed by an inner ring of 6 TM1 domains that is surrounded by concentric rings of TM2/TM3 and TM4 domains. Previously, we described mutations in TM1 and TM3 that either abolish protein expression or result in nonfunctional proteins.3,9 Fig 1, G, shows the position of the 3 residues mutated in patients P1 to P4 in the human ORAI1 protein structure model.21 G98 is located in TM1 and faces the lumen of the open CRAC channel pore (Fig 1, G and H).23 The large and positively charged side chain of the arginine (R) substitution at G98 is predicted to occlude the CRAC channel pore (Fig 1, H). L194 is located toward the extracellular end of the TM3 a-helix (Fig 1, G and I). This position is in the same lateral plane as the pore-lining E106 residue in TM1 that is involved in Ca21 binding21,24 and in close proximity (<5  A) to several hydrophobic residues of TM1 that surround E106 (Fig 1, I). We hypothesized that the location of the G98R and L194P mutations in TM1 and TM3, respectively, likely interferes with ORAI1 protein function or stability.

ORAI1 mutations abolish SOCE and protein expression To investigate whether ORAI1 mutations impair CRAC channel function, we measured Ca21 influx in fibroblasts of the 3 patients and HDs. Stimulation of cells with thapsigargin in the absence of extracellular Ca21 resulted in a transient increase in the intracellular Ca21 concentration caused by Ca21 release from ER stores, which was comparable in cells from patients and HDs (Fig 2, A-C). Readdition of extracellular Ca21 resulted in strong SOCE in fibroblasts from HDs, whereas SOCE was strongly reduced or absent in fibroblasts from all 3 patients (Fig 2, A-C and G-I). To validate that abolished SOCE in patients’ fibroblasts was caused by mutations in ORAI1, we retrovirally transduced fibroblasts with wild-type ORAI1 or STIM1 (as control). We found that Ca21 influx in fibroblasts from all 3 patients was restored by ectopic expression of ORAI1, whereas STIM1 had no effect (Fig 2, D-F and G-I). Collectively, these data demonstrate that the mutations in ORAI1 are responsible for abolished SOCE in patients P1, P2, and P3.

=

To experimentally test the effects of the mutations on channel expression, we measured ORAI1 mRNA and protein levels in the patients’ cells. ORAI1 mRNA expression was not reduced significantly in patients P1 to P3 compared with that in HD control subjects (Fig 3, A-C). To analyze ORAI1 protein expression, we incubated fibroblasts of patients P1 to P3 and HDs with an mAb that recognizes an extracellular domain of human ORAI1.25 Although ORAI1 was detectable at the surfaces of HD fibroblasts, no ORAI1 expression was found in fibroblasts of the 3 patients (Fig 3, D-F). Given normal mRNA expression, the V181SfsX8, L194P, and G98R mutations likely abolish ORAI1 expression by interfering with protein stability.

ORAI1 mutations impair T-cell function and perturb iNKT, NK, Treg, and gd T-cell populations Patients with mutations in ORAI1 have CID with lifethreatening infections. The early onset, severity, and type of infections in ORAI1-deficient patients resembles that observed in patients with severe CID. Unlike severe combined immunodeficiency (SCID), however, the development of conventional T and B cells is largely preserved in the limited number of patients with ORAI1 null mutations reported to date.15 Here we confirm that patients P1 to P4 have numbers of conventional CD31 T and CD191 B cells that are normal or only slightly outside the normal range (Table I and see Table E2 in this article’s Online Repository at www.jacionline.org). Some ORAI1-deficient patients (patients P3 and P4) had an increased CD4/CD8 T-cell ratio that was not present in patients P1 and P2 or previously published patients and might be due to their chronic systemic infections (see Table E1). To better understand the role of CRAC channels in lymphocyte development and function, we analyzed T cells from patient P3 and a previously reported patient (patient P6) with a null mutation in ORAI1 (p.R91W) that abolishes SOCE3 because PBMCs from other patients (P1, P2, and P4) were not available for an in-depth analysis. We first confirmed that T cells isolated from patient P3 before HSCT have a defect in SOCE similar to that of his fibroblasts (Fig 4, A). Functionally, the T cells of patients P1 and P3 showed strongly reduced or absent proliferation in response to PHA, other mitogens, and specific antigens (see Table E2). In addition, stimulation of ORAI1-deficient T cells resulted in strongly decreased production of IFN-g (patients P2 and P4) and IL-4 (patient P4, Table I). Impaired production of IL-2, TNF-a, and IL-22 was also observed in CD45RO1 effector T cells of patient P6 isolated at 20 years of age (Fig 4, B).3 Note that patient P6 was treated with HSCT at 4 months but had completely lost donor chimerism in his lymphocytes and

FIG 4. Impaired T-cell function and reduced numbers of Treg cells in ORAI1-deficient patients. A, Measurements of SOCE in T cells from patient P3 and a healthy control subject (CTRL) by using time-lapse microscopy. Cells were stimulated with thapsigargin (TG), followed by readdition of 1.2 mmol/L (mM) extracellular Ca21. Traces show intracellular Ca21 levels (F340/380) of greater than 60 cells (average 6 SEM). Bar graphs represent means 6 SEMs of SOCE in 1.2 mmol/L extracellular Ca21 F, peak SOCE; F0, baseline Ca21 (top) and the Ca21 influx rate in the first 20 seconds after readdition of Ca21 (bottom). Data are representative of 3 experiments. B, Cytokine production by PBMCs from patient P6 (ORAI1 p.R91W)3 isolated at 20 years of age and an adult HD control subject. PBMCs were stimulated with phorbol 12-myristate 13-acetate (PMA; 40 ng/mL) and ionomycin (500 ng/mL) for 4 hours and analyzed by using intracellular cytokine staining and flow cytometry. C and D, Flow cytometric analysis of PBMCs from the 20-year-old patient P6 and a representative HD control subject for naive, central memory, and effector memory CD41 and CD81 T cells (Fig 4, C) and FOXP31 Treg cells (Fig 4, D). E, Flow cytometric analysis of PBMCs from patient P3 (ORAI1 p.G98R) and an HD control subject for FOXP31 Treg cells. Contour plots are gated on CD41 cells. Numbers in red in Fig 4, B-E, indicate marked differences in T-cell subsets in patient P3 and P6 compared with HD control subjects.

10 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

FIG 5. Lack of iNKT cells and perturbed NK and gd T-cell populations in ORAI1-deficient patients. A-C, Flow cytometric analysis of PBMCs from the 20-year-old patient P6 and a representative HD control subject for NK cells (Fig 5, A), iNKT cells (Fig 5, B), and gd T cells (Fig 5, C). Fig 5, A, For detection of NK cells, CD32HLA-DR2 lymphocytes were stained with antibodies against CD16 and CD56. Fig 5, B, For detection of iNKT cells, lymphocytes were stained with antibodies against CD3 and the Va24Ja18 TCR. Fig 5, C, For detection of CD42CD81 and CD42CD82 gd T cells, lymphocytes were stained with antibodies against CD3 and the gd TCR. Numbers in red in Fig 5, A-C, indicate marked differences in T-cell subsets in patient P6 compared with HD control subjects. D, Frequencies of CD161CD561, CD162CD561, and CD161CD562 NK cells, CD31Va24Ja181 iNKT cells, and CD42CD81 or CD42CD82 gd T cells in PBMCs of patient P6 (blue circles) from Fig 5, A-C, compared with 23 unrelated HD control subjects (age, 22-65 years). Whisker plots show the median, 25th-75th percentiles, and minimum and maximum values of the distribution of HDs.

thus SOCE by 19 years of age.26-28 These defects are consistent with previous reports of other ORAI1- and STIM1-deficient patients demonstrating a critical role of SOCE in cytokine production and proliferation of T cells.8,9,12,29 To evaluate the effects of ORAI1 deficiency on lymphocyte development, we analyzed PBMCs of patients P3 and P6. The analysis of CD41 and CD81 T cells of patient P6 showed reduced numbers of naive CD45RO2CCR71 T cells in both subsets compared with an HD control (Fig 4, C). We observed a reciprocal increase of CD41CD45RO1CCR71 central and CD81CD45RO1CCR72 effector memory T cells in patient P6

compared with an HD control (Fig 4, C, middle and lower panels). Loss of naive CD45RA1 T cells and concomitant expansion of CD45RO1 or HLA-DR1 activated T cells is also found in patients P1 and P3 (Table I and see Table E2), as well as previously reported SOCE-deficient patients.8,9,12 ORAI1-deficient patients P2, P3, and P4 had AIHA, autoimmune thrombocytopenia, neutropenia, and antiphospholipid syndrome (see case reports in the Methods section in this article’s Online Repository and Table I), suggesting that SOCE is required for maintaining immunologic tolerance. Therefore we tested whether lack of ORAI1 in patients affects Treg cell numbers.

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

Patient P6 showed a profound reduction of CD271 forkhead box P3 (FOXP3)1, CD45RO2FOXP31, and CD45RO1FOXP31 Treg cells compared with those in an HD control subject (Fig 4, D).29 Similarly, patient P3 showed strongly decreased percentages of CD251FOXP31 Treg cells and CD251CD127low T cells (Fig 4, E), which normally express high levels of FOXP3 and effectively suppress T-cell proliferation.30 The strong reduction in numbers of Treg cells in patient P3 was also observed in CD45RA1FOXP3low naive and CD45RA2FOXP31 activated Treg cells (Fig 4, E). The decrease in Treg cell numbers likely contributes to the loss of naive T cells, autoimmunity, and lymphadenopathy observed in patient P3 and other ORAI1-deficient patients. Deletion of Stim1 and Stim2 in murine T cells was shown to impair the development of agonist-selected T cells, including, in addition to Treg cells, iNKT cells and T-cell receptor (TCR) ab1CD8aa1 intestinal intraepithelial lymphocytes.31 Therefore we analyzed iNKT cells together with NK cells in PBMCs from the 20-year-old patient P6 compared with 23 unrelated adult HD control subjects. Within the NK cell compartment, numbers of CD561CD161 NK cells, the main population in human blood, were reduced, whereas numbers of CD562CD161 NK cells were increased compared with those in HD control subjects (Fig 5, A and D). More strikingly, we observed a complete absence of CD31 TCR Va241Ja181 iNKT cells in patient P6 compared with HD control subjects (Fig 5, B and D). Similar defects were observed when analyzing PBMCs of the 5-month-old patient P6 (data not shown). Given the important role of iNKT cells in immunity to bacterial and viral infections, the lack of iNKT cells likely contributes to the patient’s CID.32 Another nonconventional T-cell population that combines features of adaptive and innate immune cell types are gd T cells.33 We observed markedly increased frequencies of CD81 gd and CD42CD82 gd T cells in PBMCs of the 20-year-old patient P6 compared with HD control subjects (Fig 5, C and D), which might be a response to the patient’s chronic infections. Collectively, our findings indicate that SOCE is required for the development of agonist-selected iNKT and Treg cells, the marked reduction of which in ORAI1-deficient patients likely contributes to their CID and autoimmunity.

ORAI1 null mutations cause EDA In addition to CID and autoimmunity, ORAI1 mutations were associated with congenital, nonprogressive muscular hypotonia affecting the facial, axial, and respiratory musculature and causing partial iris hypoplasia (see Fig E3, A and B, in this article’s Online Repository at www.jacionline.org). Although muscle biopsy specimens from patients P2 and P3 did not reveal abnormalities in hematoxylin and eosin (H&E) staining (see Fig E3, C, and data not shown), ATPase staining of a muscle biopsy specimen of patient P1 showed a predominance of type 1 and paucity of type 2 muscle fibers (see Fig E3, D). At the ultrastructural level, muscle biopsy specimens of patients P2 and P3 revealed defects in mitochondrial morphology and viability (see Fig E3, E-L), suggesting, together with impaired electron transport chain function (see case reports in the Methods section in this article’s Online Repository), that ORAI1 deficiency may cause muscular hypotonia through mitochondrial dysfunction. This interpretation is consistent with impaired mitochondrial function in fibroblasts of ORAI1- and

LIAN ET AL 11

STIM1-deficient patients34 and T cells of Stim1/Stim2-deficient mice.35 By contrast, gain-of-function mutations in ORAI1 and STIM1 are characterized by tubular aggregate myopathy,15,36,37 indicating that precise homeostasis of SOCE is required to maintain skeletal muscle integrity and function. Furthermore, null mutations in ORAI1 were associated with EDA (see Fig E4 and Table E2 in this article’s Online Repository at www.jacionline.org). Patients P1 to P4 were unable to sweat and lacked sweat production tested by using pilocarpin iontophoresis (Table I and see Table E3). Patients P3 and P4 had dry and exfoliate skin, and at 3 and 6 months of age, respectively, they showed signs of heat intolerance and thermoregulatory instability characterized by several attacks of facial flushing accompanied by tachycardia, tachypnea, and hypertension. A skin biopsy specimen of patient P1 showed the presence of eccrine sweat glands in the dermis (Fig E4, B), demonstrating that anhidrosis is not due to a defect in sweat gland development. In addition, ORAI1-deficient patients had severe enamel defects diagnosed as hypocalcified amelogenesis imperfecta (type III, see Table E3). The teeth of patient P1 at 8 months showed pitted enamel hypoplasia and hypomineralization of incisors. He had multiple dental abscesses, 6 of his permanent teeth have been extracted, and virtually all other teeth had to be capped. The teeth of patient P3 showed severely cracked, chipped, and absent enamel with exposure of the underlying dentine (yellow) and excessive wear (see Fig E4, C). The teeth of his sister, patient P4, at 10 months of age showed yellowish discoloration (Table I). Similar defects in enamel formation were reported in other patients with null mutations in ORAI1 and STIM1 (see Table E3).15 Another feature of EDA in patients P1 to P4 was their sparse, thin, and brittle hair (Table I and see Fig E4, D, and Table E3). Taken together, mutations in ORAI1 (and STIM1) that abolish SOCE represent a new form of EDA and immunodeficiency, which is distinct from EDA-ID because of mutations in the NF-kB signaling pathway.18,38,39

DISCUSSION Here we describe 3 novel mutations in ORAI1 that abolish SOCE and cause CID, autoimmunity, and EDA in infants. One of the mutations (ORAI1 p.V181SfsX8) truncates the ORAI1 protein at the beginning of TM3, preventing expression of a functional protein in the plasma membrane. The other 2 mutations (ORAI1 p.G98R and p.L194P) abolish ORAI1 protein expression, most likely by interfering with protein stability. Modeling the mutations on the crystal structure model of human ORAI1 indicates that substitution of G98 in TM1 by arginine (G98R) occludes the CRAC channel pore or results in steric clashes of the large and positively charged arginine side chains when the mutant ORAI1 p.G98R proteins are assembled into the hexamer channel, thus destabilizing the ORAI1 protein complex. G98 is critical for ORAI1 function. It was suggested to function as a gating hinge that controls opening of the ORAI1 channel.40 Other studies showed that G98 lines the pore when the ORAI1 channel is activated by STIM141,42 but is replaced by neighboring F99 through a rotational movement of the TM1 a-helix when the channel is closed.21,23 The importance of G98 for CRAC channel function is emphasized by engineered mutations that either abolish (G98A) or constitutively activate (G98D and G98P) CRAC channel function.40 In human subjects heterozygosity for a ORAI1 p.G98S mutation causes constitutive Ca21 influx

12 LIAN ET AL

and tubular aggregate myopathy.36 By contrast, the G98R mutation we identified here abolishes SOCE by preventing ORAI1 protein expression. L194 is located in TM3, which does not line the pore but forms a concentric ring of a-helices surrounding the inner ring of TM1 domains. However, L194 is located at the extracellular end of TM3 and maps closely (<5  A) to several hydrophobic residues in TM1 next to E106, which is the Ca21 binding site in the selectivity filter of the CRAC channel.21,24 The human ORAI1 protein structure model predicts that breaking of the TM3 helix by proline substitution of L194 disrupts the TM3 backbone hydrogen bonding and perturbs the extensive network of hydrophobic interactions centered around L194. Thus the p.L194P mutation likely interferes with the stability of individual ORAI1 proteins, preventing the proper assembly of ORAI1 subunits into a hexameric channel structure and enhancing the degradation of ORAI1 proteins. Null mutations in ORAI1 result in CID and increased susceptibility to a variety of viral, bacterial, and fungal pathogens, as apparent from the broad spectrum of infections observed in patients P1 to P4. One cause of infections is impaired T-cell function, which is characterized by defective proliferation after mitogen or antigen stimulation and markedly reduced production of cytokines, including IL-2, IL-22, TNF-a, and IFN-g. These defects are consistent with similar findings in other patients with ORAI1 and STIM1 mutations.8-10,29 However, ORAI1-deficient T cells are not completely unresponsive, as demonstrated by the expansion of CD45RO1 memory CD41 and CD81 T cells, which might be due to the known role of ORAI1, STIM1, and SOCE in promoting T-cell apoptosis27,43 and reduced numbers of Treg cells (see below). In addition to impaired T-cell function, we report marked perturbations in several lymphocyte populations, including iNKT, NK, Treg, and gd T cells in ORAI1-deficient patients, which likely contribute to their CID and autoimmunity. In particular, the lack of TCR Va241Ja181 iNKT cells might impair immunity to bacterial and viral infections given the important role of iNKT cells in recognizing bacterial lipid and glycolipid antigens.32 Reduced iNKT cell counts were also found in a patient lacking STIM1 expression8 and in Stim1/Stim2-deficient mice,31 suggesting that SOCE is critical for the development of this agonistselected lymphocyte population. Total NK cell numbers were in the low-to-normal range in patients P1 to P4. In patient P6, for whom PBMCs were available for in-depth analysis, frequencies of CD561CD161 NK cells were reduced, whereas CD562CD161 NK cell numbers were increased. The increase in CD562CD161 NK cell counts is reminiscent of the expansion of a similar and highly dysfunctional population of NK cells in chronically HIV- or hepatitis C virus–infected patients.44,45 To what degree the altered NK cell subsets contribute to CID in ORAI1-deficient patients remains to be tested. In contrast to iNKT and CD561CD161 NK cells, numbers of CD81 and CD42CD82 gd T cells were increased in patient P6. The majority of these gd T cells were CD3lowgdTCRhigh, which are thought to mostly belong to the Vd1 subset46 and can be derived from intestinal tissues.47 Vd1 T cells can be expanded by inflammatory cytokines induced by microbial components.48 Thus it is conceivable that dysbiosis or microbial translocation caused by disruption of the immune system in the gut results in the expansion of these gd T cells in the patient.

J ALLERGY CLIN IMMUNOL nnn 2017

Alternatively, expansion of gd T cells also occurs in CMV infection,49 which is common in ORAI1-deficient patients. In this context it is noteworthy that increased gd T-cell numbers were observed in the 20-year-old patient P6 who had CMV infection but not in the 5-month-old patient P6, in whom CD81 gd T-cell numbers were normal and CD42CD82 gd T-cell numbers were decreased. Therefore it is likely that increased numbers of CD42CD82 gd T cells in the 20-year-old patient are secondary to his CMV infection, reduced numbers of Treg cells, or both. In addition to CID, the ORAI1-deficient patients reported here had AIHA (patients P2 to P4), autoimmune thrombocytopenia (patients P2 and P4), and autoimmune neutropenia (patient P4). Autoantibodies such as antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA), anti-cardiolipin (aCl), and anti2b2-glycoprotein (anti-b2 GP1) antibodies were detected in patients P3 and P4. Here we show that null mutations in ORAI1 are associated with reduced numbers of FOXP31 Treg cells (patients P3 and P6). This finding is consistent with similar observations in patients with null mutations in STIM18,10 and mice lacking Orai1/Orai250 or Stim1/ Stim2.29,31,51 In addition to decreased thymus-derived Treg cells, mice lacking Stim1/Stim2 also had a defect in differentiation of inducible (peripheral) Treg cells27 and follicular Treg cells.29 The latter defect results in autoantibody production, including ANAs and anti–double-stranded DNA antibodies, which is associated with spontaneous germinal center formation and an increase in germinal center B cells.29 Because Stim1/Stim2-deficient mice also have reduced follicular helper T cell counts, their ability to mount a humoral immune response to immunization or viral infection is impaired, similar to the ORAI1-deficient patients’ inability to seroconvert after vaccination. Decreased numbers of Treg cells in ORAI1-deficient patients likely cause, together with chronic infections, loss of naive T cells, as well as the patients’ autoimmunity and lymphadenopathy. Taken together, our findings suggest that SOCE is required for the development of agonist-selected iNKT and Treg cells, lack of which likely contributes to the CID and autoimmunity observed in ORAI1-deficient patients. A unifying feature of all patients with null mutations in ORAI1 (and STIM1) is EDA. Anhidrosis was present in patients P1 to P4 and confirmed by using pilocarpin iontophoresis. Anhidrosis resulted in hyperthermia with severe attacks of facial blushing, tachycardia, and tachypnea in patients P3 and P4. A skin biopsy of patient P1 confirmed the presence of eccrine sweat glands of normal morphology, which is consistent with similar findings in SOCE-deficient patients with ORAI1 p.R91W (patient P6) and STIM1 p.P165Q mutations.3,52,53 Recently, we reported that sweat glands require SOCE for opening of the Ca21-activated chloride channel TMEM16A and thus chloride secretion and sweat production.52 Impaired sweat gland function as the cause of anhidrosis is different from patients with EDA-ID caused by X-linked recessive mutations in IKBKG (NF-kB essential modulator and IKKg) or autosomal dominant mutations in NFKBIA (Ik-Ba) that suppress NF-kB signaling and are associated with absent eccrine sweat glands.38,39,54 Another characteristic feature of EDA in patients P1 to P4 (and other patients with ORAI1 and STIM1 mutations) is hypocalcified amelogenesis imperfecta (type III), a form of dental enamel hypoplasia caused by defective calcification of the enamel matrix and use-dependent attrition of the enamel layer. ORAI1 is expressed in ameloblasts (cells that deposit dental enamel), where it likely

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

mediates SOCE.55,56 An important role of SOCE in enamel formation (amelogenesis) was recently shown by us and others using Stim1fl/flStim2fl/fl K14-Cre mice, which have thin, mechanically weak, and hypomineralized teeth with decreased Ca21 content resulting in severe enamel attrition.57,58 Patients with EDA-ID caused by IKBKG or NFKBIA (Ik-Ba) mutations also have a tooth defect, which is characterized by hypodontia and conical teeth and thus is morphologically easily distinguishable from the enamel defects in ORAI1-deficient patients.59-61 Furthermore, EDA in patients P1 to P4 manifested itself in thin and brittle hair, which in the case of patient P4 was prone to fall out. This hair phenotype is partially recapitulated in Orai1-deficient mice, which have progressive hair loss.62 To date, the diagnosis of EDA-ID is limited to patients with mutations in the IKBKG (OMIM 300291) and NFKBIA (OMIM 164008) genes who present with hypotrichosis, hypodontia, hypohidrosis (anhidrotic ectodermal dysplasia [EDA]) and are prone to bacterial, viral, and fungal infections (immunodeficiency).17 Criteria for the diagnosis of EDA include sparse-toabsent hair, hypoplastic-to-absent sweat glands, and hypodontia to adontia.61 From a clinical perspective, patients with null mutations in ORAI1 (or STIM1) fulfil 3 of these criteria: sparse hair, anhidrosis, and amelogenesis imperfecta. With regard to immunodeficiency, mutations in IKBKG and NFKBIA increase susceptibility to infections with mycobacteria, P jirovecii, Candida albicans, and, most frequently, pyogenic bacteria caused by hypogammaglobulinemia and failure to mount a specific antibody response to polysaccharide antigens.61 ORAI1-deficient patients are susceptible to an overlapping spectrum of pathogens, but they are also prone to viral infections, including CMV, EBV, RSV, and rotavirus. AIHA and autoimmune thrombocytopenia are common in patients with mutations in ORAI1 and STIM1 but not IKBKG and NFKBIA; instead, patients with IKBKG mutations can have inflammatory bowel disease (NF-kB essential modulator colitis).61 Here we propose that mutations in ORAI1 and STIM1 constitute a new form of EDA-ID and are an important differential diagnosis of EDA-ID caused by mutations in IKBKG or NFKBIA. We thank Dr H.J. McBride (Amgen, Thousand Oaks, Calif) for providing the ORAI1 antibody used for FACS staining, Dr A. F. Liang (Microscopy Core, NYU School of Medicine), Dr A. M. Cuervo (Albert Einstein College of Medicine), Dr R. T. Dirksen (University of Rochester), and the Feske laboratory for helpful discussions.

Clinical implications: Mutations in ORAI1 (or STIM1) that abolish SOCE cause a new form of EDA-ID that has to be differentiated from EDA-ID caused by defects in NF-kB signaling.

REFERENCES 1. Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, et al. STIM1, an essential and conserved component of store-operated Ca21 channel function. J Cell Biol 2005;169:435-45. 2. Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE Jr, et al. STIM is a Ca21 sensor essential for Ca21-store-depletion-triggered Ca21 influx. Curr Biol 2005;15:1235-41. 3. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, et al. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006;441:179-85. 4. Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, et al. CRACM1 is a plasma membrane protein essential for store-operated Ca21 entry. Science 2006;312:1220-3.

LIAN ET AL 13

5. Zhang SL, Yeromin AV, Zhang XH, Yu Y, Safrina O, Penna A, et al. Genomewide RNAi screen of Ca(21) influx identifies genes that regulate Ca(21) release-activated Ca(21) channel activity. Proc Natl Acad Sci U S A 2006; 103:9357-62. 6. Feske S, Skolnik EY, Prakriya M. Ion channels and transporters in lymphocyte function and immunity. Nat Rev Immunol 2012;12:532-47. 7. Chou J, Badran YR, Yee CSK, Bainter W, Ohsumi TK, Al-Hammadi S, et al. A novel mutation in ORAI1 presenting with combined immunodeficiency and residual T cell function. J Allergy Clin Immunol 2015;136:479-82.e1. 8. Fuchs S, Rensing-Ehl A, Speckmann C, Bengsch B, Schmitt-Graeff A, Bondzio I, et al. Antiviral and regulatory T cell immunity in a patient with stromal interaction molecule 1 deficiency. J Immunol 2012;188:1523-33. 9. McCarl CA, Picard C, Khalil S, Kawasaki T, Rother J, Papolos A, et al. ORAI1 deficiency and lack of store-operated Ca21 entry cause immunodeficiency, myopathy, and ectodermal dysplasia. J Allergy Clin Immunol 2009;124:1311-8.e7. 10. Picard C, McCarl CA, Papolos A, Khalil S, Luthy K, Hivroz C, et al. STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med 2009;360:1971-80. 11. Klemann C, Ammann S, Heizmann M, Fuchs S, Bode SF, Heeg M, et al. Hemophagocytic lymphohistiocytosis as presenting manifestation of profound combined immunodeficiency due to an ORAI1 mutation. J Allergy Clin Immunol 2017 [Epub ahead of print]. 12. Feske S, Muller JM, Graf D, Kroczek RA, Drager R, Niemeyer C, et al. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in T lymphocytes of two male siblings. Eur J Immunol 1996; 26:2119-26. 13. Feske S, Draeger R, Peter HH, Eichmann K, Rao A. The duration of nuclear residence of NFAT determines the pattern of cytokine expression in human SCID T cells. J Immunol 2000;165:297-305. 14. Picard C, Al-Herz W, Bousfiha A, Casanova JL, Chatila T, Conley ME, et al. Primary Immunodeficiency Diseases: an Update on the Classification from the International Union of Immunological Societies Expert Committee for Primary Immunodeficiency 2015. J Clin Immunol 2015;35:696-726. 15. Lacruz RS, Feske S. Diseases caused by mutations in ORAI1 and STIM1. Ann N Y Acad Sci 2015;1356:45-79. 16. Feske S. CRAC channelopathies. Pflugers Arch 2010;460:417-35. 17. Picard C, Casanova JL, Puel A. Infectious Diseases in patients with IRAK-4, MyD88, NEMO, or I kappa B alpha ceficiency. Clin Microbiol Rev 2011;24: 490-7. 18. Boisson B, Puel A, Picard C, Casanova JL. Human IkappaBalpha gain of function: a severe and syndromic immunodeficiency. J Clin Immunol 2017;37: 397-412. 19. Maus M, Jairaman A, Stathopulos PB, Muik M, Fahrner M, Weidinger C, et al. Missense mutation in immunodeficient patients shows the multifunctional roles of coiled-coil domain 3 (CC3) in STIM1 activation. Proc Natl Acad Sci U S A 2015;112:6206-11. 20. Feske S. Immunodeficiency due to defects in store-operated calcium entry. Ann N Y Acad Sci 2011;1238:74-90. 21. Hou X, Pedi L, Diver MM, Long SB. Crystal structure of the calcium releaseactivated calcium channel Orai. Science 2012;338:1308-13. 22. Yen M, Lokteva LA, Lewis RS. Functional analysis of Orai1 concatemers supports a hexameric stoichiometry for the CRAC channel. Biophys J 2016;111: 1897-907. 23. Yamashita M, Yeung PSW, Ing CE, McNally BA, Pomes R, Prakriya M. STIM1 activates CRAC channels through rotation of the pore helix to open a hydrophobic gate. Nat Commun 2017;8:14512. 24. Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG. Orai1 is an essential pore subunit of the CRAC channel. Nature 2006;443:230-3. 25. Lin FF, Elliott R, Colombero A, Gaida K, Kelley L, Moksa A, et al. Generation and characterization of fully human monoclonal antibodies against human Orai1 for autoimmune disease. J Pharmacol Exp Ther 2013;345:225-38. 26. Maul-Pavicic A, Chiang SC, Rensing-Ehl A, Jessen B, Fauriat C, Wood SM, et al. ORAI1-mediated calcium influx is required for human cytotoxic lymphocyte degranulation and target cell lysis. Proc Natl Acad Sci U S A 2011;108: 3324-9. 27. Desvignes L, Weidinger C, Shaw P, Vaeth M, Ribierre T, Liu M, et al. STIM1 controls T cell-mediated immune regulation and inflammation in chronic infection. J Clin Invest 2015;125:2347-62. 28. Elling R, Keller B, Weidinger C, Haffner M, Deshmukh SD, Zee I, et al. Preserved effector functions of human ORAI1- and STIM1-deficient neutrophils. J Allergy Clin Immunol 2016;137:1587-91.e7. 29. Vaeth M, Eckstein M, Shaw PJ, Kozhaya L, Yang J, Berberich-Siebelt F, et al. Store-operated Ca21 entry in follicular T cells controls humoral immune responses and autoimmunity. Immunity 2016;44:1350-64.

14 LIAN ET AL

30. Yu N, Li XM, Song WY, Li DM, Yu DL, Zeng XF, et al. CD4(1)CD25(1) CD127(low/-) T cells: a more specific Treg population in human peripheral blood. Inflammation 2012;35:1773-80. 31. Oh-hora M, Komatsu N, Pishyareh M, Feske S, Hori S, Taniguchi M, et al. Agonist-selected T cell development requires strong T cell receptor signaling and store-operated calcium entry. Immunity 2013;38:881-95. 32. Crosby CM, Kronenberg M. Invariant natural killer T cells: front line fighters in the war against pathogenic microbes. Immunogenetics 2016;68:639-48. 33. Vantourout P, Hayday A. Six-of-the-best: unique contributions of gammadelta T cells to immunology. Nat Rev Immunol 2013;13:88-100. 34. Maus M, Cuk M, Patel B, Lian J, Ouimet M, Kaufmann U, et al. Store-operated Ca21 entry controls induction of lipolysis and the transcriptional reprogramming to lipid metabolism. Cell Metabolism 2017;25:698-712. 35. Vaeth M, Maus M, Klein-Hessling S, Freinkman E, Yang J, Eckstein M, et al. Store-operated Ca21 entry controls clonal expansion of T cells through metabolic reprogramming. Immunity 2017;47:664-79. 36. Bohm J, Bulla M, Urquhart JE, Malfatti E, Williams SG, O’Sullivan J, et al. ORAI1 mutations with distinct channel gating defects in tubular aggregate myopathy. Hum Mutat 2017;38:426-38. 37. Endo Y, Noguchi S, Hara Y, Hayashi YK, Motomura K, Miyatake S, et al. Dominant mutations in ORAI1 cause tubular aggregate myopathy with hypocalcemia via constitutive activation of store-operated Ca(2)(1) channels. Hum Mol Genet 2015;24:637-48. 38. Doffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, et al. X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling. Nat Genet 2001;27:277-85. 39. Jain A, Ma CA, Liu S, Brown M, Cohen J, Strober W. Specific missense mutations in NEMO result in hyper-IgM syndrome with hypohydrotic ectodermal dysplasia. Nat Immunol 2001;2:223-8. 40. Zhang SL, Yeromin AV, Hu J, Amcheslavsky A, Zheng H, Cahalan MD. Mutations in Orai1 transmembrane segment 1 cause STIM1-independent activation of Orai1 channels at glycine 98 and channel closure at arginine 91. Proc Natl Acad Sci U S A 2011;108:17838-43. 41. McNally BA, Yamashita M, Engh A, Prakriya M. Structural determinants of ion permeation in CRAC channels. Proc Natl Acad Sci U S A 2009;106:22516-21. 42. McNally BA, Somasundaram A, Yamashita M, Prakriya M. Gated regulation of CRAC channel ion selectivity by STIM1. Nature 2012;482:241-5. 43. Kim KD, Srikanth S, Yee MK, Mock DC, Lawson GW, Gwack Y. ORAI1 deficiency impairs activated T cell death and enhances T cell survival. J Immunol 2011;187:3620-30. 44. Mavilio D, Lombardo G, Benjamin J, Kim D, Follman D, Marcenaro E, et al. Characterization of CD56-/CD161 natural killer (NK) cells: a highly dysfunctional NK subset expanded in HIV-infected viremic individuals. Proc Natl Acad Sci U S A 2005;102:2886-91. 45. Bjorkstrom NK, Ljunggren HG, Sandberg JK. CD56 negative NK cells: origin, function, and role in chronic viral disease. Trends Immunol 2010;31:401-6. 46. Yokobori N, Schierloh P, Geffner L, Balboa L, Romero M, Musella R, et al. CD3 expression distinguishes two gammadeltaT cell receptor subsets with different phenotype and effector function in tuberculous pleurisy. Clin Exp Immunol 2009;157:385-94.

J ALLERGY CLIN IMMUNOL nnn 2017

47. Chowers Y, Holtmeier W, Harwood J, Morzycka-Wroblewska E, Kagnoff MF. The V delta 1 T cell receptor repertoire in human small intestine and colon. J Exp Med 1994;180:183-90. 48. Das H, Sugita M, Brenner MB. Mechanisms of Vdelta1 gammadelta T cell activation by microbial components. J Immunol 2004;172:6578-86. 49. Pitard V, Roumanes D, Lafarge X, Couzi L, Garrigue I, Lafon ME, et al. Longterm expansion of effector/memory Vdelta2-gammadelta T cells is a specific blood signature of CMV infection. Blood 2008;112:1317-24. 50. Vaeth M, Yang J, Yamashita M, Zee I, Eckstein M, Knosp C, et al. ORAI2 modulates store-operated calcium entry and T cell-mediated immunity. Nat Commun 2017;8:14714. 51. Oh-Hora M, Yamashita M, Hogan PG, Sharma S, Lamperti E, Chung W, et al. Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol 2008; 9:432-43. 52. Concepcion AR, Vaeth M, Wagner LE, Eckstein M, Hecht L, Yang J, et al. Storeoperated Ca21 entry regulates Ca21-activated chloride channels and eccrine sweat gland function. J Clin Invest 2016;126:4303-18. 53. Schaballie H, Rodriguez R, Martin E, Moens L, Frans G, Lenoir C, et al. A novel hypomorphic mutation in STIM1 results in a late-onset immunodeficiency. J Allergy Clin Immunol 2015;136:816-9.e4. 54. Zonana J, Elder ME, Schneider LC, Orlow SJ, Moss C, Golabi M, et al. A novel X-linked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK-gamma (NEMO). Am J Hum Genet 2000;67:1555-62. 55. Nurbaeva MK, Eckstein M, Concepcion AR, Smith CE, Srikanth S, Paine ML, et al. Dental enamel cells express functional SOCE channels. Sci Rep 2015;5: 15803. 56. Zheng L, Zinn V, Lefkelidou A, Taqi N, Chatzistavrou X, Balam T, et al. Orai1 expression pattern in tooth and craniofacial ectodermal tissues and potential functions during ameloblast differentiation. Dev Dyn 2015;244: 1249-58. 57. Eckstein M, Vaeth M, Fornai C, Vinu M, Bromage TG, Nurbaeva MK, et al. Store-operated Ca21 entry controls ameloblast cell function and enamel development. JCI Insight 2017;2:e91166. 58. Furukawa Y, Haruyama N, Nikaido M, Nakanishi M, Ryu N, Oh-Hora M, et al. Stim1 regulates enamel mineralization and ameloblast modulation. J Dent Res 2017;96:1422-9. 59. Jorgensen SE, Bottger P, Kofod-Olsen E, Holm M, Mork N, Orntoft TF, et al. Ectodermal dysplasia with immunodeficiency caused by a branch-point mutation in IKBKG/NEMO. J Allergy Clin Immunol 2016;138:1706-9.e4. 60. Courtois G, Smahi A, Reichenbach J, Doffinger R, Cancrini C, Bonnet M, et al. A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. J Clin Invest 2003; 112:1108-15. 61. Kawai T, Nishikomori R, Heike T. Diagnosis and treatment in anhidrotic ectodermal dysplasia with immunodeficiency. Allergol Int 2012;61:207-17. 62. Gwack Y, Srikanth S, Oh-Hora M, Hogan PG, Lamperti ED, Yamashita M, et al. Hair loss and defective T- and B-cell function in mice lacking ORAI1. Mol Cell Biol 2008;28:5209-22.

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

METHODS Case reports Patient P1. P1 is the index patient (A-II-1 in Fig 1, A) of kindred A (Tables I; Table E2; and Fig E2, A). The patient is a 13-year-old boy born to consanguineous parents of Nova Scotian origin. From 2 weeks of age, he had continuous rhinorrhea and prolonged rotavirus enteritis. He received a diagnosis of lobar pneumonia and was treated with antibiotics, with some benefit at age 6 months. He had failure to thrive and increased breathing difficulties suggestive of bronchiolitis at the time. Because of a lack of clinical improvement and abnormalities in immunoglobulins and lymphocyte subsets, a lung biopsy was performed, which showed an extensive P jirovecii infection. The patient was treated with trimethoprim-sulfamethoxazole and responded eventually with complete recovery. No signs of autoimmunity, such as AIHA or thrombocytopenia, were apparent. A relative of patient P1 (the daughter of his maternal grandfather’s brother) died of P jirovecii pneumonia at approximately 3 years of age 40 years ago and had received a diagnosis of Nezelof syndrome, which was associated with reduced T-cell proliferation. The immunologic analysis of patient P1 at 7 months showed a normal white blood cell count, including normal numbers of absolute lymphocytes and lymphocyte subsets (see Table E2). His CD41 T cells were 95% CD45RO1 and 5% CD45RA1, indicating a paucity of naive CD41 T cells. His B cells were 68% IgD1, 8% IgM1, 4% IgG1, and 20% IgA1 at the cell surface. Patient P1 showed dysgammaglobulinemia with normal IgG levels but increased IgM and IgA levels. Immunoelectrophoresis showed oligoclonal IgA and increased lambda chains. No specific antibodies to immunization with diphtheria, tetanus, and pneumococcus were detectable. Lymphocyte proliferation studies showed essentially no response to mitogens (PHA, concanavalin A, pokeweed mitogen, and anti-CD3), antigens (S aureus, tetanus toxoid, diphtheria toxoid, and C albicans), and mixed lymphocyte cultures (see Table E2). Because of his severely impaired T-cell function and infections, patient P1 was treated at 13 months of age with a matched HSCT from an unrelated donor, which engrafted well and was complicated only by mild episodes of graft-versus-host disease that were treated with cyclosporine and steroids. At 13 years of age, he is in immunologic remission with normal T- and Bcell numbers, a diverse TCR Vb repertoire, normal T-cell proliferation to mitogens and antigens, and mixed lymphocyte cultures. His serum immunoglobulin levels are normal, and he responded well to both protein and polysaccharide antigens (except for hepatitis B), as well as live virus vaccines. In addition to CID, patient P1 has congenital muscular hypotonia. As an infant, he was floppy and showed delayed sitting and walking with discernible gait problems, which were initially thought to be related to his chronic illness and later ascribed to a steroid myopathy. Detailed muscular assessment at approximately 3.5 years of age showed reasonable strength in his upper extremities but considerable weakness of his facial muscles and a positive Gower sign. His fine motor development was normal. He had right-eye esotropia, which was treated by surgery. Results of electromyography and nerve conduction studies performed at the time were normal. A muscle biopsy of the right gastrocnemius muscle followed by ATPase staining showed an almost complete absence of type 2 muscle fibers (Fig E3, D). No evidence of inflammatory muscle changes was found. Patient P1’s myopathy continues to slowly worsen, and at 6 years of age, he began to use a wheelchair intermittently especially at school. Patient P1 shows symptoms of anhidrotic ectodermal dysplasia. He has mild hypotrichosis and produces very little sweat in response to iontophoresis, despite normalappearing sweat glands in a skin biopsy specimen taken at age 9 years (Fig E4, B).E1 His dental development at 8 months showed pitted enamel hypoplasia and hypomineralization of incisors. He had multiple dental abscesses, 6 of his permanent teeth have been extracted, and virtually all other teeth had to be capped. Patient P1 also has mild hypotrichosis. At 3 and 4 years of age, the patient fractured his tibia and humerus, respectively, after minor falls. His bone mineral density at age of 4 years was significantly below normal. He is very bright intellectually, and no cognitive deficits have been observed. Patient P2. Patient P2 is the index patient (B-II-1 in Fig 1, C) of kindred B (Table I; Table E2; and Fig E2, B). She was born at term to unrelated parents and has 1 healthy sister. Patient P2 presented acutely at age of 2 months with

LIAN ET AL 14.e1

irritability, opisthotonus, tachycardia, tachypnea, hyperpyrexia, vomiting, diarrhea, and dehydration. A chest x-ray film showed bilateral lung infiltrates, and her cerebrospinal fluid contained 176 cells. Because of her meningitis, pneumonia, and gastroenteritis of unresolved etiology, an empiric antimicrobial treatment regimen was started, which improved her condition at that time. At 3.5 months of age, patients P2 deteriorated severely because of Klebsiella and Candida species sepsis, massive bilateral pneumonia (caused by S aureus), and pneumonitis (210,000 copies of CMV DNA/mL of bronchoalveolar lavage fluid). She was treated with various antibiotics but without lasting results. At 6 months of age, patient P2 had sepsis caused by Enterococcus cloacae and C albicans, resulting in a life-threatening condition with disturbed consciousness, tachycardia, tachypnea and poor capillary perfusion. From age 6 months, patient P2 had several life-threatening infections caused by RSV, norovirus, Salmonella enteritidis, C albicans, Klebsiella pneumoniae, and S aureus, which resulted in progressively deteriorating respiratory function and acute respiratory distress syndrome, pulmonary fibrosis, and pulmonary hypertension necessitating mechanical ventilation. Despite intensive care, patient P2 died at 7.5 months of age from various infections, including disseminated CMV and gram-negative cocci. The immunologic analysis of patient P2 at 4 months of age showed normal total lymphocyte counts and numbers of B cells but an increased CD4/CD8 Tcell ratio (Table I and Table E2). Intracellular cytokine staining of CD81 T cells demonstrated undetectable IFN-g production on 2 occasions. By contrast, test results for phagocytosis, respiratory burst, and NK cell activity were normal. Patient P2 had hypergammaglobulinemia and dysgammaglobulinemia (IgG, 25 g/L; IgE, 666 kIU/L; IgA, 3.53 g/L; and IgM, 1.66 g/L; Table E2). Her anti-CMV IgM serology at age 6 months was negative but positive for CMV DNA detected by using PCR in plasma (246,000 copies of CMV DNA/ mL) and bronchoalveolar lavage fluid (221,000 copies of CMV DNA/mL). When patient P2 first presented at 2 months of age, she appeared pale and was anemic (hematocrit, 0.23; hemoglobin, 75 g/L) and received blood transfusions to correct her anemia. In addition, she was thrombocytopenic and leukopenic at 7 months of age. Throughout her life, patient P2 presented with moderate hepatosplenomegaly, as well as cervical and inguinal lymphadenopathy. In addition to CID, patient P2 had congenital muscular hypotonia, muscular hypotrophy, and failure to thrive. She was sluggish with poor head control, was hyperextensive, lacked spontaneous movements, and lacked facial mimicking. Her muscular hypotonia affected mostly the facial, axial, and respiratory musculature, contributing to her respiratory failure. She had mydriasis with very slow pupil reactions to direct light. A biopsy specimen from the deltoid muscle at 6 months of age showed variable fiber size but otherwise normally structured fibers (Fig E3, C). Histochemical analysis of frozen sections showed normal periodic acid–Schiff (PAS), Gomory trichrome, and oil-red O staining. Staining for oxidative enzymes NADH, succinate dehydrogenase (SDH), COX and menadione was normal and showed a mosaic pattern of type I and II muscle fibers. Electron microscopic (EM) analysis revealed accumulation of glycogen, increased numbers and size of lipid droplets, swelling of the sarcoplasmic reticulum, and myelin-like figures as an unspecific sign of myopathy (Fig E3, E-L). Furthermore, EM showed increased numbers of mitochondria that appeared swollen and had dissolved cristae structure. Patient P2 also showed symptoms of EDA. Her hair was sparse, thin, brittle, and prone to fall off, whereas her nails looked normal. She was unable to sweat, resulting in dry and exfoliate skin. Patients P3 and P4. Patient P3 is the index patient (C-II-2 in Fig 1, E) of kindred C (Table I; Table E2; and Fig E2, C) and the younger brother of patient P4. He was born at term to unrelated parents. He first presented with acute RSV-positive bronchiolitis at 10 days after birth. Given the CID and autoimmunity of his older sister, patient P3 was hospitalized at 1 month of age and initially managed in accordance with UK PIDNet standards of care for patients with CID, including protective isolation measures and opportunistic infection prevention. Nevertheless, he had infections with a wide spectrum of pathogens, including Stenotrophomonas species, extended-spectrum b-lactamase–producing K pneumoniae, C albicans, and Aspergillus fumigatus. Patient P3 also had persistent CMV infection

14.e2 LIAN ET AL

(up to 20,000 copies of CMV DNA/mL of plasma), which was resistant to standard treatment with ganciclovir but responded to treatment with foscarnet and CMV-specific and nonspecific immunoglobulins (<1000 copies of CMV DNA/mL of plasma). Because patient P3 had received BCG vaccination, he was provided with antimycobacterial treatment. His immunologic analysis in the first months after birth revealed increased percentages of CD41 T cells (71%) but decreased numbers of naive CD45RA1CD41 T cells. His CD81 T-cell counts (9%) and CD191 B-cell counts were reduced (Table E2). His T cells showed poor or no proliferation after stimulation with mitogens (PHA and phorbol 12-myristate 13-acetate/ ionomycin) and anti-CD3 (OKT3), respectively (Table E2). Serum immunoglobulin levels were strongly increased, in particular IgE levels. At 3 months of age, patient P3 received a diagnosis of Coombs-positive AIHA. In addition to autoantibodies against erythrocytes, he had positive test results for antiphospholipid antibodies including anticardiolipin (aCL), and anti-beta 2 glycoprotein-1 (anti-b2 GP1), as well as antinuclear antibodies (ANA) and antineutrophil cytoplasmic antibodies (ANCA). In addition to CID, patient P3 had congenital, nonprogressive muscular hypotonia involving the facial, respiratory, and axial musculature. Muscular hypotonia manifested with poor head control, diminished motor activity, blunted deep tendon reflexes and overall delayed motor development (Fig E3, A). Patient P3 had mydriasis and showed slow pupillary light reflexes due to bilateral partial iris hypoplasia (Fig E3, B) and showed slow pupillary light reflexes. H&E stains of a quadriceps muscle biopsy specimen at 2.5 months showed normally structured fibers (not shown). Histochemical analysis of frozen sections showed normal PAS, Gomory trichrome, and oil-red O staining. Stain results for the oxidative enzymes NADH, SDH, COX and menadione, were normal and showed a mosaic pattern of type I and II muscle fibers. EM showed increased numbers of mitochondria, appearing swollen and with dissolved cristae structure; in addition, signs of mitophagy were present (Fig E3, K-L). A mitochondrial respiratory chain enzyme analysis in skeletal muscle showed normal results. Furthermore, patient P3 showed symptoms of anhidrotic ectodermal dysplasia. His skin was very dry and exfoliate, and his hair was sparse, thin, and brittle (Fig E4, D). A sweat test using pilocarpin iontophoresis confirmed the diagnosis of anhidrosis. At 3 months of age, patient P3 experienced several attacks of facial flashing accompanied by tachycardia, tachypnea, and hypertension (similar to his sister, patient P4), potentially because of his inability tolerate sweat and heat. The teeth of patient P3 showed severely cracked and chipped enamel and loss of cuspal enamel with exposure of underlying dentine (yellow). The visible discoloration and excessive wear and loss of enamel on the teeth indicate a developmental defect consistent with the diagnosis of hypocalcified amelogenesis imperfecta (type III; Fig E4, C). Because of his CID and that of his older deceased sister, patient P4, patient P3 was treated with HSCT at 7 months of age with an HLA-matched donor. Patient P4 (C-II-1 in Fig 1, E; Table I; Table E2; and Fig E2, C) is the older sister of patient P3. She was born at term but failed to thrive, and from approximately 3.5 months of age, she experienced frequent, severe, and prolonged upper and lower respiratory tract infections (bronchiolitis, pneumonia, and pneumonitis) caused by a large spectrum of bacteria (mostly P aeruginosa, S aureus, and K pneumoniae), fungi (A fumigatus and C albicans), and viruses (RSV, CMV, adenovirus, influenza, and parainfluenza). Repeated episodes of gastroenteritis were caused by adenovirus or rotavirus infections. During her first year, patient P4 had disseminated and chronic CMV infection with approximately 2,670,000 copies of CMV DNA/mL of plasma despite yearlong treatment with ganciclovir, foscarnet, and anti–CMV-specific immunoglobulins. A lung biopsy specimen showed severe CMV pneumonitis (Fig E4, A) At 6.5 months of age, she had BCGitis after BCG vaccination and was treated with tuberculostatics for several months. In her second year her respiratory failure became more pronounced, necessitating mechanical ventilation and intensive care management on several occasions. She continued to experience multiple infections, including with Enterococcus faecalis, Acinetobacter baumannii, Pseudomonas aeruginosa, S aureus, K pneumoniae, and disseminated CMV infection at 16 months, causing pneumonitis, chorioretinitis with blindness, colitis, and encephalitis. From 7 months onward, patient P4 had autoimmunity with several lifethreatening episodes of AIHA (hemoglobin, 4 g/dL; hematocrit 0.1). In her second year patient P4 had several severe episodes of acute bleeding from the

J ALLERGY CLIN IMMUNOL nnn 2017

gastrointestinal tract caused by autoimmune thrombocytopenia and cytomegalovirus-associated colitis, resulting in circulatory shock. In addition, she was given a diagnosis of autoimmune neutropenia and anti-phospholipid syndrome with increased levels of antibodies against phospholipids including anti-beta 2 glycoprotein-1 (anti-b2 GP1, 52 U/mL) and anticardiolipin (aCLIgG, 121 U/mL; aCL-IgM, 25 U/mL). She also had positive direct and indirect Coombs test results and antiplatelet antibody levels. The immunologic analysis of patient P4 at 4.5 months of age showed an abnormal CD4/CD8 ratio with a significant increase in CD41 and decrease in CD81 T-cell counts (Table E2). Flow cytometric analysis of cytokine levels showed very low IFN-g production by CD81 T cells after phorbol 12-myristate 13-acetate and ionomycin stimulation on 3 occasions. Patient P4 also had hypergammaglobulinemia (IgG, 25 g/L; IgE, 7169 kIU/L). In addition to CID, patient P4 had congenital muscular hypotonia with delayed motor development. She was sluggish from birth, with very poor head control, blunted deep tendon reflexes, diminished motor activity, and wormlike movements. Her marked muscular hypotonia affected mostly facial, axial, and respiratory musculature with a tendency for intermittent respiratory failure. She had mydriasis with unresponsive pupils and rotatory nystagmus. H&E stains of deltoid muscle biopsy specimens at 6 months of age showed variably sized muscle fibers but otherwise normally structured fibers. Histochemical analysis of frozen sections showed normal PAS, Gomory trichrome, and oil-red O staining. Stains for oxidative enzymes NADH, SDH, COX, and menadione were normal and showed a mosaic pattern of type I and II muscle fibers. EM of the same muscle biopsy showed increased numbers and size of the lipid droplets but no specific mitochondrial abnormalities. The activity of respiratory chain complexes I and IV was reduced (complex I: 0.048 U/unit citrate synthase [UCS; normal range, 0.17-0.56 U/UCS] and 3.0 U/g noncollagen protein [gNCP; normal range, 15.8-42.8 U/gNCP]; complex IV: 0.862 U/UCS [normal range, 1.1-5 U/UCS] and 53.6 U/gNCP [normal range, 112-351 U/gNCP]), whereas complex II/III function was normal (0.2 U/UCS [normal range, 0.08-0.45 U/UCS]) as reported by Maus et al,E2 suggesting a mitochondrial cause of her myopathy. Sequencing of mitochondrial DNA for mutations of transfer RNA genes was normal, and mitochondrial DNA depletion was excluded by using real-time PCR. Urine organic acid analysis revealed increased levels of ethylmalonic and glutaric acid, as observed in some patients with mitochondriopathies. Patient P4 also showed symptoms of EDA. Her teeth at 10 months of age showed yellowish discoloration. Her skin was very dry and exfoliate, and her hair was sparse, thin, fragile, and brittle. A sweat pilocarpine sweat test confirmed the diagnosis of anhidrosis. After 6 months, her anhidrosis resulted in thermoregulatory instability, attacks of facial blushing, hypertension, tachycardia (up to 200-250/min), and tachypnea (up to 100/min). Patient P4 died at 2.5 years of age of multiple infections, including disseminated CMV infection and respiratory failure. Patient P6. Patient P6 has been reported previously.E3-E5 He is homozygous for an ORAI1 p.R91W missense mutation that abolishes SOCE. Clinically, patient P6 had CRAC channelopathy with CID, autoimmunity, muscular hypotonia, and EDA (Table I and Tables E1 and E2).E6 At 4 months of age, he received HSCT to cure his CID, which resulted in mixed chimerism with the presence of both donor and recipient cells in his PBMCs. When patient P6 was re-evaluated for chimerism of his PBMCs at 15 years of age, no donor NK cells and only 5% to 15% donor T and B cells were detectable by using short tandem repeat analysis.E7 At 19 years of age, repeat testing of his PBMCs showed complete autologous reconstitution of his granulocyte compartment and complete lack of SOCE in his CD41 and CD81 T cells,E8,E9 indicating that all T cells in the 19-year-old patient P6 were autologous and not of HSCT donor origin. PBMCs were isolated from patient P6 at 20 years of age before he received a second HSCT (to prevent a recurrence of his CID) and used for this study.

DNA sequencing analyses Genomic DNA was extracted from cells with the FlexiGene DNA Kit (Qiagen, Hilden, Germany). PCR was conducted with the following primers flanking exons 1 and 2 of the ORAI1 gene: exon 1, forward 59ACAACAACGCCCACTTCTTGGTGG and reverse 59TGCTCACGTCC

LIAN ET AL 14.e3

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

AGCACCTC; exon 2, forward 59TCTTGCTTTCTGTAGGGCTTTCTG and reverse 59TCTCAAAGGAGCTGGAAGTGC. PCR products were separated on 1.5% agarose gels, excised with the Qiagen Gel Extraction Kit, and sequenced directly (Genewiz, South Plainfield, NJ) by using the following primers: exon 1, forward 59AGCATGCAAAACAGCCCAGG and reverse 59ACGGTTTCTCCCAGCTCTTC; exon 2, forward 59TGACAGGAGG AGAGCTAGG and reverse 59AAGAGATCCTCCTGCCTTGG. Sequence alignments were performed with T-Coffee software (Swiss Institute of Bioinformatics, http://tcoffee.vital-it.ch/cgi-bin/Tcoffee_cgi/index.cgi), and sequence traces were visualized with Sequence Scanner, version 1.0. Combined Annotation-Dependent Depletion scores were calculated by using combined annotation-dependent depletion analysis available on the Mutation Significance Cutoff Server (http://pec630.rockefeller.edu:8080/MSC/).

Synthesis of cDNA and quantitative real-time PCR Total RNA was extracted from T cells and fibroblasts by using TRIzol Reagent (Invitrogen, Carlsbad, Calif). cDNA was synthesized with Superscript II RT (Invitrogen), according to the manufacturer’s instructions. Realtime PCR was performed with the iCycler system (Bio-Rad Laboratories, Hercules, Calif), the SYBR green PCR kit (Applied Biosystems, Foster City, Calif), and the following primers: ORAI1, forward 59TCAACGAG CACTCCATGCAG and reverse 59GGACGCTGACCACGACTA; glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 59CGCTC TCTGCTCCTCCTGTT and reverse 59CCATGGTGTCTGAGCGATGT. ORAI1 mRNA expression was normalized to GAPDH expression and calculated by using the 22DCT method with the following formula: 22ðCT ðORAI1Þ2CT ðGAPDHÞÞ :

Plasmids and retroviral transduction Bicistronic retroviral vectors containing the coding sequences of wild-type ORAI1 or STIM1 and an internal ribosome entry site–green fluorescent protein sequence have been described previously.E9 Retroviral supernatants were generated by transfecting HEK293 cells with STIM1, ORAI1, or empty vectors, as well as gag-pol and VSV-G packaging plasmids (Addgene, Cambridge, Mass). Two days later, viral supernatants were harvested and used for transduction of fibroblasts from patients and control subjects. After removal of cell debris by means of centrifugation, the viral supernatant supplemented with 6 mg/mL polybrene was added directly to fibroblasts for 8 hours. The transduction efficiency was evaluated by using green fluorescent protein expression.

Time-lapse Ca21 imaging Fibroblasts from patients and HD control subjects were seeded on sterilized 15-mm glass coverslips overnight and loaded for 45 minutes at room temperature with 3 mmol/L Fura-2 AM (Invitrogen) in RPMI 1640 medium containing 10% FCS, 1% L-glutamate, 1% HEPES, and 1% penicillin/ streptomycin before mounting in an RC20 flow chamber (Warner Instruments, Hamden, Conn). T cells were loaded with 1 mmol/L Fura-2 AM and attached to coverslips with poly-L-lysine. Fibroblasts and T cells were perfused with Ringer solution (155 mmol/L NaCl, 4.5 mmol/L KCl, 1-2 mmol/L CaCl2, 1 mmol/L MgCl2, 10 mmol/L D-glucose, and 5 mmol/L Na-Hepes, pH 7.4). Ca21-free Ringer solution was prepared by substituting 2 mmol/L MgCl2 for CaCl2. Cells were stimulated with thapsigargin (1 mmol/L; EMD Biosciences, San Diego, Calif) to deplete intracellular Ca21 stores. Fura-2 emission was detected at 510 nm after excitation at 340 and 380 nm with an Olympus IX81 inverted epifluorescence microscope and SlideBook imaging software v4.2 (Olympus). Fura-2 emission ratios (340 nm/380 nm) were calculated every 5-second interval after background subtraction. The number of cells analyzed per experiment are indicated in the figure legends. Ca21 influx rates were inferred from the maximal rate of the initial rise of Fura-2 emission ratios in the first 20 seconds after Ca21 readdition.

Modeling of human ORAI1 structure and mutations Homology models of the human ORAI1 protein structure were generated based on the Drosophila melanogaster Orai crystal structure (4HKR.pdb) as a template using MODELLER software (version 9.16).E10 First, the human dimer unit was modeled with the fly:human sequence alignment, as reported previously.E11 Subsequently, the ORAI1 hexamer was assembled by means of backbone atom superposition of the modeled human dimer with each of the fly dimer units. G98R and L194P mutations found in human patients were modeled by using a similar approach after the respective sequence modifications. These models orient the mutant side chains in positions that are homologous to the wild-type residues and do not show the precise structural consequences of the substitutions, which requires new high-resolution structural data.E4,E12-E17 REFERENCES E1. Concepcion AR, Vaeth M, Wagner LE, Eckstein M, Hecht L, Yang J, et al. Store-operated Ca21 entry regulates Ca21-activated chloride channels and eccrine sweat gland function. J Clin Invest 2016;126:4303-18. E2. Maus M, Cuk M, Patel B, Lian J, Ouimet M, Kaufmann U, et al. Store-operated Ca21 entry controls induction of lipolysis and the transcriptional reprogramming to lipid metabolism. Cell Metabolism 2017;25:698-712. E3. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, et al. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006;441:179-85. E4. Feske S, Draeger R, Peter HH, Eichmann K, Rao A. The duration of nuclear residence of NFAT determines the pattern of cytokine expression in human SCID T cells. J Immunol 2000;165:297-305. E5. Feske S, Muller JM, Graf D, Kroczek RA, Drager R, Niemeyer C, et al. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in T lymphocytes of two male siblings. Eur J Immunol 1996;26:2119-26. E6. Lacruz RS, Feske S. Diseases caused by mutations in ORAI1 and STIM1. Ann N Y Acad Sci 2015;1356:45-79. E7. Maul-Pavicic A, Chiang SC, Rensing-Ehl A, Jessen B, Fauriat C, Wood SM, et al. ORAI1-mediated calcium influx is required for human cytotoxic lymphocyte degranulation and target cell lysis. Proc Natl Acad Sci U S A 2011;108: 3324-9. E8. Elling R, Keller B, Weidinger C, Haffner M, Deshmukh SD, Zee I, et al. Preserved effector functions of human ORAI1- and STIM1-deficient neutrophils. J Allergy Clin Immunol 2016;137:1587-91.e7. E9. Desvignes L, Weidinger C, Shaw P, Vaeth M, Ribierre T, Liu M, et al. STIM1 controls T cell-mediated immune regulation and inflammation in chronic infection. J Clin Invest 2015;125:2347-62. E10. Webb B, Sali A. Comparative protein structure modeling using MODELLER. Curr Protoc Bioinformatic 2014;475.6.1-32. E11. Hou X, Pedi L, Diver MM, Long SB. Crystal structure of the calcium releaseactivated calcium channel Orai. Science 2012;338:1308-13. E12. Byun M, Abhyankar A, Lelarge V, Plancoulaine S, Palanduz A, Telhan L, et al. Whole-exome sequencing-based discovery of STIM1 deficiency in a child with fatal classic Kaposi sarcoma. J Exp Med 2010;207:2307-12. E13. Le Deist F, Hivroz C, Partiseti M, Thomas C, Buc HA, Oleastro M, et al. A primary T-cell immunodeficiency associated with defective transmembrane calcium influx. Blood 1995;85:1053-62. E14. Parry DA, Holmes TD, Gamper N, El-Sayed W, Hettiarachchi NT, Ahmed M, et al. A homozygous STIM1 mutation impairs store-operated calcium entry and natural killer cell effector function without clinical immunodeficiency. J Allergy Clin Immunol 2016;137:955-7.e8. E15. Partiseti M, Le Deist F, Hivroz C, Fischer A, Korn H, Choquet D. The calcium current activated by T cell receptor and store depletion in human lymphocytes is absent in a primary immunodeficiency. J Biol Chem 1994;269: 32327-35. E16. Wang S, Choi M, Richardson AS, Reid BM, Seymen F, Yildirim M, et al. STIM1 and SLC24A4 are critical for enamel maturation. J Dent Res 2014; 93(suppl):94S-100S. E17. Maus M, Jairaman A, Stathopulos PB, Muik M, Fahrner M, Weidinger C, et al. Missense mutation in immunodeficient patients shows the multifunctional roles of coiled-coil domain 3 (CC3) in STIM1 activation. Proc Natl Acad Sci U S A 2015;112:6206-11. E18. Dahmane R, Djordjevic S, Simunic B, Valencic V. Spatial fiber type distribution in normal human muscle Histochemical and tensiomyographical evaluation. J Biomech 2005;38:2451-9.

14.e4 LIAN ET AL

E19. McCarl CA, Picard C, Khalil S, Kawasaki T, Rother J, Papolos A, et al. ORAI1 deficiency and lack of store-operated Ca21 entry cause immunodeficiency, myopathy, and ectodermal dysplasia. J Allergy Clin Immunol 2009;124:1311-8.e7. E20. Chou J, Badran YR, Yee CSK, Bainter W, Ohsumi TK, Al-Hammadi S, et al. A novel mutation in ORAI1 presenting with combined immunodeficiency and residual T cell function. J Allergy Clin Immunol 2015;136:479-82.e1. E21. Badran YR, Massaad MJ, Bainter W, Cangemi B, Naseem SU, Javad H, et al. Combined immunodeficiency due to a homozygous mutation in ORAI1 that deletes the C-terminus that interacts with STIM 1. Clin Immunol 2016;166-7:100-2.

J ALLERGY CLIN IMMUNOL nnn 2017

E22. Picard C, McCarl CA, Papolos A, Khalil S, Luthy K, Hivroz C, et al. STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. Engl J Med 2009;360:1971-80. E23. Fuchs S, Rensing-Ehl A, Speckmann C, Bengsch B, Schmitt-Graeff A, Bondzio I, et al. Antiviral and regulatory T cell immunity in a patient with stromal interaction molecule 1 deficiency. J Immunol 2012;188:1523-33. E24. Schaballie H, Rodriguez R, Martin E, Moens L, Frans G, Lenoir C, et al. A novel hypomorphic mutation in STIM1 results in a late-onset immunodeficiency. J Allergy Clin Immunol 2015;136:816-9.e4.

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

FIG E1. Gating strategy to identify NK, iNKT and gd T cells. PBMCs from patient P6 and an HD control subject were stained with antibodies against CD3, HLA-DR, CD4, CD8, CD16, CD56, the invariant TCR Va24Ja18 chain, and gd TCR. CD32HLA-DR2 cells were analyzed further for different NK cell populations based on CD16 and CD56 expression. CD31 cells were analyzed for TCR Va24Ja181 iNKT cells. CD31 cells were analyzed further for CD41 and CD81 T cells. CD42CD81 and CD42CD82 (double negative [DN]) cells were analyzed for gd TCRdim and gd TCRhigh cells.

LIAN ET AL 14.e5

14.e6 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

A

Father (A-I-1)

B

Mother (A-I-2) C A C C G T C G T C A

C A C C G T C G T C A

del541C/WT V181SfsX8/WT

del541C/WT V181SfsX8/WT

P1

P2

C A C G T C

mRNA del541C protein V181SfsX8

C Father (C-I-1)

P4

(C-II-1)

mRNA protein

C

G292C G98R

T

(B-II-1)

T581C/T581 L194P/L194

Sister

(B-II-2)

T G C C C T

T G C T/C C T

mRNA T581C protein L194P

T581C/T581 L194P/L194

Mother (C-I-2)

T

T C C C/G G C

G292C/G292 G98R/G98

T C C C G

Mother (B-I-2) T G C T/C C T

T581C/T581 L194P/L194

(A-II-1)

T C C C/G G C

Father (B-I-1) T G C T/C C T

T

G292C/G292 G98R/G98

P3

Brother

(C-II-2)

T C C C G C

G292C G98R

T

(C-II-3)

T C C C/G G C

T

G292C/G292 G98R/G98

FIG E2. Genomic DNA sequences of patients from 3 unrelated kindreds with AR ORAI1 mutations. A, Kindred A. The index patient P1 (A-II-1) is homozygous for a del541C mutation in exon 2 of ORAI1 that results in a truncated ORAI1 p.V181SfsX8 protein. His healthy parents are heterozygous for the same mutation. B, Kindred B. The index patient P2 (B-II-1) is homozygous for a n.T581C transition in exon 2 of ORAI1 that results in a mutant ORAI1 p.L194P protein. Her healthy sister and parents are heterozygous for the same mutation. C, Kindred C. The index patient P3 (C-II-2) and his sister, P4 (C-II-1), are homozygous for a n.G292C transversion in exon 1 of ORAI1 that results in a mutant ORAI1 p.G98R protein. His healthy brother and parents are heterozygous for the same mutation.

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

FIG E3. Histologic and clinical findings in ORAI1-deficient patients related to their muscular hypotonia. A, Poor head control of patient P3 at approximately 3 months of age. B, Mydriasis due to partial iris hypoplasia in patient P3 at 3 months of age. C, H&E staining of muscle fibers of patient P2 shows no abnormalities. Magnification 340. D, ATPase stain of a biopsy specimen of the right gastrocnemius muscle of patient P1 at 5 years of age shows a predominance of type 1 muscle fibers (I, black arrowhead) and an almost complete absence of type 2 muscle fibers (II, yellow arrowhead). The normal frequency of type 1 fibers in gastrocnemius muscle is 54% to 63%.E18 E-L, EM of muscle biopsy specimens of patients P2 (Fig E3, E-J) and P3 (Fig E3, K and L). Cross-sections show several tight round myofibrils and signs of mitochondrial damage. Mitochondria in some muscle fibers appear swollen with dissolved cristae structure (Fig E3, E and H-J) compared with other fibers with healthy-looking mitochondria (Fig E3, E and G). Autophagic vacuoles with mitochondrial cargo are seen (Fig E3, K and L). Fig E3, G-J, show enlarged areas from Fig E3, E and F, as indicated by yellow boxes; Fig E3, K and L, are from additional regions. Magnification 320,000 (Fig E3, E, G, H, K, and L) and 340,000 (Fig E3, F, I, and J).

LIAN ET AL 14.e7

14.e8 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

FIG E4. Histologic and clinical findings in ORAI1-deficient patients related to their EDA and immunodeficiency. A, H&E staining of a lung biopsy specimen from patient P4 shows CMV pneumonitis with characteristic large cells that have a prominent basophilic nuclear inclusion and halo (arrow). Magnification 3100. B, H&E staining of a skin biopsy specimen of patient P1 at 1 year of age shows the presence of eccrine sweat glands in the dermis (arrows). C, Hypocalcified amelogenesis imperfecta (type III) in patient P3 at 6 years of age. Severely cracked and chipped enamel and loss of cuspal enamel with exposure of underlying dentine (yellow). The visible discoloration, excessive wear, and loss of enamel on the teeth indicate a developmental defect. D, Sparse, thin, and brittle hair of patient P3 at 18 months of age.

LIAN ET AL 14.e9

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

TABLE E1. Anti-human antibodies used for flow cytometry Antigen

Manufacturer

Clone

Conjugation

CD3 CD3 CD4 CD4 CD4 CD8 CD8 CD45RO CD45RO CD57 CD16 CD56 CD27 CCR7 HLA-DR Va24Ja18 TCR Foxp3 IL-2 IL-22 TNF-a gd TCR 1 streptavidin

BioLegend, San Diego, Calif BioLegend BioLegend BioLegend BioLegend BioLegend BioLegend BD PharMingen, San Jose, Calif BioLegend BioLegend BioLegend BioLegend BioLegend R&D Systems, Minneapolis, Minn BioLegend BioLegend BioLegend BioLegend eBioscience, San Diego, Calif BioLegend BD BioLegend

SK7 UCHT1 OKT4 RPA-T4 OKT4 HIT8a RPA-T8 UCHL1 UCHL1 HCD57 3G8 HCD56 O323 150503 L243 6B11 259D MQ1-17H12 22URTI MAb11 B1 —

APC-Cy7 Alexa Fluor 700 BV510 PE Alexa Fluor 700 Alexa Fluor 700 PE-Cy7 PE-Cy7 APC-Cy7 Pacific Blue Alexa Fluor 488 PerCP-Cy5.5 PE-Cy7 FITC APC-Cy7 APC PE Alexa Fluor 700 eF710 A488 Biotinylated BV605

ViabDye

eBioscience

—

eF506

APC, Allophycocyanin; FITC, fluorescein isothiocyanate; PE, phycoerythrin; PerCP, peridinin-chlorophyll-protein complex.

14.e10 LIAN ET AL

J ALLERGY CLIN IMMUNOL nnn 2017

TABLE E2. Immune cell populations and function of novel patients P1 to P4 Patient

ORAI1 mutation Age at analysis (mo) Lymphocytes (/mL) T cells (%) CD31 CD41 CD81 CD45RO1CD41 CD45RA1CD41 B cells (%) CD191 or B2201 NK cells (%) CD161CD561 T-cell proliferation (cpm) PHA Con A Pokeweed mitogen OKT3 OKT3 1 CD28 PMA 1 ionomycin Staphylococcus aureus Tetanus toxoid Diphtheria toxoid Candida albicans Mixed lymphocyte culture Serum antibodies IgM (g/L) IgG (g/L) IgA (g/L) IgE Seroconversion

Patient P1 (A-II-1)

Patient P2 (B-II-1)

Patient P3 (C-II-2)

Patient P4 (C-II-1)

Patient P5*

Patient P6*

V181SfsX8 7 5920

L194P 4 Normal

G98R 6 9800

G98R 4.5

R91W 5 9600

R91W 1 6800

82 (54-80) 79 (25-46) 9 (15-42)

85 (51-77) 70 (35-56) 11 (12-23)

75 (60-85) 46 (41-68) 24 (9-23)

71 (77-94)

73 (77-94)

12 (15-32)

2 (15-32)

59 44 14 95 5

(49-76) (31-56) (12-24) (5-12) (88-95)

High Low

82 71 9 92 8

(49-76) (31-56) (12-24) (5-12) (88-95)

25 (14-37)

Normal

8 (14-37)

5 (3-15)

Low

7 (3-15)

6 6 6 6

1.9 2.2 2.5 0.7

(69.1 (38.7 (32.4 (62.6

4.8) 3.1) 3.7) 4.3)

0.9 0.5 0.6 1.4 2.5

(4.3 6 0.7) (39.7 6 7.6) (23.5 6 5.3) (35.9 6 6.5) (16.5 6 2.7)

Increased Normal 6.01 (0.08-0.54) None

1.66 (0.26-0.96) 25.00 (1.88-5.36) 3.53 (0.04-0.72) 666 kIU/L None

9 (9-37) 6.2 (5-20)

32 (>50)

33 (80) 5 (68)

27.2 (71.2) 11.4 (50.5)

0.3 (>30) 29 (>80)

0.9 (130) 0.04 (3)

11.6 (45.4) 1 (31) 1 (30)

1.24 (0.34-0.95) 21.36 (2.4-4.4)  1.15 (0.2-0.62) >5000 kIU/L None

25.00 (1.88-5.36) 7169 kIU/L None

1.6 (0.3-0.9) 11.4 (2.3-5.5) 7.0 (0.1-0.6)

0.5 (0.3-0.9) 6.6 (2.3-5.5) 1.8 (0.1-0.6)

None

None

Values in parentheses indicate normal values for the indicated age and analyzing laboratory. For T-cell proliferation data, values in parentheses indicate counts per minute of T cells from HD control subjects. Con A, Concanavalin A; PHA, phytohemagglutinin; PMA, phorbol 12-myristate 13-acetate. *As published in McCarl et al, 2009.E19  After intravenous immunoglobulin infusion.

LIAN ET AL 14.e11

J ALLERGY CLIN IMMUNOL VOLUME nnn, NUMBER nn

TABLE E3. CRAC channelopathy causes EDA-ID Anhidrotic ectodermal dysplasia (EDA) Anhidrosis Gene

ORAI1

STIM1

Mutation

Clinical

Test

Dental enamel defect

p.V181SfsX8 (patient P1) p.L194P (patient P2) p.G98R (patient P3) p.G98R (patient P4) p.R91W p.R91W (P6) p.A88SfsX25 p.A103E/p.L194P p.H165PfsX1 p.R270X p.E128RfsX9 p.E128RfsX9 C1538-1 G>A p.R429C p.R429C p.R426C p.P165Q p.P165Q p.L74P p.L74P p.L374P p.L374P

Y Y Y Y NR Y Y Y NR NR NR NR NR Y Y Y Y Y Y Y Y Y

Y Y Y Y NR Y Y Y NT NT NT NT NT Y Y Y NT Y Y Y§ Y§ Y§

Y * Y  Y NR* Y  NR* Y  NR* NR* Y Y NR Y Y Y Y Y Y  Y  Y NR

Skin and hair

Immunodeficiency

References

Hypotrichosis Hypotrichosis Hypotrichosis Hypotrichosis NR N N N N N NR NR NR NR NR NR NR NR NR NR Hypotrichosis NR

Y Y Y Y Y Yk Y Y Y Y Y Y Y Y Y NR Y Y Yà Yà Yà Yà

This study This study This study This study Feske et al (1996)E5; Feske et al (2006)E3 Feske et al (2000)E4; Feske et al (2006)E3 Partiseti et al (1994)E15; McCarl et al (2009)E19 Le Deist et al (1995)E13; McCarl et al (2009)E19 Chou et al (2015)E20 Badran et al (2016)E21 Picard et al (2009)E22 Picard et al (2009)E22 Byun et al (2010)E12 Fuchs et al (2012)E23; Maus et al (2015)E17 Fuchs et al (2012)E23; Maus et al (2015)E17 Wang et al (2014)E16 Schaballie et al (2015)E24 Schaballie et al (2015)E24 Parry et al (2016)E14 Parry et al (2016)E14 Unpublished Unpublished

Shown in boldface are ORAI1 mutations reported in this article N, No; NR, not reported; NT, not tested; Y, Yes. *Patient died before complete dentition.  Hypocalcified amelogenesis imperfecta (type III). àModerate immunodeficiency. §Because of profound hypohidrosis, the sweat test was not possible. kPatient received a first curative HSCT at 4 months of age before onset of CID and received a second HSCT after CMV pneumonia and loss of donor chimerism in his PBMCs.